Download Plant and soil

Author's personal copy
Plant Soil (2012) 356:139–150
DOI 10.1007/s11104-011-1009-2
REGULAR ARTICLE
The hisC1 gene, encoding aromatic amino acid
aminotransferase-1 in Azospirillum brasilense Sp7,
expressed in wheat
Julio Castro-Guerrero & Angelica Romero & José J. Aguilar & Ma. Luisa Xiqui &
Jesús O. Sandoval & Beatriz E. Baca
Received: 9 February 2011 / Accepted: 25 September 2011 / Published online: 30 November 2011
# Springer Science+Business Media B.V. 2011
Abstract
Background and aims Production of indole-3-acetic
acid (IAA) by Azospirillum brasilense is one of the
most important mechanisms underlying the beneficial
effects observed in plants after inoculation with this
bacterium. This study determined the contribution of
the hisC1 gene, which encodes aromatic amino acid
aminotransferase-1 (AAT1), to IAA production, and
analyzed its expression in the free-living state and in
association with the roots of wheat.
Methods We determined production of IAA and AAT
activity in the mutant hisC::gusA-smR. To study the
expression of hisC1, a chromosomal gene fusion was
analyzed by following β-glucuronidase (GUS) activity
in vitro, in the presence of root exudates, and in
association with roots.
Results IAA production in the hisC mutant was not
reduced significantly compared to the activity of the
wild-type strain. AAT1 activity was reduced by 50%
when tyrosine was used as the amino acid donor,
Responsible Editor: Euan K. James.
J. Castro-Guerrero : A. Romero : J. J. Aguilar :
M. L. Xiqui : J. O. Sandoval : B. E. Baca (*)
Centro de Investigaciones en Ciencias Microbiológicas,
Instituto de Ciencias,
Benemérita Universidad Autónoma de Puebla,
Av. San Claudio s/n, Ciudad Universitaria,
72570 Puebla, Mexico
e-mail: [email protected]
whereas there was a 30% reduction when tryptophan
was used, compared to the activity of the wild-type
strain. Expression of the fusion protein was upregulated in both logarithmic and stationary phases
by several compounds, including IAA, tryptophan,
tyrosine, and phenyl acetic acid. We observed the
expression of hisC1 in bacteria associated with wheat
roots. Root exudates of wheat and maize were able to
stimulate hisC1 expression.
Conclusions The expression data indicate that hisC1
is under a positive feedback control in the presence of
root exudates and on plants, suggesting that AAT1
activity plays a role in Azospirillum–plant interactions.
Keywords Azospirillum brasilense . Aromatic amino
acid aminotransferase-1 . Indole acetic production .
Radical exudates regulation
Abbreviations
IAA
Indole-3-acetic acid
AAT1 Aromatic amino acid aminotransferase-1
IPyA
Indole-3-pyruvic acid
IAdhl Indole-3-acetaldehyde
Trp
Tryptophan
Tyr
Tyrosine
Phe
Phenylalanine
pHPP p-Hydroxyphenylpyruvate
PAA
Phenyl acetic acid
HPLC High-performance liquid chromatography
Author's personal copy
140
Introduction
The amino acid aminotransferase-1 (AAT1) protein
from Azospirillum brasilense Sp7 is encoded by
hisC1. AAT1 belongs to the α subfamily of Family
I aminotransferases (Jensen and Gu 1996). These
aminotransferases participate in several chemical
reactions of cellular metabolism, aromatic amino acid
biosynthesis, and function in the catabolism of amino
acids to provide nitrogen and carbon sources for
growth (Sergeeva et al. 2007). Individual subfamily
members may be relatively specific for aromatic
amino acids, but exhibit broad specificity. In addition
to using aromatic amino acids as substrates, AAT1
from A. brasilense is involved in the catabolism of
histidine, and produces indol-3-pyruvic acid (IPyA)
from tryptophan (Trp) and phenyl pyruvic acid from
phenylalanine. These compounds are precursors of
indole acetic acid (IAA) and phenyl acetic acid
(PAA), respectively (Baca et al. 1994; Soto-Urzúa et
al. 1996; Somers et al. 2005).
Azospirillum belongs to a group of soil bacteria
often referred to as plant-growth promoting rhizobacteria (PGPR; Bashan et al. 2004). Several studies have
described their beneficial effects on several plants:
cereals; Compositae, such as sunflower; Cruciferae,
such as mustard, vegetable crops; legumes, such as
chick pea; clover, and alfalfa (Okon and LabanderaGonzález 1994; Bashan et al. 2004). Several mechanisms of plant–microbe interactions can affect plant
growth, including N2 fixation, hormonal effects,
production of nitric oxide (NO), and enhanced
mineral uptake (Bashan et al. 1990, 2004; Creus et
al. 2005), all of which contribute to the beneficial
effects observed in plants (Bashan and de-Bashan
2010).
Azospirillum can synthesize four classes of phytohormones; auxins, gibberellins, cytokinins, and abscisic acid (Tien et al. 1979; Carreño-López et al. 2000;
Cohen et al. 2008; Croizier et al. 1988; MartínezMorales et al. 2003; Piccoli et al. 1996). Production of
auxins is considered the most important (Spaepen et
al. 2008). The biosynthesis of IAA involves distinct
pathways: three pathways requiring Trp have been
proposed. The main pathway in Azospirillum involves
the intermediary (IPyA), [Trp
IPyA IAdhl
IAA] (Costacurta et al. 1994; Carreño-López
et al. 2000; Spaepen et al. 2008). The first reaction
of this pathway is transamination of Trp to IPyA. The
Plant Soil (2012) 356:139–150
enzymatic activity of two AATs is found in several A.
brasilense strains (Pedraza et al. 2004) and four A.
lipoferum strains (Ruckdäschel et al. 1988). The
second step is catalysis by the key enzyme phenyl
pyruvate decarboxylase (PPDC; Spaepen et al.
2007a, b) to produce IAdlh, which is further oxidized
to IAA.
The present study identified the hisC1 gene from
A. brasilense Sp7 that encodes AAT1, and examined
its contribution to biosynthesis of IAA, as well as its
expression in both the free-living state and in
association with the plant.
Materials and methods
Bacterial strains and growth conditions
Escherichia coli strains were grown overnight at 37°C
in Luria broth (LB, Sambrook et al. 1989) containing
antibiotics: 25 μg/mL kanamycin, 100 μg/mL ampicillin, and 75 μg/mL streptomycin (Sm). Azospirillum
strains were grown in minimal K-lactate medium
(Carreño-López et al. 2000), overnight at 30°C. The
mating and isolation of the transcriptional fusion was
performed as described by Carreño-López et al.
(2000). E. coli S17.1 (pAB144-4A) or E. coli S17.1
(pAB144-4B) strains (Table 1), with the cassette smRgusA or A. brasilense Sp7 were used as the donor and
acceptor strain, respectively. For selection of transconjugants, plates (minimal K-lactate medium with
150 μg/mL Sm) were incubated at 30°C for 2 days.
Construction of plasmid clones and DNA sequencing
Plasmid DNA isolation, restriction analysis, transformation and molecular cloning were performed by methods
described in Sambrook et al. (1989). For Southern
hybridization experiments, genomic, plasmid, and cosmid DNA were digested with BglII, EcoRI, KpnI,
EcoRV, or SalI and were blotted on Hybond N+ nylon
membranes (Amersham Biosciences, Piscataway, NJ)
with a vacuum blotter (Fisher Scientific, Waltham,
MA). DNA was fixed by exposure to a 312-nm
transilluminator for 4 min. Prehybridization, labeling,
and purification of probes, as well as hybridization,
were performed as described by Carreño-López et al.
(2000). The physical maps of the inserts for this work
Author's personal copy
Plant Soil (2012) 356:139–150
141
Table 1 Bacterial strains and plasmids used in this study
Strains/plasmids
Description
Reference or source
Escherichia
coli DH5α
E. coli S17.1
endA1 hsdR17 supE44 thi-1 λ- recA1 gyrA96 relA1 ΔlacU169 Ø80
(ΔlacZΔM15)
pro, thi hsd, recA, :: RP4-2 Tc:: Mu- Km Tn7
Invitrogen, Carlsbad, CA
Azospirillum
brasilense Sp7
A. brasilense7445
Wild-type strain
ATCC29729
Derivative of Sp7 hisC1:: gusA- smR
This study
A. brasilense7446
Derivative of Sp7 hisC1::smR-gusA
This study
Strain
Simon et al. 1983
Plasmids
pSUP202
Suicide vector ApR, CmR, TcR
Simon et al. 1983
SuperCos 1
Cloning vector ApR, KmR,
Stratagene, La Jolla, CA
pCR 2.1
Cloning vector
Invitrogen
pBSL197
Vector pBSL carrying the cassette smR-gusA
pABaat1
Derivative of pCR2.1 carrying a fragment of 432 bp of hisC1 gene
This study
pAB144
This study
pAB144-1
Cosmid from A. brasilense Sp7 library, carrying a fragment of
20 kb harboring the hisC1 gene
Derivative of pAB144 carrying a 13 kb EcoRI fragment
pAB144-2
Derivative of pSUP202 carrying a 4.2 kb BglII fragment of pAB1444-2
This study
pAB144-3
Derivative of pAB144-1 carrying a 4.2 kb BglII fragment, cloned in pCR2.1
This study
pAB144-4A
Derivative of pAB144-2 carrying the cassette hisC1:: gusA- smR
inserted in the 5’ 3’ direction
Derivative of pAB144-2 carrying the cassette hisC1::smR-gusA
This study
pAB144-4B
are shown in Fig. 1. Both DNA strands were
sequenced by Macrogen (Rockville, MD).
To identify the hisC1 gene, we used primers Faat1
(5′ GCTGACGGTCAATCCGCTGG) and Raat1 (5′
CCGCAGGACCATCTCCGACGG) designed from
the sequence of peptides LSLTVNPLGP, and YIPSEMVLR, which were obtained from AAT1 protein
E
C
Sm
Bg
S
K
This study
This study
purified to homogeneity as described by Soto-Urzúa
et al. (1996).The amino acid sequences of the two
peptides were determined at the Stanford University
Protein and Nucleic Acid Facility (Stanford, Palo
Alto, CA). PCR amplification was performed according to directions of the manufacturer of Taq polymerase (Invitrogen, Carlsbad, CA), in a final volume of
Bg
K
E
pAB144-1
probe hisC1 pABaat1
V EV
Bg
S
K
Bg
S
V
pAB144-3
1kb
ORF1 ORF2
AAT1 S
S
ORF3
S
pAB144-4A; 7445
S
smR
S
gusA
S
pAB144-4B; 7446
gusA
smR
Fig. 1 Schematic map of the sequenced hisC1 region in the plasmid, strains and constructs. The insertion of the smR-gusA cassette is
shown, and arrows indicate the direction of transcription. E EcoRI, C ClaI , Sm SmaI, Bg BglI, S SalI, K KpnI, EV EcoRV, V Vector
Author's personal copy
142
25 μl, using 50 ng genomic A. brasilense Sp7 DNA.
The amplification cycle consisted of 10 min at 96°C,
30 cycles of 1 min at 95°C, 1.5 min at annealing
temperature of 67°C, 1 min at 72°C, and a final 10min extension at 72°C. The amplicon of 473 bp was
cloned into the pCR2.1 vector (Invitrogen) as described by the manufacturer to obtain the plasmid
pABaat1 (Table 1). This amplicon was used as a
probe to screen an A. brasilense Sp7 library. The
cosmid pAB144 was identified by DNA/DNA hybridization. pAB144-1 was obtained by digestion of
pAB144 with EcoRI, hybridization with the probe
aat1, and then subcloning of a 13-kb fragment into the
Supercos vector (Invitrogen). The cosmid pAB144-1
was digested with enzymes Cla I, Kpn I, Sma I, or
BglI after hybridization to probe aat1. A 4.7-kb BglII
fragment was subcloned into pCR2.1, which was
digested with the enzyme BamHI and transformed
into E. coli DH5α. This plasmid was designated
pAB144-2. Both strands were sequenced at Macrogen
to obtain the full sequence of the hisC1 gene. The
GenBank accession number is JF509704.1.
Construction of trancriptional fusion and mutation
of the hisC1 gene
The same 4.7 bp BglII fragment from pAB144-1 was
also subcloned into the suicide vector pSUP202
digested with BamHI. The ligated fragments were
transformed into E. coli S17.1 to generate the plasmid
pAB144-3. This plasmid was digested with KpnI and
the gusA-smR cassette was obtained from plasmid
pSBL197 by digestion with KpnI (Alexeyev et al.
1995). The fragments were ligated and transformed
into E. coli S17.1. Both cloned directions were
selected (see Table 1). E. coli strains S17.1
(pAB144-4A) and S17.1 (pAB144-4B) were used as
donors and transferred to A. brasilense Sp7 to obtain
transcriptional fusions (Fig. 1). The correct orientation
(sense strand of gusA) was determined by Southern
blot analysis as described by Carreño-López et al.
(2000), using aat1 and the gusA-smR cassette as
probes.
IAA production and AAT1 enzyme assays
IAA production was determined from bacteria grown in
10 mL K-malate minimal medium supplemented with
100 μg/mL Trp at 30°C for 48 h with shaking at 120 rpm.
Plant Soil (2012) 356:139–150
The cells were then pelleted by centrifugation
(10,000 g, 5 min, at 20°C). Aliquots of 20 μl
supernatant were taken, and the IAA concentration was determined by HPLC as described by
Carreño-López et al. (2000). Three replicates were
performed, and the experiment was repeated twice.
Total AAT enzyme activity was determined from the cell
pellets, which was used to produce a cell-free extract
described by Pedraza et al. (2004). Specific activity was
defined as micromoles of product [(IPyA and phydroxyphenyl pyruvic acid (pHPP)] per minute per
milligram of protein described by Diamondstone
(1966).
Preparation of wheat and maize root exudates
To prepare root exudates, seed from wheat (Triticum
aestivum var Zacatecas) and maize (Zea mays var.
Criollo) were surface-sterilized by gentle shaking for
1 min in 0.2% HgCl2 with 2% Tween 20 (P1379,
Sigma). The sterilized seeds were soaked six times for
30 min in sterile, demineralized water. The seeds were
allowed to germinate on Petri plates containing agarwater under dark conditions at 20°C for 2 days.
Seedlings were transferred aseptically to Magenta
vessels (Sigma-Aldrich, St. Louis, MO) equipped
with a stainless steel perforated tray and filled with
150 mL plant nutrient solution (Hoffland 1992).
Germinated wheat seedlings (65) and germinated
maize seedlings (25), (corresponding to 30 g) were
placed on the tray with the root in the solution, and
then placed in a cycle of 16-h light at 24°C and 8-h of
dark at 16°C for 7 and 10 days.
Root exudates were recovered aseptically and
checked for bacterial contamination using LB medium
before sterile filtration through a 0.45-μm disposable
cellulose-nitrate filter (EMD Millipore, Bedford, MA)
and then stored at −20°C until use. Only materials from
exudates in which no microbial growth could be
detected were used.
Reporter gene expression in minimal medium
and root exudates in the free living-state
The activity of β-glucuronidase (GUS) and OD600 nm
of A. brasilense 7445 and A. brasilense 7446 strains
were determined in K-lactate minimal medium containing: Trp, Phe, pHPP, phenyl-pyruvic acid (PPA),
IAA, or PAA, each at a concentration of 0.5 mM. The
Author's personal copy
Plant Soil (2012) 356:139–150
pH of all media was maintained at 6.8. The strains
were grown in K-lactate medium overnight at 30°C
with shaking, then inoculated at 0.01 OD600nm in a
125-mL Erlenmeyer flask containing 15 mL of each
test medium in individual flasks and incubated at 30°C
with shaking at 200 rpm. At various points during the
exponential and stationary growth phases, 2 mL
culture per flask were centrifuged and resuspended
in K-lactate medium (for OD600nm measurements)
and frozen at −20°C for later GUS activity determinations. GUS activity was measured by the method of
Miller (1972) using PNPG (para-nitrophenyl-β-Dglucuronide, Sigma) as substrate. Enzyme activities
were expressed as Ea =[A420(OD600nm ×t)]×1,000,
where Ea is GUS activity in Miller units and t is
incubation time (in minutes). When required, the total
protein was determined with a protein assay reagent
(Bio-Rad, Hercules, CA) using serum bovine albumin
as the standard (Sigma). Erlenmeyer flasks containing
15 mL root exudates diluted to 50% with a solution
described by Hoffland (1992) were inoculated as
described above and incubated at 30°C with shaking
until reaching 0.3 or 0.4 OD600nm. Cells were then
centrifuged and GUS activity determined as indicated
above.
Plant cultivation and in situ detection of bacteria
colonizing the root surface
Wheat seeds were germinated as described above, and
grown hydroponically under sterile conditions as
described by Zeman et al. (1992). One-week-old
wheat plantlets were inoculated with 1 mL A.
brasilense Sp7 or A. brasilense strains 7445 or 7446
at approximately 108 bacterial cells mL−1 in hydroponic culture as described by Arsène et al. (1994).
Five days after inoculation, root material was weighed
and homogenized in a mortar with 2 mL sterile
phosphate buffer (20 mM at pH 7). Activity of the
reporter gene was measure in cells from 1 mL of the
homogenized material. As soon as bacteria were
isolated from root wheat, GUS activity was determined as described by Miller (1972). The colonization pattern of the root surfaces was estimated by the
number of Azospirillum cells present in 1 mL homogenized material from wheat roots by the mostprobable number (MPN) technique. Cell counts for A.
brasilense 7445 and 7446 were made in K lactate
medium supplemented with Sm (150 μg/mL). In situ
143
detection of GUS activity in 2-cm root segments
inoculated with Azospirillum 7445 and 7446 strains
was performed as described by Arsène et al. (1994).
Afterwards, the segments were stained (XGlc; 5bromo-4-chloro-indolyl-D-glucopyranoside, Sigma).
After staining, the segments were examined under a
light microscope (Nikon-2000), and sections were
viewed and photographed using the Nikon system.
Results
Identification and mutagenesis of hisC1
We isolated the hisC1 gene using a PCR-generated
probe with oligonucleotides designed from peptides
obtained from purified and digested AAT1 protein, as
described in Materials and methods. The Sp7strain
library was screened and a clone including the hisC1
gene was obtained. Figure 1 describes this region.
The deduced protein product of ORF1 shares homology with an acetyl transferase of the GNAT family
from Rhospirillum centenum SW (YP_002297377.1)
with 55% similarity, Roseobacter SpAzwK-3b
(ZP_01903442) with 60% similarity, and Azospirillum B510 (AZL012950), with 88% similarity. ORF2
appears to be a hypothetical membrane protein
showing homology to the deduced protein products
from Aurantimonas manganoxidans SI85-A1
(ZP_01228200.1), with 61% similarity and Rhizobium etli CIAT with 56% similarity. The hisC1 gene, in
a convergent orientation, displayed a deduced protein
sequence with high similarity to the histidol-aromatic
amino acid aminotransferases of various bacteria, in
particular the gene hisC (AZL012940) coding for a
histidol-phosphate aminotransferase, putatively identified in the recent genome sequence of Azospirillum
spp. IB510 (http://genome.kazusa.or.jp/rhizobase).
The predicted product from Azospirillum spp. IB510
shares 85% similarity with hisC1 from A. brasilense
Sp7. The sequence of AAT1 indicated a protein of
360 amino acids with a predicted molecular mass of
39,248 Da; the pyridoxal 5′ phosphate binding
(FLANPNNPTGTY) was also identified. ORF3 corresponded to a partial sequence of a histidine kinase,
which is predicted to be a signaling protein. The
conservation of gene arrangement in the genetic
region identified in A. brasilense Sp7 matched the
corresponding region in Azospirillum spp B510; in
Author's personal copy
144
Plant Soil (2012) 356:139–150
the latter strain, this region is located on the bacterial
chromosome (Kaneko et al. 2010).
To analyze the contribution of AAT1 to IAA
biosynthesis, we constructed an AAT1 mutant by
inserting a gusA-smrR cassette in the natural KpnI site
found in the hisC1 sequence. The correct cassette
orientation relative to the promoter was created in
strain 7445, and strain 7446 was generated by
inserting the cassette in the opposite orientation.
Growth of strains Sp7, 7445, and 7446 was similar
(data not shown). IAA production in 7445 was lower
compared with wild type Sp7, but the difference was not
significant, as expected: 11.3±1.2 IAA μg/mg protein−1
for the wild type strain, and 8.9±1.1 IAA μg/mg
protein−1 for A. brasilense 7445. However, total AAT
activity was lower in strain 7445 than in the Sp7 strain
(Fig. 2). When Trp was used as the amino acid donor,
the reduction was 30% (0.023 μmol/mg protein−1)
compared with the wild type (0.039 μmol/mg
protein−1). When Tyr was used as the amino acid
donor, the reduction was 50% (0.034 to 0.016 μmol/mg
0.05
0.045
Specific Activity AAT1
0.04
0.035
0.03
0.025
0.02
0.015
0.01
0.005
0
1
2
Fig. 2 Aminotransferase-1 (AAT) specific activity. 1 Tryptophan (Trp) AAT activity was assayed by measuring indole-3pyruvic acid (IPyA) at 330 nm (ε=10,000 cm2/mol, Granner
and Tomkins 1970), at pH 8.5 with pyridoxal 5′ phosphate
(1 mM), 2-oxoglutarate (1 mM), and Trp (1 mM). 2 Tyrosine
(Tyr) ATT was measuring as the concentration of p-hydroxyphenylpyruvate (pHPP) at 331 nm (ε=19,900 cm2/mol,
Granner and Tomkins 1970), at pH 8.5 with pyridoxal 5′
phosphate (1 mM), 2-oxoglutarate (1 mM), and Tyr (1 mM).
Each bar represents the mean of three independent replicates,
error bars represent the standard error of the mean, black bars
Sp7 strain, grey bars 7445 strain
protein−1). The results indicate a role for AAT1 in
IPyA intermediate production.
Chromosomal gene fusion expression in the free
living state
To measure the influence of individual compounds on
expression of the hisC1 gene, GUS activity of the
reporter gene cassette inserted into A. brasilense
strains 7445 and 7446 was tested. The cassette
insertion was confirmed by Southern blot analysis
on A. brasilense 7445 and 7446 genomic DNA
probed with the gusA-smR and aat1 DNA cassettes
(data not shown). The resulting chromosomal fusion
conferred the ability to produce blue colonies on
medium containing the GUS indicator X-Glc; the
correct orientation for expression was present only in
the case of A. brasilense 7445. To check expression of
the reporter fusion, GUS activity was determined in
both permeabilized A. brasilense 7445 and 7446 cells.
As was expected, only A. brasilense 7445 displayed
activity. To further study gene expression, A. brasilense 7445 was grown in minimal medium (K-lactate)
and K-lactate medium supplemented with Tyr, Trp,
Phe, pHPP, IAA, or PAA. GUS activity was determined as described in Materials and methods.
Expression of hisC1 was constitutive and was seen
in both exponential and stationary growth phases
(Fig. 3). In medium supplemented with IAA, PPA,
Trp or Tyr, expression was significantly up-regulated
during both phases. Up-regulation was 1.8-fold for
Trp, 2.6-fold for Tyr, 2.5-fold for PAA, and 4.6fold for IAA in early stationary phase compared
with expression observed in K-lactate medium.
These data indicate that the compound that best
functioned as a regulator was IAA, followed by
PAA, Tyr, and Trp.
In view of this, we tested the expression of strain
7445 grown in radical exudates derived from wheat and
maize. We found that both exudates drive the transcription of the hisC1 promoter, with maize root exudates
showing greater enhancement than wheat exudates
(Fig. 4). Maximal bacteria growth was detected with
maize root exudates at 10 days (107 CFU/mL),
compared with wheat root exudates (106 CFU/mL).
Currently, we do not know the concentrations of
carbon and nitrogen sources or the nature of the
exogenous inducer(s). Additionally, Hoffland solution
was inoculated with strain 7445, and wheat exudates
Author's personal copy
Plant Soil (2012) 356:139–150
25000
Miller Units/mg protein-1
Fig. 3 β-glucuronidase
(GUS) activity of the hisC1::
gusA fusion in the freeliving state. Bacteria were
grown to both exponential
and stationary phase in Klactate (KL) minimal medium
supplemented with 0.5 mM
Trp, Tyr, IAA and PPA or in
their absence. GUS activity
was determined at 12 h
(white bars), 24 h (grey
bars), and 36 h (black bars).
The data shown are averages of three independent
replicates; error bars standard error of the mean
145
20000
15000
10000
5000
0
KL
were inoculated with strain 7446 strain: no GUS
activity was detected in either case (1.7±0.15 MU).
Chromosomal gene fusion expression in association
with plants
Expression of the reporter gene in a hydroponic plant
was also determined using the GUS assay and MPN.
The results shown in Fig. 5 indicate that activity was
more significant in A. brasilense 7445 (155.3±43.5
MU) than in A. brasilense 7446 (3.9±0.15 MU), as
expected from the direction of cassette insertion
(Fig. 5a). The CFU of both strains was set at 107.8
to 108.01 CFU/g root, suggesting that growth of the
introduced bacteria occurred in both strains to the
same extent (Fig. 5b). To monitor establishment of
bacteria expressing the hisC gene on wheat roots,
KL + Tyr
KL +PAA
KL +IAA
GUS expression of bacteria on roots was determined
at 5 days after inoculation. When plants were
inoculated with A. brasilense 7445, hisC expression
was detected on roots, whereas no GUS staining was
observed in roots inoculated with A. brasilense 7446
(Fig. 5c).
Discussion
Amino acids in the rhizosphere are of both plant and
microbial origin (González-López et al. 2005). The
role of amino acids produced by rhizobacteria during
their interaction with plants is practically unknown,
although it has been established that some amino
acids, such as Met and Trp, act in soil as the main
precursors for synthesis of the plant hormones
14000
Miller Units/ mg protein-1
Fig. 4 GUS activity of the
hisC1::gusA fusion in the
presence of exudates from
wheat and maize in the freeliving state. GUS activity
was determined in cells at
OD600 = 0.3 or 0.4. Grey
bars Wheat exudates (harvested at 7 and 10 days),
black bars maize exudates
(harvested at 7 and
10 days). The data shown
are averages of three independent replicates; error
bars standard error of the
mean
KL + Trp
12000
10000
8000
6000
4000
2000
0
0.3
0.4
7 Days
OD600nm
0.3
0.4
10 Days
Author's personal copy
146
Plant Soil (2012) 356:139–150
A
C
180
i
Miller units/mg protein-1/g Root
160
ii
140
A. brasilense
7445
120
100
iii
iv
80
60
A. brasilense
7446
40
20
0
A.brasilense
7445
A.brasilense
7446
B
9.00
Log MPN/g Root
8.00
7.00
6.00
5.00
4.00
3.00
2.00
1.00
0.00
A.brasilense 7445
A.brasilense 7446
Fig. 5a–c Colonization and expression of A. brasilense strains
7445 and 7446 in association with wheat. After 5 days of plant
growth, root tips were isolated; bacteria were isolated from the
root tip and then plated for determination of MPN and GUS
activity as described in Materials and methods. a hisC1
promoter expression: black bar 7445 strain, grey bar 7446
strain. Values represent the average of 15 plants for each
experiment; error bars standard error of the mean. b Most
probable number (MPN) determination as log CFU/mL: black
bar 7445 strain, grey bar 7446 strain. c Bacterial hisC::gusA
expression on wheat root. In situ detection of GUS activity of
wheat root segments, inoculated with A. brasilense strains 7445
or 7446 strains. Bars: i, iii 100 μm; ii, iv 5 μm
ethylene and IAA, respectively (Frankenberger and
Arshad 1995; Murcia et al. 1997; Kamilova et al.
2006). Biosynthesis of phytohormones by Azospirillum
is documented widely, as is involvement of these
substances in plant responses observed after inoculation
of plants with bacteria (Dobbelaere et al. 2001; Spaepen
et al. 2008). Here, we identified and studied the
regulation of the hisC1 gene from A. brasilense Sp7
strain coding for AAT1, which we had previously
purified (Soto-Urzúa et al. 1996). We had also
demonstrated its substrate specificity and found that
the enzyme can convert Trp to IPyA, pHPP to Tyr, and
phenyl pyruvate to Phe as reversible reactions of AATs
(Carreño-López et al. 2000; Soto-Urzúa et al. 1996).
A knock-out mutant of the hisC1 gene showed a
significant decrease in specific AAT activity (∼50%).
Author's personal copy
Plant Soil (2012) 356:139–150
However, IAA production was not as low as
expected, which could happen if other AATs isoforms
that contribute to IAA production are present in
Azospirillum (Pedraza et al. 2004). The lack of a
significant effect on IAA production of loss of hisC1
also suggests that AAT does not catalyze the ratelimiting step in the IAA biosynthesis pathway. Ge et
al. (2009) identified and mutated the atrC gene from
A. brasilense Y62, demonstrating that atrC was
involved in IAA production; moreover, a recombinant
AtrC protein expressed and purified in E. coli
functioned as an aminotransferase with high substrate
specificity for Trp. Trp aminotransferase activity was
also found to be associated with IAA production in
Enterobacter cloacae (Koga et al. 1994), and in
Arabidopsis thaliana (Tao et al. 2008). In Pantoea
agglomerans rhizosphere isolates, AAT activity was
related to the amount of IAA produced in the
presence of Trp, but not when Tyr or Phe was used
as a sole nitrogen source; all isolates accumulated Trp
internally and released IAA (Sergeeva et al. 2007).
GUS activity was compared in the presence of two
auxins, IAA and PAA, and amino acids Trp and Tyr,
both of which are AAT1 substrates. hisC1, which
encodes AAT1, catalyzes the first step in the
conversion of Trp to IPyA, Tyr to pHPP and Phe to
PPA; it is involved in Tyr biosynthesis (by the reverse
reaction, pHPP to Tyr), and is up-regulated by PPA
and Tyr in addition to IAA. PPA and Tyr are
themselves products of the pathway. The results
indicate that IAA was the best inducer, followed by
PAA, and suggest a mechanism of feedback control.
Another positive feedback mechanism has been
described for A. brasilense Sp245 by Vande Broek
et al. (1999). The expression of the key gene, ipdC,
coding for the enzyme PPDC, showed increased
expression in the presence of Trp at its maximum
during stationary phase, as this study also demonstrated for hisC1. Also, the ipdC gene from A.
brasilense strains Sp7 and SM is upregulated by
different auxins such as IAA and indole-3-butyric
acid (Rothballer et al. 2005; Malhotra and Srivastava
2008). In addition, the ipdC gene from Enterobacter
cloacae strain UW5 showed upregulation by TyR, Trp
and Phe (Ryu and Patten 2008). Despite the fact that,
in A. brasilense, the addition of Trp to the culture
medium strongly increased IAA production, Trp did
not upregulate ipdC expression (Vande Broek et al.
1999; Carreño-López et al. 2000). Unlike ipdC
147
expression, hisC1 is upregulated by Trp, albeit to a
lesser extent than with the other compounds tested.
This upregulation could be due to the binding of these
compounds to a transcriptional regulator at the hisC1
promoter. Such transcriptional regulation of IAA
biosynthesis has been described in E. cloacae UW5
acting on the ipdC promoter (Ryu and Patten 2008).
Our data confirm the additional critical role of IAA in
gene expression. IAA has a profound effect on
bacterial metabolism, as a signaling molecule in
bacteria acting during microorganism–plant interactions (Yang et al. 2007; Spaepen et al. 2007a, b).
The plant root is thought to be the major source of
nutrients for microorganisms living in the rhizosphere
(Lynch and Whipps 1990). Therefore, bacterial
growth on compounds present in the rhizosphere is
assumed to be essential for efficient colonization and
establishment in the rhizosphere. In addition to
measuring its expression in the free-living state, we
also determined regulation of hisC using maize and
wheat root exudates as growth media. Both were able
to support growth, but the highest expression was
observed in cells growing in root maize exudates. It is
well established that exudates from different plant
species provide different compounds acting as carbon
and nitrogen sources for bacteria associated with
plants. Kamilova et al. (2006) found that the total
amount of organic acids is much higher than that of
total sugar or Trp in the exudates of several plants.
However, the concentration differs with plant species
and plant age at exudate collection, as observed here.
Reporter gene induction in vitro by maize and wheat
exudates for genes involved in proline catabolism has
been described in Pseudomonas fluorescens and
Pseudomonas putida (van Overbeek and van Elsas
1995). Induction of the put promoter by maize
exudates collected at 7 days was approximately 20fold (Vilchez et al. 2000).
The extent of hisC1 expression was also determined in association with wheat. Bacteria isolated
from plants after 5 days of growth showed a
substantial difference between the negative control,
A. brasilense 7446, and A. brasilense 7445, which
carried the reporter gene fusion in the correct
orientation. Additionally we tested hisC::gusA expression in situ in wheat roots. In agreement with data
obtained from bacteria isolated from roots, significant
expression of hisC was detected in plants after 5 days.
The tip and emergence point of lateral roots were
Author's personal copy
148
favored sites of bacterial microcolonies expressing the
reporter gene, as also described by others (Arsène et
al. 1994; Vande Broek et al. 1993).
Using global analysis of P. putida genes expressed
during their interaction with the maize rhizosphere,
Matilla et al. (2007) found 90 rhizosphereupregulated genes: genes coding for an aminotransferase (PP3786), an aldhehyde dehydrogenase family
protein (PP3281), and phenyl acetic degradation
protein (PP2694), as well as genes coding for amino
acid transport and metabolism of aromatic compounds. Some of the bacteria were analyzed in
competitive colonization, and mutants were founds
that were hampered for survival in the rhizosphere in
competition with wild type. In our work, both hisC1
strains (7445 and 7446) tested were indistinguishable
from each other and from the wild type strain for
colonization of wheat under laboratory conditions
(data not shown). Furthermore, these mutants also
behaved like their parent in this study; A. brasilense
7445 and 7446 were not auxotrophic, as shown by
growth in K-lactate minimal medium with NH4Cl as
the sole source of nitrogen. On the other hand, both
strains were able to use Tyr as sole source of nitrogen.
Uncharacterized genes coding for AATs with roles in
determining the competitive ability of A. brasilense in
the rhizosphere may explain why no difference was
observed in colonization, although no such gene
conferring a host-specific effect has yet been identified.
Knowledge of bacterial growth conditions in the
rhizosphere is important for understanding rhizosphere colonization. The composition of root exudates
was not analyzed for the presence of carbon sources
and amino acids. However, the presence of compounds such as dicarboxylic acids and Trp, Tyr and
Phe have been described in the exudates of wheat and
maize, suggesting the availability of these particular
nutrients (Phillips et al. 2004). Future work should
aim to identify the regulatory protein that controls the
hisC gene at the transcriptional level, as well as
determine the amino acid, IAA, and PAA composition
of axenically collected wheat (var Zacatecas) and
maize (var. Criollo) root exudates.
Acknowledgments This work was supported by a Consejo
Nacional de Ciencia y Tecnología (CONACyT) Grant 49227-Z,
together with Vicerrectoría de investigación y estudios de
posgrado-Secretaría de educación pública (VIEP-SEP), Grant
NAT-IC-1. J.G.C. was the recipient of a scholarship from
CONACyT.
Plant Soil (2012) 356:139–150
References
Alexeyev MF, Shokolenko IN, Croughan TP (1995) Improved
antibiotic-resistance gene cassettes and omega elements
for Escherichia coli vector construction and in vitro
deletion/insertion mutagenesis. Gene 160:63–67
Arsène F, Katupitiya S, Kennedy IR, Elmerich C (1994) Use of
lacZ fusions to study the expression of nif genes of
Azospirillum brasilense in association with plants. Mol
Plant Microbe Interact 7:748–757
Baca EB, Soto-Urzúa L, Xochihua YG, Cuervo A (1994)
Characterization of aromatic amino acid aminotransferases
and production of indolacetic acid in Azospirillum strains.
Soil Biol Biochem 26:57–63
Bashan Y, de-Bashan L (2010) How the plant growth-promoting
bacterium Azospirillum promotes plant growth—a critical
assessment. Adv Agron 108:77–136
Bashan Y, Harrison SK, Whitmoyer RE (1990) Enhanced growth
of wheat and soybean plants inoculated with Azospirillum
brasilense is not necessarily due to general enhancement
of mineral uptake. Appl Environ Microbiol 56:769–775
Bashan Y, Holguin G, de-Bashan LE (2004) Azospirillum–plant
relationships: physiological, molecular, agricultural, and
environmental advances (1997–2003). Can J Microbiol
50:521–577
Carreño López R, Campos Reales N, Elmerich C, Baca BE
(2000) Physiological evidence for differently regulated
tryptophan-dependent pathways for indole-3-acetic acid
synthesis in Azospirillum brasilense Sp7. Mol Gen Genet
264:521–530
Cohen AC, Bottini R, Piccoli PN (2008) Azospirillum brasilense Sp 245 produces ABA in chemically-defined culture
medium and increases ABA content in arabidopsis plants.
Plant Growth Regul 54:97–103
Costacurta A, Keijers V, Vanderleyden J (1994) Molecular
cloning and sequence analysis of an Azospirillum brasilense indole-3-pyruvate decarboxylase gene. Mol Gen
Genet 243:463–472
Creus CM, Graziano M, Casanovas EM, Pereyra MA,
Simontacchi M, Puntarulo S, Barassi CA, Lamattina L
(2005) Nitric oxide is involved in the Azospirillum
brasilense-induced lateral root formation in tomato. Planta
221:297–303
Crozier A, Arruda P, Jasmin JM, Monterio AM,Sandberg G
(1988) Analysis of indole-3 acetic acidand related indoles
in culture medium and Azospirillumbrasilense. Appl
Environ Microbiol 54:2833–2837
Diamondstone TI (1966) Assay of tyrosine transaminase
activity by conversion of p-hydroxyphenylpyruvate to
hydroxybenzaldehyde. Anal Biochem 16:395–401
Dobbelaere S, Croonenborghs A, Thys A, Ptacek D, Vanderleyden
J, Dutto P et al (2001) Responses of agronomically important
crops to inoculation with Azospirillum. Aust J Plant Physiol
28:871–879
Frankenberger WT, Arshad M (1995) Phytohormones in soil:
microbial production and function. Dekker, New York
Ge SM, Li T, Chen SF (2009) Expression and functional
analysis of aminotransferase involved in indole-3-acetic
acid biosynthesis in Azospirillum brasilense Y62. Biochem
(Moscow) 74:81–84
Author's personal copy
Plant Soil (2012) 356:139–150
González-López J, Rodelas B, Pozo C, Salmerón-López V,
Martínez-Toledo MV, Salmerón V (2005) Liberation of
amino acids by heterotrophic nitrogen fixing bacteria.
Amino Acids 28:363–367
Granner DK, Tomkins GM (1970) Tyrosine aminotransferase
(rat liver). Methods Enzymol 17:633–637
Hoffland E (1992) Quantitative evaluation of the role of organic
acid exudation in the mobilization of rock phosphate by
rape. Plant Soil 140:279–289
Jensen RA, Gu W (1996) Evolutionary recruitment of biochemically specialized subdivisions of Family I within the
protein superfamily of aminotransferases. J Bacteriol
178:2161–2171
Kamilova F, Kravchenko LV, Shaposhnikov AI, Azarova T,
Makarova N, Lugtenberg B (2006) Organic acids, sugars
and L-tryptophane in exudates and vegetables growing on
stonewool and their effects on activities of rhozosphere
bacteria. Mol Plant Microbe Interact 19:250–256
Kaneko T et al (2010) Complete genomic structure of the
cultivated rice endophyte Azospirillum sp B510. DNA Res
17:37–50. doi:10.1093/dnares/dsp026
Koga J, Syono K, Ichikawa T, Adachi T (1994) Involvement of
L-tryptophan in indole-3-acetic acid biosynthesis in Enterobacter cloacae. Biochem Biophys Acta 1209:241–247
Lynch JM, Whipps JM (1990) Substrate flow in the rhizosphere. Plant Soil 129:1–10
Malhotra M, Srivastava S (2008) organization of the ipdC
region regulates IAA levels in different Azospirillum
brasilense strains: molecular and functional analysis of
ipdC in strain SM. Environ Microbiol 10:1365–1373
Martínez-Morales LJ, Soto-Urzúa L, Baca BE, Sánchez-Ahédo
JA (2003) Indole-3-butyric acid (IBA) production in
culture medium by wild-type Azospirillum brasilense.
FEMS Microbiol Lett 228:167–173
Matilla MA, Espinosa-Urgel M, Rodríguez-Herva JJ, Ramos
JL, Ramos-González MI (2007) Genomic analysis reveals
the major driving forces of bacterial life in the rhizosphere.
Genome Biol 8:R1791–13
Miller JH (1972) Experiments in molecular genetics. Cold
Spring Harbor Laboratory Press, Cold Spring Harbor,
NewYork
Murcia R, Rodelas B, Salmerón V, Pozo C, González-López J
(1997) Effect of simazine on the production of lisine and
methionine by Azotobacter chroococcum and Azotobacter
vinelandii. Amino Acids 12:249–255
Okon Y, Labandera-González CA (1994) Agronomic applicationsof Azospirillum: an evaluation of 20 years worldwide
fieldinoculation. Soil Biol Biochem 26:1591–1601
Van Overbeek LS, Van Elsas JD (1995) Root exudate-induced
promoter activity in Pseudomonas fluorescensmutants in
the wheat rhizosphere. Appl Environ Microbiol 61:889–
898
Pedraza RO, Ramírez Mata A, Xiqui Vázquez ML, Baca BE
(2004) Aromatic amino acid aminotransferase activity and
índole-3-acetic acid production by associate nitrogenfixing bacteria. FEMS Microbiol Lett 233:15–21
Phillips DA, Fox TC, King MD, Bhuvaneswari TV, Teuber LR
(2004) Microbial products trigger amino acid exudation
from plant roots. Plant Physiol 136:2887–2894
Piccoli P, Masciarelli O, Bottini R(1996) Metabolism of 17,17[ 2 H 2 ]-gibberellin A 4 , A 9 and A 20 by Azospirillum
149
lipoferum in chemically defined culture medium. Symbiosis 21:263–274
Rothballer M, Schmid M, Fekete A, Hartmann A (2005)
Comparative in situ analysis of ipdC-gfpmut3 promoter
fusions of Azospirillum brasilense strains Sp7 and Sp245.
Environ Microbiol 7:1839–1846
Ruckdäschel E, Lewis-Kittell B, Helinski DR, Klingmüller W
(1988) Aromatic amino acid aminotransferase of Azospirillum lipoferum and their possible involvement in IAA
biosynthesis. In: Klingmüller W (ed) Azospirillum IV,
genetics, physiology, ecology. Springer, The Netherlands,
pp 49–53
Ryu RJ, Patten CL (2008) Aromatic amino acid dependent
expression of índole-3-pyruvate decarboxylase is regulated
by TyrR in Enterobacter cloacae UW5. J Bacteriol
190:7200–7208
Sambrook J, Fritsch EF, Maniatis T (1989) Molecular cloning:
a laboratory manual. Cold Spring Harbor Laboratory
Press, Cold Spring Harbor, New York
Sergeeva E, Hirkala DLM, Nelson LM (2007) Production of
indole-3-acetic acid, aromatic amino aminotransferase
activities and plant growth promotion by Pantoea agglomerans rhizosphere isolates. Plant Soil 297:1–13
Simon R, Priefer U, Pühler A (1983) A broad host range
mobilization system for in vivo genetic engineering:
transposon mutagenesis in gram negative bacteria. Biotechnology 1:784–790
Somers E, Ptacek D, Gysegom P, Srinivasan M, Vanderleyden J
(2005) Azospirillum brasilense produces the auxin-like
phenylacetic acid by using the key enzyme for indol-3acetic acid biosynthesis. Appl Environ Microbiol
71:1803–1810
Soto-Urzúa L, Xochihua-Corona YG, Flores-Encarnación M,
Baca BE (1996) Purification and properties of aromatic
amino acid aminotransferase from Azospirillum brasilense
UAP14 strain. Can J Microbiol 42:294–298
Spaepen S, Vanderleyden J, Remans R (2007a) Indole-3-acetic
acid in microbial and microorganism-plant signaling.
FEMS Microbiol Rev 31:425–448
Spaepen S, Versées W, Gocke D, Pohl M, Steyaert J,
Vanderleyden J (2007b) Characterization of phenylpyruvate decarboxylase, involved in auxin production of
Azospirillum brasilense. J Bacteriol 189:7626–7633
Spaepen S, Dobbelaere S, Croonenborghs A, Vanderleyden J
(2008) Effects of Azospirillum brasilense of indol-e3acetic-acid production on inoculated wheat plants. Plant
Soil 312:15–23
Tao Y et al (2008) Rapid synthesis of auxin via a new
tryptophan-dependent pathway is required for shade
avoidance in plants. Cell 133:164–176
Tien TM, Gaskins MH, Hubbell DH (1979) Plant growth
substances23 produced by Azospirillum brasilense and
their effect on the growth of pearl millet24 (Pennisetum
americanum L.). Appl Environ Microbiol 37:1016–1024
Vande Broek A, Michiels J, Van Gool A, Vanderleyden J
(1993) Spatial-temporal colonization patterns of Azospirillum brasilense on the wheat root surface and expression
of bacterial nifH gene during association. Mol Plant
Microbe Interact 6:592–600
Vande Broek A, Lambrecht M, Eggermont K, Vanderleyden J
(1999) Auxins up-regulate expression of the indole-3-
Author's personal copy
150
pyruvate decarboxylase gene in Azospirillum brasilense. J
Bacteriol 181:1338–1342
Vílchez S, Molina L, Ramos C, Ramos JL (2000) Proline
catabolism by Pseudomonas putida: cloning, characterization, and expression of the put genes in the presence of
root exudates. J Bacteriol 182:91–99
Yang S, Zhang Q, Guo J, Charkowski AM, Glick BR, Ibekwe
AM, Cooksey DA, Yang CH (2007) Global effect of
Plant Soil (2012) 356:139–150
indole-3-acetic acid biosynthesis on multiple factors of
Erwinia chrysanthemi 3937. Appl Environ Microbiol
73:1079–1088
Zeman AMM, Tchan YT, Elmerich C, Kennedy IR (1992)
Nitrogenase activity in wheat seedlings bearing paranodules induced by 2,4-dichlorophenoxyacetic acid (2,4D) and inoculated with Azospirillum. Res Microbiol
143:847–855