Download 71370_Forensic_DNA_Analysis

Survey
yes no Was this document useful for you?
   Thank you for your participation!

* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project

Document related concepts

Mutation wikipedia , lookup

Epigenetics wikipedia , lookup

DNA methylation wikipedia , lookup

Epigenetic clock wikipedia , lookup

Genetic engineering wikipedia , lookup

Human genome wikipedia , lookup

DNA sequencing wikipedia , lookup

DNA barcoding wikipedia , lookup

DNA paternity testing wikipedia , lookup

Metagenomics wikipedia , lookup

Zinc finger nuclease wikipedia , lookup

Gene wikipedia , lookup

Nutriepigenomics wikipedia , lookup

Designer baby wikipedia , lookup

DNA wikipedia , lookup

DNA repair wikipedia , lookup

Mutagen wikipedia , lookup

Site-specific recombinase technology wikipedia , lookup

Comparative genomic hybridization wikipedia , lookup

Mitochondrial DNA wikipedia , lookup

Point mutation wikipedia , lookup

No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup

Genomic library wikipedia , lookup

Cancer epigenetics wikipedia , lookup

Microevolution wikipedia , lookup

Primary transcript wikipedia , lookup

DNA polymerase wikipedia , lookup

Genomics wikipedia , lookup

Nucleosome wikipedia , lookup

SNP genotyping wikipedia , lookup

DNA profiling wikipedia , lookup

Replisome wikipedia , lookup

DNA vaccination wikipedia , lookup

DNA damage theory of aging wikipedia , lookup

Vectors in gene therapy wikipedia , lookup

Therapeutic gene modulation wikipedia , lookup

Non-coding DNA wikipedia , lookup

Bisulfite sequencing wikipedia , lookup

Molecular cloning wikipedia , lookup

Epigenomics wikipedia , lookup

Gel electrophoresis of nucleic acids wikipedia , lookup

Microsatellite wikipedia , lookup

United Kingdom National DNA Database wikipedia , lookup

Artificial gene synthesis wikipedia , lookup

Nucleic acid analogue wikipedia , lookup

Cell-free fetal DNA wikipedia , lookup

History of genetic engineering wikipedia , lookup

Cre-Lox recombination wikipedia , lookup

Helitron (biology) wikipedia , lookup

DNA supercoil wikipedia , lookup

Genealogical DNA test wikipedia , lookup

Extrachromosomal DNA wikipedia , lookup

Nucleic acid double helix wikipedia , lookup

Deoxyribozyme wikipedia , lookup

Transcript
Forensic DNA Analysis
1.20.09
Basic Review
• 46 chromosomes per cell, 23 pairs
• Humans have approximately 25,000
genes
• Each gene has multiple versions, called
alleles (ex: hair color=gene, alleles=brown,
blonde, etc.)
DNA Structure Review
• DNA is made of 4 nucleotides connected
by a sugar-phosphate backbone
• Adenine-Thymine
• Guanine-Cytosine
• 3.2 Billion base pairs in each cell
Common Sources of DNA at a
Crime Scene
•
•
•
•
Hair
Skin cells
Blood
Semen
•
•
•
•
Cigarettes
Clothing
Envelope
Glass/bottle
How to match DNA to
suspect?
• Main limitation of DNA evidence?
How to match DNA to
suspect?
• Main limitation of DNA evidence?
 Sample size - Millions of copies of DNA
sample needed to perform tests
How to match DNA to
suspect?
• Main limitation of DNA evidence?
 Sample size - Millions of copies of DNA
sample needed to perform tests
 Solution??
How to match DNA to
suspect?
• Main limitation of DNA evidence?
 Sample size - Millions of copies of DNA
sample needed to perform tests
 Solution??
• Polymerase Chain Reaction (PCR)
Polymerase Chain Reaction
(PCR)
• DNA Polymerase = enzyme that builds
new DNA strand one base pair at a time
• PCR allows the production of a billion+
copies of a DNA strand in a few hours
Gel Electrophoresis
• Goal of G.E. is to
separate sample
DNA into bands
that allow
comparison
between
individuals
Process of G. E.
1. PCR
2. DNA cut with restriction enzyme, a molecule
3.
4.
5.
that cuts DNA at specific base pair sequences
DNA loaded into gel, attracted to positive end
due to negative charge
DNA strands separate based on size
(restriction fragment length)
Labeled radioactively or with dye, compared to
known standard for analysis
Reading a DNA Fingerprint
Short Tandem Repeats
• 30% of DNA is made up of repeating
segments called Short Tandem Repeats
 Ex. GATTACGACGACGACGTATTGGA
Short Tandem Repeats
• 30% of DNA is made up of repeating
segments called Short Tandem Repeats
 Ex. GATTACGACGACGACGTATTGGA
 STRs have no known function, seem to act as
filler between genes
STR Analyis
• STRs have become the most successful
and widely used form of forensic DNA
analysis
• STR lengths (# of repeats) vary from
individual to individual
• # of repeats for a variety of STRs tested
can positively ID a suspect or victim
STR Analysis
• Thirteen STRs are listed in the CODIS DNA
•
•
database
Each has a known probability of occurrence
By testing multiple STRs, a sample can be
identified along with its frequency of occurance
 Ex: 3.5% chance of STR combo #1, 0.7% chance of
combo #2, 1.3% of combo #3
• Total likelihood of combination = 0.0003185% or 1 in 3,000
people would share same STR
Advantages of STR Analysis
• Need as few as 18 cells
• Faster – look at only a small portion of DNA, as
•
•
STRs are >450 base pairs long out of
3,200,000,000
Cheaper
Highly discriminate
 Looking at all 13 CODIS STRs gives odds of 1 in 575
trillion for caucasians, 1 in 900 trillion for african
americans (0.000000000001% chance of random
match)
Mitochondrial DNA
• 99% of DNA is found within cell’s nucleus,
but small amount of DNA found inside
mitochondria
 Mitochondria are responsible for supplying
energy to the cell
Forensic Mitochondrial DNA
Analysis
• Mitochondrial DNA is only inherited from mother identical from generation to generation and
among siblings
 Disadvantage: Not as many variations as nuclear
DNA, thus not as specific to individual
 Advantage: Doesn’t degrade as quickly as nuclear
DNA
• Useful for old, skelontonized remains, mass graves, lost
soldiers, etc.