Download View/Open - Dora.dmu.ac.uk

In vitro Plant Culture System induces Phase Transition in Fruit-Bearing
Plants
T. Sgamma and B. Thomas
School of Life Sciences,
University of Warwick,
Gibbet Hill Road, Coventry,
West Midlands CV4 7AL,
United Kingdom
M. Cirilli and R. Muleo
Dept. Agriculture, Forestry, Nature & Energy,
University of Tuscia,
Via S.C. DeLellis snc, 01100 Viterbo
01100 Viterbo
Italy
E. Caboni
Agricultural Research Council (CRA),
Fruit Tree Research Center,
Via di Fioranello, 52,
00134 Rome,
Italy
C. Iacona
Dept. Agriculture, Food and Environment
University of Pisa,
Via del Borghetto, 80,
56124 Pisa
Italy
Keywords: in vitro culture, Prunus persica L. Batch, phase changing, gene expression,
epigenetic, microRNA
Abstract
The juvenile to adult switch is the most important post-embryonic transition.
In woody plants the juvenile phase can last many years with a great economic
impact. In Arabidopsis, the small RNAs miR156 and miR172 play a crucial but
opposite role in the regulation of this process. miR156 maintains juvenility,
negatively regulating SPLs genes, while miR172 promotes adult transition, targeting
the floral repressors AP2-like transcription factors. In this work, peach (Prunus
persica L. Batch) orthologs of Arabidopsis epigenetic and genetic factors involved in
the juvenility to adult phase transition were studied. In peach, higher levels of ppamiR156 were detected in seedlings, in vitro and extra vitro plants than in adult
plants. Also, PpSPLs were more expressed in adult plants, confirming a possible role
for the miR156-SPL pathway in promoting juvenile-like characteristics. ppa-miR172
expression level was low in seedlings and in vitro plants but an increase was observed
in the adult donor plant, corresponding to lower expression of PpAP2-like genes. In
Arabidopsis, flower induction is also promoted by activation of the FLOWERING
LOCUS T (FT) gene. In peach leaf tissue, low levels of PpFT-like expression in
rejuvenated plants and seedlings were detected. We propose that, in peach,
conserved key genes present in herbaceous plants and woody species are involved in
juvenile to adult and adult to juvenile-like phase transitions.
INTRODUCTION
After germination, plants pass through a juvenile period mainly characterized by
their inability to differentiate reproductive structures. The subsequent transition to the
adult phase involves plant morphological and physiological characteristic changes,
through a coordinated process of cellular differentiation and organ formation. These
changes are exemplified by phyllotaxy, leaf morphology, growth vigour, rooting potential
and most importantly, flowering competence. In annual plants, the juvenile to adult
1
transition occurs relatively soon after germination and, usually, in many perennial woody
plants it occurs after several years (Poethig, 2010). Shoots grown in vitro can assume
some characteristics of the plants in their juvenile phase such as small leaf size and high
rooting ability, but the “rejuvenation” response induced by tissue culture can be different
in different species (George, 1993).
Recent studies have begun to reveal the molecular mechanisms that regulate phase
transitions in the annual model species Arabidopsis and maize. Two evolutionary highly
conserved microRNAs (miRNAs), miR156 and miR172, and their targets have been
identified as key components of the genetic control mechanisms that underlie vegetative
phase changes (Wu et al., 2009). miR156 targets SQUAMOSA PROMOTER BINDING
PROTEIN-LIKE (SPL) family transcription factors, which promote adult transition upregulating key MADS-box genes, like APETALA1 (AP1), LEAFY (LFY) and FRUITFULL
(FUL). In addition, the SPL gene family regulates some important aspects of the adult
phase, such as leaf shape, trichomes distribution and phyllotaxy. Antagonistically to
miR156, miR172 promotes adult transition targeting key floral repressors belonging to
the AP2-like transcription factor family genes: APETALA2 (AP2), TARGET OF EAT1
(TOE1), 2 and 3, SCHLAFMUTZE (SMZ), and SCHNARCHZAPFEN (SNZ) (Zhu et al.,
2011). Over-expression of miR156 in Populus delays adult transition, suggesting that the
miR156-SPL pathway regulates vegetative phase changes in many flowering plants,
including woody plants (Wang et al., 2011). Indeed, miR156 as well as the SPL gene
family is phylogenetically conserved between all major plant taxa, including bryophytes
(Preston et al. 2013). An understanding of the mechanisms that regulate competence to
flower is important, especially in perennial plants where a shortened juvenile phase could
greatly facilitate breeding programs and genetic improvements.
In peach (Prunus persica L. Batch), the juvenile phase is generally shorter
compared to other woody plant species, lasting about 3-5 years and this time can be
reduced if the plant is cultivated under favourable conditions (Layne and Bassi, 2008). In
this species, apart from some morphological and physiological characters such as leaf
size, growth vigour and photosynthetic activity, major dimorphisms between juvenile and
adult phases are not particularly evident. Furthermore, the small genome size and the
availability of its entire sequence make P. persica a suitable model species to study the
molecular mechanisms that regulate phase changes in fruit-bearing trees.
Micropropagation is an important industrial activity and has applications in plant
propagation, plant breeding, molecular biology and germplasm preservation. During
studies of the optimization of production protocols, it was observed that the in vitro
conditions can be stressful for the plant and lead to stress-related modifications, with
consequential economic damages (Von Anderkas and Bonga, 2000). Micropropagation,
starting with explants from mature trees, has two main problems: high rates of
contamination and occasional reversion to morphological juvenility (McCown, 2000;
Leifert et al., 1994).
In this work, we investigated whether the in vitro culture induces the effects of
'rejuvenation' of plants via the mechanism described above, regulating the transition from
adult to juvenile and back. Moreover, we also investigated if the relationship between
genetic and epigenetic mechanisms in the regulation of phase transition from juvenile to
adult in model species is conserved in peach.
MATERIALS AND METHODS
2
Prunus persica (L.) Batsch, cv Rich Lady, was chosen for this study. To achieve
genetically homogeneous material, in vitro shoot sterile cultures were obtained from a
single axillary bud, excised in spring from an in vivo growing adult plant located at the
Agricultural Research Council (CRA) Institute (Fioranello, Rome, Italy), as previously
reported (Gentile et al., 2014). The shoot cluster obtained was transferred into a 250 ml
vessel (Magenta, Sigma, Italy) containing 50 ml of a multiplication medium, consisting of
QL (Quoirin et al., 1977) macro-elements, MS micro-elements and organics, 30 g L-1
sucrose (Eridania, Italy) and 5.5 g L-1 agar (B & V, Italy). The medium was supplemented
by 0.25 mg L-1 BA, 3 mg L-1 adenine sulfate, 0.06 mg L-1 IBA and 0.03 mg L-1 GA3. The
pH was adjusted to 5.7 prior to sterilization in an autoclave and cultures were maintained
at 24° C under a 16 h photoperiod at 40 µmol m-2 s-1 photon flux density, provided by
cool white fluorescent tubes (Fluora L58 vv/77, Osram, Italy).
Sub-culturing on fresh media was performed every 21 days for a total period of 23
subcultures. After 18 subcultures of in vitro culture, part of the shoots were induced to
root on an MS medium supplied with 2 mg L-1 IAA and transferred under plastic tunnel to
a mixture of 50% of coconut peat, 40% peat and 10% perlite with 80% of humidity for 2
weeks, for acclimatisation. The humidity was gradually reduced over 2 weeks to 60% and
plantlets were transferred into a greenhouse and thereafter moved to an open field.
Seedlings were obtained by in vivo germination of seeds generated from selfpollinated embryos from the same adult donor plant.
Molecular analyses were carried out on leaves and buds. Leaves of in vitro plants
were sampled after 3, 18 and 23 subcultures, respectively. Leaves were also sampled at
the end of June from: the main shoots of extra vitro plants after 73 days from the
beginning of acclimatization, one-year-old shoots of adult plants and from the main
shoots of 4-month-old seedlings. Leaves from adult donor plants were sampled at the end
of June.
Total RNA was extracted from leaf and bud tissues using TRIzol (Invitrogen),
purified using miRNeasy kit (Qiagen, Germany) and quantified using QUBIT
fluorometer, following the respective manufacturers’ guidelines.
cDNA for RT-qPCR was synthesized using miScriptII kit (Qiagen, Germany),
following the manufacturers’ guidelines. 2 g of total RNA were reverse transcribed
using HiFlex buffer and modified oligo-dT primers with a 3' degenerate anchor and a
universal tag sequence on the 5' end, allowing amplification of both mature miRNA and
precursor in the real-time PCR step. Nucleotide sequences of target genes were identified
in Peach Genome V1.0 (Verde et al., 2013) by tBLASTX approach using aminoacidic
sequences of orthologs genes already characterized in other plant species. Identified
transcripts were used to design specific primers by Primer3 (www.Primer3.com). Primer
sequences, genomic position and transcript name are reported in Table 1. Specific primers
for ppa-miR156 (5’- TGACAGAAGAGAGAGAGCAC-3’) and ppa-miR172 (5’GAATCTTGATGATGCTGCA-3’) were designed based on sequences of their most
abundant isoforms, according to Zhu et al. (2012).
Real-time PCR analysis was conducted using the thermal cycler LC480II®
(Roche, Italy). Each reaction (20 µL) contained 10 µL of Light Cycler 480 SYBR Green I
Master (Roche, Italy), 0.5 µM of each primer, 1 µL of cDNA and 7 µL of water PCRgrade. The PCR reaction was conducted using the following conditions: 95° C for 10 min;
45 cycles at 94° C for 20 sec, 58° C for 30 sec and 72° C for 30 sec, followed by a
melting cycle from 65° to 95° C. Quantitative Real-time PCR was performed using three
biological replicates, with three technical replicates for each sample. Data were expressed
3
with the 2ΔΔCp method (Kubista et al., 2006) using ACTIN (Table 1) as an endogenous
reference gene for the normalisation of expression analysis. One-way ANOVA and
Student-Newman-Keuls test were used for comparison of multiple groups, considering p
< 0.05 as statistically significant.
Eight growing seedlings, extra vitro plants and growing shoots of the adult donor
plants were randomly chosen for measuring leaf dimensions. For all types of plants, the
sampled fully expanded leaves were collected on the same nodal position (3rd, 4th, 5th, 6th),
starting from the shoot apex. Leaf length (ll) and maximum width of leaf (lw) were
measured, the leaf shape index (LSI = ll/lw) was calculated and the internode elongation
was measured between the 3rd and the 6th node from the apex along the shoot axis.
RESULTS AND DISCUSSION
In many species, the juvenile and adult phases are characterized by marked
differences in leaf characteristics such as shape, size and internode length (Kerstetter and
Poethig, 1998). Bitonti et al. (2002) have reported differences in peach leaf dimensions
and internode elongation. In our work, leaf size measurements of seedlings and extra vitro
adapted plants have been determined in the same year of germination and adaption to in
vivo, respectively. To standardize the physiological state among the plants and the sprouts
sampled on donor plant, measurements have been run when the apical bud of the sprouts
and plants ceased to grow. As different organs at different developmental stages of the
plants were measured, data were analysed carrying out the mean and the standard
deviation of a single data set, separately from the other groups. A difference in size was
also observed between the leaves of shoots sampled from the adult donor plant, those of
seedlings and the leaves from extra vitro plants (Table 2). Leaves of seedlings, although
having the same age as the adult plants, had a smaller leaf blade. Leaves from extra vitro
plants, even when fully expanded at the end of the growing season, had a reduced blade
size. The size was even smaller than the seedling ones, but the LSI was similar to that of
the seedlings leaves. This could be an indication that the extra vitro plants were still in a
“re-juvenile” phase. However, the medium length of internodes indicated that these plants
were overcoming the juvenile phase since the internodes length did not differ from that of
shoots of the adult plants, while this parameter was significantly higher in the seedlings
(Table 2). In fact, internode elongation is considered to be another distinctive feature of
the dimorphism that occurs between the juvenile and adult phases in peach and in many
other species (Bitonti et al., 2002; Huijser and Schmid 2011).
In Arabidopsis, the transcription factor FLOWERING LOCUS T (FT) plays a
pivotal role in the phase changing promotion and flowering induction and its activity is
down-regulated during juvenility by TEMPRANILLO (TEM) through the photoperiodic
and gibberellin pathways (Osnato et al., 2012; Sgamma et al., 2014). FT integrates
information from different internal pathways and external factors and the movement and
accumulation of its protein to the shoot apex induce flowering (Song et al., 2013). In
peach leaf tissue, low expression levels of PpFT-like were detected in vitro growing
plants and extra vitro plants, with a significant lower level detected in seedlings (Fig. 1).
Although in the extra vitro plants, the level of the transcripts was higher compared to the
other two types of plants, it was almost 4 times lower than in the adult donor plant (Fig.
1). Similar results have been detected for the PpSOC1-like gene (Data not shown), which
positively regulate the flowering induction and the phase changing (Lee and Lee, 2010).
An opposite gene expression trend has been detected for the PpTEM-like gene; in fact, the
highest level of transcripts has been found in the seedlings plants and the lowest in the
4
adult donor plant (Fig. 1). In the in vitro plants and in extra vitro plants the transcript
levels were reduced but not completely repressed. The lower TEM levels in in vitro and
extra vitro plants could be still enough for repressing FT expression. The results observed
in the seedlings and adult plants confirm the antagonistic role of TEM on FT expression in
negatively controlling the juvenile phase length as shown in previous works where TEM
levels declined when FT levels were shown to increase after the end of juvenility
(Castillejo and Pelaz, 2008; Sgamma et al., 2014).
In Arabidopsis, miR156-SPLs and miR172-AP2 pathways control the juvenileadult transition (Wu et al. 2009). After germination, miR156 gradually declines while
miR172 shows an inverse regulation pattern, increasing until differentiation of floral
organs (Wu et al. 2009). To explore the possibility that these mechanisms are also
conserved in peach we analysed the expression of miR156 and miR172 and their putative
target genes. Higher levels of peach miR156 were detected in seedling, in vitro and extra
vitro plants compared to adult donor plant. Also, the peach genes PpSPL3, PpSPL9-like 1
and 2 became more expressed in adult plants (Fig. 2). As reported by Zhu et al. (2012),
PpSPL9-like 1 and 2 are validated targets of ppa-miR156. Our results showed that
PpSPL3-like fits into an inverse regulatory pattern compared to miR156. Thus, we
suggest that PpSPL3-like could be involved in promoting adult transition. The expression
level of ppa-miR172 was significant lower in seedlings and in vitro plants, higher in extra
vitro plants and significantly higher in the donor adult plant (Data not shown). miR172 is
a translational repressor of TOE1/2/3-AP2 genes, which in turn are repressors of FT and
SOC1 genes (Chen, 2003). In donor adult peach plants the level of PpTOE1-like became
lowest in adult donor plants and an inverse relationship between miR172 and target genes
was detected in all types of plants (Data not shown).
CONCLUSIONS
The plant changing phase is affected by developmental and environmental factors. Many
plants require permissive signals from day length and temperature history to initiate
flowers. When flowering occurs, the plant acquires complete adult characteristics. When
this phase is reached, it is often no longer feasible to propagate the plant by agamic
methods. The in vitro plant production aims to establish reactive explants, producing new
shoots with several well-spaced nodes to be subcultured, easy to root, and to be
acclimatized into an in vitro environment. These traits have been related with tissue
juvenility (George, 1993). Poor in vitro response or unsuccessful rooting of explants of
old trees or shrubs is attributed to the lack of juvenility factors in older tissues (George
1993). We used the in vitro growing plants condition to assess whether, in woody species,
the re-juvenility is under epigenetic and genetic regulation of miR156 and miR172, and
their target genes. Results confirmed that the regulatory system of the two micro-RNAs
and their target genes is conserved in peach plants. This pathway plays an important
regulatory role on the genetic network that pushes back plants from the adult phase into
juvenility under in vitro conditions, where plants’ characteristics are more similar to
seedling plants characterized by the juvenile vegetative phase.
ACKNOWLEDGEMENTS
This study was financially supported by the Italian “Ministero delle Politiche
Agricole Alimentari e Forestali”, part of the FRU.MED (D.M. 3690/7303/08)
Literature Cited
5
Bitonti, M.B., Cozza, R., Chiappetta, A., Giannino, D., Ruffini Castiglione, M., Dewitte, W.,
Mariotti, D., Van Onckelen, H., Innocenti, A.M. 2002. Distinct nuclear organization, DNA
methylation pattern and cytokinin distribution mark juvenile, juvenile-like and adult
vegetative apical meristems in peach (Prunus persica (L.) Batsch). J. Exp. Bot. 53:1047-1054.
Castillejo, C., Pelaz, S. 2008. The balance between CONSTANS and TEMPRANILLO activities
determines FT expression to trigger flowering. Curr. Biol. 18:1338-1343.
Chen, X. 2003. A microRNA as a translational repressor of APETALA2 in Arabidopsis flower
development. Science 303:2022-2025.
Gentile, A., Jaquez Gutierrez, M., Martinez, J., Frattarelli, A., Nota, P. and Caboni, E. 2014.
Effect of meta-Topolin on micropropagation and adventitious shoot regeneration in Prunus
rootstocks. Plant Cell Tiss. Org. Cult. (In press).
George, E.F. 1993. Plant propagation by tissue culture, Part 1: The technology (2nd edition).
Exegetics Ltd. Edington.
Huijser, P. and Schmid, M. 2011. The control of developmental phase transitions in plants.
Development 138(19):4117-4129.
Kerstetter, R. A. and Poethig, R. S. 1998. The specification of leaf identity during shoot
development. Annu. Rev. Cell Dev. Biol. 14:373-398.
Kubista, M., Andrade, J.M., Bengtsson, M., Forootan, A., Jonak, J., Lind, K., et al. 2006. The
real-time polymerase chain reaction. Mol. Aspects Med. 27:95-125.
Layne, D.R., Bassi, D. 2008. The peach: Botany, production, and uses. HortSci. 43(4):1190-1191.
Lee, J., Lee, I. 2010. Regulation and function of SOC1, a flowering pathway integrator. J. Exp.
Bot. 61:2247-2254.
Leifert, C., E. Morris & W.M. Waites. 1994. Ecology of microbial saprophytes and pathogenes in
tissue culture and field-grown plants: reasons for contamination problems in vitro. Crit. Rev.
Plant Sci. 13(2):139-183.
McCown, B.H. 2000. Recalcitrance of woody and herbaceous perennial plants: Dealing with
genetic predeterminism. In Vitro Cell. Devol. Biol. 36:149-154.
Osnato, M., Castillejo, C., Matias-Hernandez, L. and Pelaz, S. 2012. TEMPRANILLO genes link
photoperiod and gibberellin pathways to control flowering in Arabidopsis. Nat. Commun. 3.
Poethig, R.S. 2010. The past, present, and future of vegetative phase change. Plant Physiol
154:541-544.
Preston, J. C., Hileman L.C. 2013. Functional evolution in the plant SQUAMOSA-PROMOTER
BINDING PROTEIN-LIKE (SPL) gene family. Front Plant Sci. 4:80.
Sgamma, T., Jackson, A., Muleo, R., Thomas, B., Massiah, A. 2014. TEMPRANILLO is a
regulator of juvenility in plants. Scientific Reports 4:3704.
Song, Y.H., Ito, S., Imaizumi, T. 2013. Flowering time regulation: photoperiod and temperature
sensing in leaves. Trends Plant Sci. 18(10):575-583.
Verde, I., Abbott, A.G., Scalabrin, S., Jung, S., Shu, S., Marroni, F., Zhebentyayeva, T., Dettori,
M. T., et al 2013.The high quality draft genome of peach (Prunus persica) identifies unique
patterns of genetic diversity, domestication and genome evolution. Nat. Genet. 45(5):487-496.
Von Aderkas, P. and Bonga, J.M. 2000. Influencing micropropagation and somatic
embryogenesis in mature trees by manipulation of phase change, stress and culture
environment. Tree Physiol. 20:921-928.
Wang, J.W., Park, M.Y., Wang, L.J., Koo, Y., Chen, X.Y., Weigel, D. and Poethig, R.S. 2011.
miRNA control of vegetative phase transition in trees. PLoS Genet.7: e1002012
Wu, G., Park, M.Y., Conway, S.R., Wang, J.W., Weigel, D. and Poethig, R.S. 2009. The
sequential action of miR156 and miR172 regulates developmental timing in Arabidopsis. Cell
138:750–759.
Zhu, Q.H., Helliwell, C.A. 2011. Regulation of flowering time and floral patterning by miR172. J.
Exp. Bot. 62:487–95
6
Zhu, H., Xia, R., Zhao, B., An, Y., Dardick C., et al., 2012. Unique expression, processing
regulation, and regulatory network of peach (Prunus persica) miRNAs. BMC Plant Biol.
12:149.
Tables
Table 1. Identificative number of gene transcript as reported into the Peach Genome,
primer sequences for qPCR analysis and amplicon size. F indicates forward primers while
R indicates reverse primers.
Gene
Transcript
SPL3
ppa012607m
SPL9-like1
ppa007056m
SPL9-like2
ppa021582m
AP2
ppa003783m
TOE-like1
ppa005230m
TOE-like2
ppa021782m
FT-like
ppa012320m
TEM-like
ppa006243m
SOC1
ppa016511m
ACTIN
ppa007242m
Primer sequence (5'- 3')
F. CAGGTTCCATAGCCTATCAGAGTT
R. CTCTCCATGATATTCAGAGGAGGT
F. CCAACAGTGTAGCAGATTTCATCA
R. TAGATAGATGAAGAAAGTCGGCCA
F. GAGTCTCGGAGCTTCATACAAATC
R. CTTTGTGCCTGGAATAGTAAGCTT
F. CTTCTACTCAGAACCAACCTTCAT
R. CTGAACATGGTGGTAATTGTTTGG
F. GAAAGAGCAACGGAAAAGAGAATG
R. TTGAAGAAGGGAATCCTGATGATG
F. CAGCAATCAAATGTAATGGAAGGG
R. GATATCCCCAAATTCAGATCGAGA
F. GGACTTTCTACACTCTGGTC
R. GGGCTTTCATAACACACAATC
F. GTCAAAGTTACGTGTTGACCAAAG
R. AATCGATATAAAGCTGCTTGTCCT
F. AGACAACCATACCAGCAACAAATC
R. TTCAATAGTGCATGATCCTAGACC
F. ATACTGAGGACATTCAACCC
R. GACCCATACCAACCATAACA
Amplicon size
(bp)
109
152
179
150
133
127
148
120
151
144
Table 2. Leaf dimensions and internode elongation in eight 4-months old shoots of the
adult donor plants, eight 4-months old seedlings and 2.5-months old extra vitro plants.
Leaf structural index calculated as the ratio between longitudinal and transversal section
of the leaf. The values represent the average ± SD of 32 sampled leaves for each type of
plant and 24 internodes for each type of plant.
Adult plant
4-months shoot
Seedling
4-months
Extra vitro
plant
2.5-months
Leaf length (ll, mm)
134.9 ± 6.7
87.7 ± 5.5
71.2 ± 4.9
Leaf width (lw, mm)
29.6 ± 1.8
21.5 ± 1.5
16.8 ± 1.6
LSI (mm)
4.55 ± 0.12
4.07 ± 0.17
4.24 ± 0.17
Internode length (mm)
24.7 ± 2.5
32.2 ± 3.7
24.3 ± 2.1
7
Figures
Fig. 1. Relative expression of P. persica FT-like and TEM-like genes in leaf of adult
donor plant, in vitro and extra vitro plants, and seedlings. Histograms represent the
average and bars indicate ± SE. Different letters indicate statistically differences.
Fig. 2. Relative expression of ppa-miR156 and SPL-like genes in leaf of adult, in vitro
and extra vitro plants, and seedlings. Histograms represent the average and bars indicate ±
SE. Different letters indicate statistically differences.
8