Download Development of a DNA vaccine against chicken anemia virus by

Comparative Immunology, Microbiology and Infectious Diseases 34 (2011) 227–236
Contents lists available at ScienceDirect
Comparative Immunology, Microbiology
and Infectious Diseases
journal homepage: www.elsevier.com/locate/cimid
Development of a DNA vaccine against chicken anemia virus by using a
bicistronic vector expressing VP1 and VP2 proteins of CAV
Hassan Moeini a , Abdul Rahman Omar b , Raha Abdul Rahim b,c , Khatijah Yusoff a,b,∗
a
b
c
Department of Microbiology, Faculty of Biotechnology and Biomolecular Sciences, Universiti Putra Malaysia, 43400 Serdang, Selangor, Malaysia
Institute of Bioscience, Faculty of Biotechnology and Biomolecular Sciences, Universiti Putra Malaysia, 43400 Serdang, Selangor, Malaysia
Department of Molecular Biology, Faculty of Biotechnology and Biomolecular Sciences, Universiti Putra Malaysia, 43400 Serdang, Selangor, Malaysia
a r t i c l e
i n f o
Article history:
Received 29 September 2010
Accepted 15 November 2010
Keywords:
Chicken anemia virus
DNA vaccine
VP1
VP2
a b s t r a c t
In the present study, we describe the development of a DNA vaccine against chicken anemia virus. The VP1 and VP2 genes of CAV were amplified and cloned into pBudCE4.1 to
construct two DNA vaccines, namely, pBudVP1 and pBudVP2-VP1. In vitro and in vivo
studies showed that co-expression of VP1 with VP2 are required to induce significant levels of antibody against CAV. Subsequently, the vaccines were tested in 2-week-old SPF
chickens. Chickens immunized with the DNA-plasmid pBudVP2-VP1 showed positive neutralizing antibody titer against CAV. Furthermore, VP1-specific proliferation induction of
splenocytes and also high serum levels of Th1 cytokines, IL-2 and IFN-␥ were detected in
the pBudVP2-VP1-vaccinated chickens. These results suggest that the recombinant DNA
plasmid co-expressing VP1 and VP2 can be used as a potential DNA vaccine against CAV.
© 2010 Elsevier Ltd. All rights reserved.
1. Introduction
Chicken anemia virus (CAV) belongs to Gyrovirus genus
of Circoviridae family. It is a small nonenveloped virus
resistant to thermal inactivation and treatment with lipid
solvents and many of the common disinfectants [1,2].
Infections with CAV are considered to be economically
significant because vertical transmission of the virus by
eggs from infected breeder flocks can result in increased
mortality in young chicks [1–3]. In addition, the virus has
the potential to induce immune dysfunction alone or in
combination with other pathogens [3]. The genome, a circular single-stranded DNA, codes for three viral proteins:
VP1, the 52 kDa structural capsid protein; VP2, a 28 kDa
non-structural protein with dual-specificity phosphatase
activity; and VP3, the smallest protein of about 13 kDa,
∗ Corresponding author at: Department of Microbiology, Faculty of
Biotechnology and Biomolecular Sciences, Universiti Putra Malysia (UPM),
43400 Serdang, Selangor, Malaysia. Fax: +60 388903972.
E-mail address: [email protected] (K. Yusoff).
0147-9571/$ – see front matter © 2010 Elsevier Ltd. All rights reserved.
doi:10.1016/j.cimid.2010.11.006
known as apoptin which induces apoptosis in erythrocyte
precursors and thymocytes, resulting in immunodeficiency
[4–6]. Among them, VP1 is the main protective protein
inducing neutralizing antibodies [7].
Vielitz and Landgraf [8] have developed a vaccine
against CAV, which is based on non-attenuated virulent
CAV propagated in chicken embryos. An attenuated live
vaccine, developed by Steenhuisen et al. [9] is also commercially available. However, these vaccines cannot be used in
chickens in lay and within 21 days of slaughter. Furthermore, live attenuated vaccine may cause clinical disease if
not attenuated sufficiently and sometimes spreading of the
modified viruses to young chickens may cause the disease.
In a recent development, plasmid DNA-based vaccines
have emerged as one of the more promising applications
of non-viral gene therapy. DNA vaccines are potentially
safer than other traditional vaccines; have the potential
for simultaneous immunization against multiple antigens
or pathogens; and more importantly, they can stimulate both humoral and cell-mediated immune responses,
making them attractive for the development of effective
subunit vaccines against viral and bacterial pathogens
228
H. Moeini et al. / Comparative Immunology, Microbiology and Infectious Diseases 34 (2011) 227–236
Fig. 1. Map of the recombinant plasmids pBudVP1 and pBudVP1-VP2. To construct pBudVP1, VP1 gene of CAV was cloned downstream of EF-1␣ promoter.
pBudVP2-VP1 was constructed by the insertion of VP2 gene into the SalI and BamHI sites of CMV MCS and VP1 gene into the NotI and KpnI of EF-1␣ MCS.
which will likely require both neutralizing antibody and
cell-mediated immune responses for protection [10–12].
One such subunit vaccine against infectious chicken anemia was developed by using recombinant baculovirus as a
vector for the expression of the CAV proteins [7]. It was
shown that co-synthesis of VP1 and VP2 was required
for the induction of neutralizing antibodies that protected
progeny chicks against CAV challenge [7,13,14]. However,
vaccination with plasmid DNAs encoding these proteins of
CAV has not been studied. We therefore report the development of a DNA vaccine against CAV using a eukaryotic
co-expression vector encoding the VP1 and VP2 proteins
of CAV, simultaneously.
and KpnI sites of the vector under the control of the EF-1␣
promoter, while the gene for VP2 was inserted into the
SalI and BamHI sites, downstream of the CMV promoter.
After transformation into Escherichia coli, cells carrying
the recombinant plasmids were selected on LB agar containing Zeocin (25 ␮g/ml, Invitrogen, USA). Plasmids were
extracted using the alkaline lysis method as described by
Sambrook and Russell [15]. The correct orientation and
nucleotide sequence of the inserted genes were verified by
double-stranded sequencing (Medigene, Malaysia). All the
plasmid constructs and the control plasmid were purified
using a large-scale endotoxin-free plasmid purification kit
(Qiagen, USA). The purified plasmids were resuspended in
sterile endotoxin-free PBS.
2. Materials and methods
2.3. Transfection of MSB1 cells
2.1. Chickens and CAV genes
Specific pathogen free (SPF) chicken eggs were obtained
from Malaysian Vaccines & Pharmaceuticals Sdn Bhd,
Selangor, Malaysia. The eggs were hatched and maintained
under specific-pathogen free condition with free access
to feed and water. All procedures were conducted with
the protocols approved by Animal Care and Use Committee of the Faculty of Veterinary Medicine, Universiti Putra
Malaysia (UPM). Recombinant pCR2.1(VP1–VP2) cloning
vector containing VP1 and VP2 genes of CAV isolate SMSC1 (Accession No. AF285882) was obtained from the Faculty
of Veterinary Medicine, UPM.
2.2. Construction of DNA vaccines
The pBudCE4.1 co-expression vector (Invitrogen, USA)
was used to construct the DNA vaccines, pBudVP1 encoding
the CAV VP1 protein and pBudVP2-VP1 encoding the VP1
and VP2 genes of CAV, synchronously. The full length of the
VP1 with the exception of the last 12 nucleotides and the
full ORF of VP2 were amplified from the pCR2.1(VP1-VP2)
plasmid using a pair of VP1-specific primers 5 GTAACGCGGCCGCACCATGGCAAGACGAGCTCGC3 and 5 CTAGGGGTACCCCAGTACATGGTGCTGTTGG3 and VP2-specific
primers 5 GCTAAGTCGACACCATGCACGGGAACGGC3 and
5 CATGGGGATCCCACTATACGTACCGG-GGC3 , and then
cloned into pBudCE4.1 to construct the DNA plasmids. As
shown in Fig. 1, the VP1 gene was inserted into the NotI
Chicken MSB1 cells were transfected with the constructed plasmids using LipofectamineTM 2000 reagent
(Invitrogen, USA). Briefly, a MSB1 cell suspension was prepared in RPMI medium supplemented with 10% (v/v) FBS
and 10% (v/v) TPB. The cells were harvested and washed
with serum-free medium without antibiotics. The cell
suspension (0.5 ml) containing 1 × 105 cells was then dispensed into each well of 6 wells culture plate. For each
well, 4 ␮g of plasmid in 250 ␮l of serum free medium was
mixed with 10 ␮l of Lipofectamine 2000 in 250 ␮l of serumfree medium and then the mixture was incubated at room
temperature for 20 min before adding to the wells. After
rocking the plate, the cells were incubated at 39 ◦ C in a CO2
incubator for 5 h. Thereafter, 2 ml RPMI medium containing 10% FBS and 10% TPB was added to each well and then
incubated in the above conditions for 48 h prior to testing
for expression.
2.4. In vitro expression analysis
In vitro expression of the gene inserts was studies in the
transfected MSB1 cells by RT-PCR. After 48 h of transfection,
total RNA was extracted using Trizol reagent from the cells
and then treated with DNase I (1 ␮/␮l, Fermentas, Canada)
prior to RT-PCR. After verification of DNA removal by PCR
using the specific primers used for PCR amplification (see
above), DNA-free samples were processed directly for RTPCR. RNA extracted from normal MSB1 cells was used as
H. Moeini et al. / Comparative Immunology, Microbiology and Infectious Diseases 34 (2011) 227–236
negative control. The RT-PCR reactions were performed in
25 ␮l volume in a Gradient Thermal Cycler (BioRad, USA).
Following an reverse transcription step at 45 ◦ C for 45 min
and then denaturation at 94 ◦ C for 3 min, the samples were
subjected to 35 cycles of 40 s at 94 ◦ C; 1 min at 55 ◦ C; 2 min
at 68 ◦ C; and a final elongation step at 68 ◦ C for 10 min. The
reaction products were analyzed by electrophoresis on a 1%
agarose gel, and then visualized by staining with ethidium
bromide.
The transfected cells were also tested for the presence
of the viral proteins by Western blot analysis using mouse
anti-His monoclonal antibody (Promega, USA) or chicken
anti-CAV hyperimmune serum prepared by Hailemariam
et al. [16] as primary antibodies and anti-mouse IgG or antichicken IgY conjugated to alkaline phosphatase (Promega,
USA) as secondary antibodies.
2.5. Indirect immunofluorescence
The expression of the genes was also evaluated by
immunofluorescence test according to Richter and Wick
[17]. Transfected cells were washed with 1× PBS (pH 7.4)
and fixed with cold acetone–methanol solution (ratio 1:1)
for 10 min. The cells were then overlaid with anti-His monoclonal antibody or chicken anti-CAV serum diluted at ratio
1:500 in TBST [0.01% (v/v) Tween-20, 20 mM Tris base,
0.5 M NaCl, pH 7.5] and incubated at RT for 1 h. Cells were
washed three times by TBST and incubated with a secondary fluorescein isothiocyanate (FITC) anti-mouse IgG
or anti-chicken IgY (Promega, USA) diluted at 1:200 at RT
for 1 h. Following three times washing with TBST, the cells
were air dried and observed using an inverted phase contrast microscope with fluorescent light.
2.6. DNA vaccination
Two-week-old SPF chicken were divided into four
groups (n = 10). Groups 3 and 4 were immunized with
150 ␮g of plasmid pBudVP1 and pBudVP1-VP2 in PBS,
respectively, by intramuscular injection. As control, chickens in Groups 1 and 2 were injected with PBS or the
parental plasmid, respectively. Chickens were immunized
three times, at 2 weeks intervals.
2.7. In vivo expression analysis
In vivo expression of the viral genes VP1 and VP2 was
studied in the skeletal muscles at the site of injection of
the vaccinated chickens 10 days post-immunization by RTPCR and Western blotting. Total RNA was extracted from
the skeletal muscle of the vaccinated chickens using Trizol. After treatment with DNase I and verification of DNA
removal by PCR, DNA-free samples were subjected to RTPCR. RNA extracted from the control chickens was used
as a negative control. The RNA preparation was standardized by RT-PCR for the chicken housekeeping gene, ␤-actin
using the specific primers 5 ATGTGCAAGGCCGGTTTCGC3
and 5 TCCTCAGGGGCTACTCTCAG3 which were designed
based on the published sequence of the gene (Accession
No. EU931581).
229
For Western blot analysis, the skeletal muscles at the
site of injection was harvested; homogenized and their
proteins were extracted using RIPA (50 mM Tris pH 7.4,
150 mM NaCl, 1 mM EDTA, 5 ␮g/ml Aprotinin, 5 ␮g/ml Leupeptin, 1% Triton X-100, 1% sodium deoxycholate, 0.1% SDS,
1 mM PMSF) and then subjected to Western blotting using
anti-His monoclonal antibody.
2.8. Antibody assays
Blood was withdrawn from the wing vein of the chickens before vaccination and 10 days after the last vaccination
and serum antibody titers against CAV were determined
by IDEXX ELISA kit (IDEXX, Portland, ME, USA). The kit
uses a blocking format ELISA for the detection of antibodies to CAV in chicken serum. The assay has correlation to
virus neutralizing titer. ELISA was performed according to
the procedures recommended by the manufacturer. ELISA
titers higher than 1000 were considered positive.
2.9. Virus neutralization assay
Virus neutralization (VN) test is an assay used frequently to determine the ability of antibodies to neutralize
the virus infectivity after vaccination. Traditional formats
of CAV virus neutralization test use the microscopic observation of cytopathic effect (CPE) in the infected cells.
However, the replication of CAV in only MSB1 suspension
cells makes microscopic reading of CPE difficult. Therefore,
in the present study, neutralizing antibodies were evaluated by the measurement of cell proliferation and viability
using cell proliferation reagent WST-1 (Roche, Germany)
following the method described by Lehtoranta et al. [18]
with some modifications. Briefly, two-fold serial dilutions
of heat-inactivated (56 ◦ C for 30 min) sera were prepared
in RPMI medium to achieve a dilution range from 1:4 to
1:2048. The diluted sera (50 ␮l) were transferred into flatbottom 96-wells microplates and then mixed with equal
volume of 105 TCID50 of CAV SMSC-1 strain. After 60 min
incubation at 39 ◦ C, 200 ␮l MSB-1 cells were added to each
well at a concentration of 1.5 × 105 cells/ml followed by
further incubation at 39 ◦ C and 5% CO2 for 5 days. RPMI
medium with virus (non-neutralized virus) and or with
positive anti-CAV (SMSC-1) serum was served as negative
and positive controls, respectively. At 5 days of incubation,
10 ␮l of WST-1 reagent (Roche, Germany) was added to
each well and the plates were further incubated at 37 ◦ C
for 4 h in a humidified atmosphere to let the colour reaction develop. Subsequently, the plates were centrifuged at
1000 × g for 10 min to remove the cells. The supernatants
were transferred into new microplates and the absorbance
of the samples against a background control as blank was
measured at 450 nm wavelength. The mean absorbance
value from the triplicates was measured for each serum
dilution and the controls. Neutralizing activity was calculated as described by Lehtoranta et al. [18].
2.10. Splenocyte proliferation assay
Ten days after the last vaccination, spleens of the immunized and control chickens were harvested, and single
230
H. Moeini et al. / Comparative Immunology, Microbiology and Infectious Diseases 34 (2011) 227–236
Fig. 2. Expression analysis of the constructs in vitro. MSB1 cells were transfected with the recombinant plasmids. After 48 h of the transfection, expression
of the genes was carried out by RT-PCR (A) and Western blotting (B). A: transcriptional expression analysis of the VP1 (lanes 1 and 3) and VP2 (lane 2)
by RT-PCR in the pBudVP2-VP2- (lanes 1 and 2) and pBudVP1-transfected (lane 3) cells. B: Western blotting using anti-His monoclonal antibody (lanes 2
and 3) or anti-CAV serum (lanes 4–6). Lane 1: BenchMark Protein Ladder (Invitrogen, USA); lanes 2 and 4: pBudVP2-VP1-transfected cells; lanes 3 and 5:
pBudVP1-transfected cells; lane 6: control cells transfected with the parental plasmid.
cell suspensions were generated in PBS-EDTA solution
(1× PBS, 2 mg/ml EDTA) supplemented with 2% penicillin/streptomycin. Red blood cells were lysed using red
blood cell lysis solution containing 0.84% NH4 CL, 0.1%
NaHCO3 and 1.8 ml of 5% EDTA, followed with 5 min incubation at 4 ◦ C. The splenocytes were pelleted at 1000 rpm
for 10 min and then resuspended in DMEM medium
supplemented with 10% fetal bovine serum and 1% penicillin/streptomycin. Viable cells were counted by trypan
blue exclusion on a hemocytometer, prior to starting the
experiment. Chicken spleen cells were added to 96-well
plates in 0.1 ml at 2 × 104 cells/well (2 × 105 cells/ml) and
incubated in triplicate with the purified CAV VP1 antigen
(3 ␮g), and mitogen phytohemagglutinin (PHA 1 mg/ml,
Sigma), or medium alone as negative control. For preparation of the VP1 protein, the VP1 and VP2 genes of CAV were
cloned into pETDuet-1 vector to construct pETVP2-VP1 coexpressing the VP1 and VP2 genes (data not shown). After
transformation into E. coli BL21 (DE3) and induction by
IPTG, the VP1 protein was purified on Ni2+ affinity columns
(data not shown). The purified VP1 protein and PHA served
as experimental and positive stimulator, respectively. The
plates were incubated at 37 ◦ C in an atmosphere of 5% CO2
for 3 days. The proliferation response was evaluated by
BrdU cell proliferation assay kit (Exalpha Biologicals, USA).
Data is reported as stimulation indices (SI), which is the
mean of experimental wells/mean of antigen free wells
(negative control). SI greater than two was considered as
positive proliferative response.
2.11. Cytokines evaluation
Serum levels of Th1 cytokines, interleukin 2 (IL-2) and
interferon ␥ (IFN-␥) were determined by commercially
available ELISA kits (Cusabio Biotech, USA). The assay was
performed in 96-wells microplates pre-coated with antibody specific to chicken IL-2, or IFN-␥. The standard curve
concentrations were 0.19–12 pg/ml and 31.2–2000 pg/ml
for IL-2 and IFN-␥, respectively. The concentration of the
cytokines in the samples was determined by comparing the
OD of the samples to the standard curves.
For the reason that no commercial ELISA kits were
available for the detection of chicken IL-12, IL-4 and
IL-6 which play critical role in differentiation of CD4+
T cells into Th1 or Th2 cells, transcriptional expression of these cytokines were evaluated in the spleen
of the immunized chickens by RT-PCR using the specific primers 5 ACACATCTGATGAAGCACTGCC3 and
5 TTGGGATATGTCCAGGTCACAG3 for IL-12 (Accession
No. AY262752), 5 AGCTCTCAGTGCCGCTGATG3 and
5 TAGCTAGTTGGTGGAAGAAGG3 for IL-4 (Accession No.
NM 001007079), and 5 ATGAACTTCACCGAGGGCTGC3
and 5 ACGGTCTTCTCCATAAACGAAG3 for IL-6 (Accession
No. NM 204628) which were designed based on the published sequence of the genes. RT-PCR of chicken ␤-actin
(see above) was used as a positive control for verification
the quality of the RNAs.
2.12. Statistical analysis
The data was analyzed by t-test and statistical significance was set at p < 0.05. The results were expressed as
means ± standard error of mean. All the analysis was carried out using GraphPad Prism 5 and Windows Microsoft
Excel 2007.
3. Results
3.1. In vitro and in vivo expression of the viral genes
In order to determine the expression of the gene inserts,
transient gene expression was carried out in MSB1 cells.
RT-PCR analysis showed the expression of the both VP1
and VP2 genes in the cells transfected with pBudVP2-VP1,
whereas VP1 expression was observed in the cells transfected with pBudVP1 (Fig. 2A).
In order to determine the translational expression of
the DNA vaccines in vitro, transfected MSB1 cells were
tested by Western blot using anti-His monoclonal antibody or anti-CAV serum as primary antibody. As shown in
Fig. 2B, the cells transfected with the constructs, pBudVP2VP1 or pBudVP1, successfully expressed the gene inserts.
The expression of the VP1 protein (∼56 kDa) was detected
in the both pBudVP2-VP1- and pBudVP1-transfected cells
using anti-His monoclonal antibody (Fig. 2B, lanes 2 and 3).
However, anti-CAV serum only recognized the VP1 protein
H. Moeini et al. / Comparative Immunology, Microbiology and Infectious Diseases 34 (2011) 227–236
231
Fig. 3. In vitro expression of the viral proteins by indirect immunofluorescence. MSB1 cells were transfected with each of the recombinant plasmids using
Lipofectamine 2000 reagent and at 48 h later, the expression was detected by indirect immunofluorescence using anti-His monoclonal antibody (A and B)
or anti-CAV serum (C and D) as primary antibody. The images were observed under ×20 objective. A and C: cells transfected with pBudVP1; B and D: Cells
transfected with pBudVP2-VP1; E & F: Cells transfected with the parental plasmid.
which was co-expressed with the VP2 protein in the cells
transfected with pBudVP2-VP1 (Fig. 2B, lane 4), not in the
cells transfected with pBudVP1 (Fig. 2B, lane 5).
Indirect immunofluorescence using anti-His monoclonal antibody or anti-CAV serum also revealed the
expression of the proteins. Cells transfected with pBudVP2VP1 exhibited bright cytoplasmic fluorescence using both
anti-His antibody (Fig. 3B) and anti-CAV serum (Fig. 3D)
as primary antibodies, while pBudVP1-transfected cells
exhibited bright cytoplasmic fluorescence only by using
anti-His monoclonal antibody (Fig. 3A). The pBudVP1transfected cells showed very weak fluorescence using
anti-CAV serum (Fig. 3C). Cells transfected with the
parental plasmid showed no reaction with the antibodies
(Fig. 3E and F).
Expression of the genes in the constructs was also confirmed in vivo in the skeletal muscle at the site of injection
post-immunization using RT-PCR and Western blotting
(Fig. 4).
3.2. Antibody response of the immunized chickens
To evaluate the DNA vaccines, 2-week-old SPF chickens were immunized intramuscularly with pBudVP1 or
pBudVP2-VP1 in PBS and twice boosted with the same
amount of plasmids as the first injection. Sera antibody titer
232
H. Moeini et al. / Comparative Immunology, Microbiology and Infectious Diseases 34 (2011) 227–236
Fig. 4. In vivo expression analysis of the viral genes in the injected sites by RT-PCR (A) and Western blotting (B). (A): RT-PCR results for VP1 (lanes 1, 3
and 5) and VP2 (lanes 2 and 4) in the chickens injected with pBudVP2-VP1 (a), pBudVP1 (b) or parental plasmid (c) as negative control. (B) Translational
expression analysis of the genes by Western blotting using anti-His monoclonal antibody in the site of injection in the chickens injected with pBudVP2-VP1
(lane 1), pBudVP1 (lane 2) or empty plasmid (lane 3).
against CAV was evaluated pre- and post-immunization by
IDEXX ELISA kit. Table 1 summarizes the antibody titers
to CAV in the immunized chickens. Although chickens had
no detectable antibody titer to CAV before vaccination at 2
weeks old, chickens in Group 4 (injected with pBudVP2VP1) had average moderate antibody titer (1853 ± 89)
compared to Group 3 (injected with pBudVP1), which
showed no positive antibody titer post-immunization.
There was no detectable response in chickens immunized
with the control plasmid or PBS. These results indicated
that co-expression of VP1 and VP2 is necessary to efficiently
induce immune system against CAV, in agreement with
previous studies [7,13].
3.3. Virus neutralizing antibody titers
The serum samples from pBudVP2-VP1 and pBudVP1immunized chickens were tested for neutralization activity
against CAV infection in MSB1 cells. According to the
results, summarized in Table 2, the serum samples from
pBudVP2-VP1-injeted group were found to be positive for
neutralizing antibodies against CAV with titer ranging from
1:256 to 1:512, while the sera from the pBudVP1 group
showed negative neutralizing activity.
3.4. Cytokines evaluation in the vaccinated chickens
Serum levels of Th1 cytokines IL-2 and IFN-␥ were
assessed in the pBudVP2VP1-immunized chickens by
ELISA. The sera from the vaccinated group showed significantly (p < 0.05) high levels of IL-2 and IFN-␥ after
immunization when compared to the controls (Fig. 5). No
significant differences were observed between the vaccinated group and the controls pre-immunization. RT-PCR
analysis showed the presence of IL-12 mRNA in the spleen
of pBudVP2-VP1-injected chickens, whereas no detectable
expression of IL-4 and IL-6 was found in the vaccinated
chickens (results not shown).
3.5. Antigen-specific proliferation of splenocytes
In vitro proliferation assay of splenocytes which is
primarily used to monitor T-cell responses after immunization was carried out 10 days after the last vaccination.
The splenocytes of the chickens from pBudVP2-VP1 and
the control group vaccinated with the empty plasmid
were prepared and stimulated with the purified CAV
VP1 protein as antigen, or PHA as positive stimulator to give a non-specific stimulation. As shown in
Fig. 6, there was no significant difference (p > 0.05) in SI
between the pBudVP2VP1-vaccinated group and the control group, when the splenocytes were stimulated by PHA.
However, pBudVP2-VP1-immunized group showed significantly higher level of proliferative responses (p < 0.05) to
the CAV VP1 protein (mean SI 7.63) in comparison to the
control group (mean SI 1.15). These results indicated positive proliferative response of splenocytes against the VP1
antigen in pBudVP2-VP1-immunized chickens (SI > 2).
Table 1
ELISA antibody titers results in the vaccinated chickens.
Vaccinated groups
Serum antibody assays
Before vaccination
pBudVP2-VP1
pBudVP1
pBudCE4.1 (control)
PBS (control)
a
b
c
After vaccination
ELISA S/Na
ratiosb
Antibody titers
(mean ± S.D.)
ELISA resultc
ELISA S/N ratios
Antibody titers
(mean ± S.D.)
ELISA result
>0.8
>0.8
>0.8
>0.8
–
–
–
–
Negative
Negative
Negative
Negative
0.8–0.2
>0.8
>0.8
>0.8
1853 ± 89
–
–
–
Positive
Negative
Negative
Negative
S/N = sample OD650 /negative control OD650 .
ELISA S/N >0.8 negative titers; S/N 0.8–0.2 moderate titers; <0.2 high protective titers.
Antibody titers higher than 1000 are considered positive.
H. Moeini et al. / Comparative Immunology, Microbiology and Infectious Diseases 34 (2011) 227–236
233
Table 2
Neutralization activities of the serum antibodies in the vaccinated groups.
Sera groups
No. of samples
pBudVP2-VP1
7
pBudVP1
Parental plasmid
PBS
Anti-CAV serum (positive control)
7
2
2
1
4. Discussion
In the present study, two DNA vaccines against CAV have
been developed using the VP1 and VP2 genes of CAV isolate SMSC-1 as the target genes. It was showed that the
neutralizing epitope on VP1 was formed only when VP1
and VP2 were synthesized synchronously [7,13]. The interaction of the CAV proteins has been also demonstrated
by transient expression of the viral proteins in transgenic
plants whereby co-expression of VP1 and VP2 in Nicotiana
benthamiana had a marked alteration on the distribution of
VP1, forming large VP1 aggregates throughout the nucleus
[14]. As a result, VP1 and VP2 can be used to generate
a subunit vaccine against CAV infection. Therefore, the
co-expression vector pBudCE4.1 was chosen to be used
to develop DNA vaccines against CAV where two DNA
plasmids, pBudVP1 expressing the CAV VP1 protein and
pBudVP2-VP1 co-expressing the VP1 and VP2 genes of CAV,
were constructed. The DNA plasmid constructs were first
characterized using restriction enzyme analysis, PCR and
sequencing analysis prior to expression studies.
In vitro expression analysis in chicken MSB1 cells
revealed that VP1 protein capable to be recognized by
anti-CAV antibodies was produced, when expressed synchronously with VP2. These data were agreement of with
the finding of Noteborn et al. [13] that only Sf9 cells
infected with recombinant baculovirus co-expressiong VP1
and VP2, or co-infected with VP1- and VP2-recombinant
baculoviruses, react with the neutralizing antibodies. One
potential explanation of the requirement of the VP2 protein
might be that it act as a scaffold protein in virion assembly
[7,13].
In vivo evaluation of the constructs in SPF chicken
showed that only pBudVP2-VP1 co-expressing both VP1
and VP2 can induce the generation of anti-CAV neutralizing antibodies. From the ELISA results, chickens immunized
with pBudVP2-VP1 had positive antibody titer to CAV,
whereas pBudVP1 did not produce significant antibody
titer and inoculated chickens should be considered to have
a negative immune status, because according to the criteria
established in IDEXX CAV ELISA kit, samples with titers to
CAV lower than 1000 are considered negative. These results
were in agreement with the Western blot and immunofluorescence results where only the expressed VP1 protein in
the pBudVP2-VP1-transfected cells was recognized by antiCAV antibodies indicating that VP1 protein recognized by
anti-CAV antibodies, when expressed synchronously with
VP2. The results confirmed the previous studies [7,13] that
co-synthesis of the VP1 and VP2 proteins is required to
Virus neutralization test
No. of positive
VN antibody titer
VN status
6
1
1
0
0
1
1:256
1:512
1:4
0
0
1:2048
Positive
Positive
Negative
Negative
Negative
Positive
produce the essential neutralizing form of VP1 resulting
in efficient induction of antibody response against CAV,
whereas separate expression of VP1 does not.
Protective immunity against CAV infection has been
shown to have correlation with the presence of antibody
titers to CAV and neutralizing antibody can provide complete protection [19–23]. To determine virus neutralization
(VN) activity of the antibodies in the vaccinated groups, the
sera were further tested for neutralization activity against
CAV infection in MSB1 cells. The results indicated positive
neutralization activity of the sera from the pBudVP2VP1vaccinated group with protective titer ranging from 1:256
to 1:512, whereas the sera from the pBudVP1-vaccinated
group showed negative neutralizing activity. The neutralizing titer of 1:256 which has been shown to be necessary
for the prevention of shedding and vertical transmission
of CAV [24] was achieved in all chickens vaccinated with
pBudVP2-VP1. Nevertheless, in order to confirm this issue,
it is suggested that breeder flocks producing day-old chicks
with maternal antibodies be vaccinated for virus challenge.
Induction of cellular immune responses after DNA
immunization has been reported for variety of antigens
in previous studies [25–30]. Therefore, in this study, cellmediated immune responses were also evaluated in the
vaccinated chickens by in vitro proliferation assay of
splenocytes and cytokine evaluation, although neutralizing
antibodies can provide complete protection against CAV.
The splenocyte (lymphocyte) proliferation assay is
widely used to evaluate cell mediated immune responses.
It is suggested that antigen-stimulated proliferation
response of splenocytes is directly proportional to cellmediated immune response [31–33]. In the present study,
the proliferative response of the splenocytes to the VP1
antigen was evaluated in the pBudVP2VP1-vaccinated
group. Splenocytes from the immunized chickens proliferated in response to the antigen indicating the successful
expression of the construct in the systemic immune system of the vaccinated chickens, resulting in activation of
antigen-specific immune responses.
Cytokines play a critical role in the development of
cell-mediated immune responses and prevention of viral
infections [34]. To explore whether the pBudVP2-VP1 DNA
vaccine can induce Th1 T-helper cell responses, the serum
levels of Th1 cytokines, IL-2 and IFN-␥ were evaluated in
the pBudVP2VP1-vaccinated chickens by ELISA. According
to the results, high levels of IL-2 and IFN-␥ were detected in
the vaccinated group after vaccination (p < 0.05) compared
to the controls, whereas there were no significant differences between the vaccinated group and controls before
234
H. Moeini et al. / Comparative Immunology, Microbiology and Infectious Diseases 34 (2011) 227–236
Fig. 5. Serum level of IL-2 and IFN-␥ in the vaccinated chickens. The serum levels of Th1 cytokines, IL-2 (A) and IFN-␥ (B) were determined in pBudVP2VP1and PBS-injected (as a control) chickens. The results showed that IL-2 and IFN-␥ serum levels in the immunized group are significantly higher when
compared with the control group.
H. Moeini et al. / Comparative Immunology, Microbiology and Infectious Diseases 34 (2011) 227–236
235
References
Fig. 6. VP1 stimulation of splenocytes in the pBudVP2-VP1-immunized
chickens. Ten days after the last injection, proliferation response was evaluated by BrdU cell proliferation assay kit as described in material and
methods. Chickens injected with the parental plasmid were used as a
control. Mitogen phytohemagglutinin (PHA) was used as a positive control for cell proliferation. Data is reported as stimulation indices (SI). SI
greater than two is considered positive. This showed the positive VP1stimulated proliferation of splenocytes in the chickens immunized with
pBudVP2-VP1.
vaccination. Furthermore, RT-PCR analysis showed the
detectable expression of IL-12 which is involved in differentiation of CD4+ T cells into Th1 cells [35,36] in the spleen
of the vaccinated chickens. On the other hand, the expression of IL-4 and IL-6 which trigger the differentiation of Th2
cells [35] were not detected in the immunized chickens.
These results indicated that the DNA vaccine most perhaps promotes the Th1 T-helper cell responses which are
known to be involved in cellular-mediated immunity [36].
Although, these observations showed the induction of a
certain degree of cell mediated immunity by the pBudVP2VP1 plasmid, further studies in measuring the number of
CD8+ T cells and its cytotoxicity are recommended.
In conclusion, our study demonstrates that the DNA
plasmid pBudVP2-VP1 co-expressing the VP1 and VP2
genes of CAV could result in both humoral and cellmediated immune responses suggesting that this DNA
plasmid could be a potential DNA vaccine against CAV
infection. Our future efforts will concentrate on using an
in ovo delivery system for administration of the DNA vaccine to study protective immunity against CAV infection in
young chicks, because age resistance to CAV develops during the first week of life and becomes complete within 3
weeks [20–23].
Acknowledgments
Hassan Moeini is supported by the Graduate Research
Fellowship, Universiti Putra Malaysia. We are thankful to
Ms. Sara Oveissi for her assistance in animal challenge.
[1] McNulty M. Chicken anaemia agent: a review. Avian Pathology
1991;20:187–203.
[2] Schat K. Chicken anemia virus. TT Viruses 2009:151–83.
[3] Schat K. Chicken infectious anemia. Diseases of Poultry
2003;11:181–202.
[4] Noteborn M, De Boer G, Van Roozelaar D, Karreman C, Kranenburg
O, Vos J, et al. Characterization of cloned chicken anemia virus DNA
that contains all elements for the infectious replication cycle. Journal
of Virology 1991;65:3131.
[5] Peters M, Jackson D, Crabb B, Browning G. Chicken anemia virus VP2
is a novel dual specificity protein phosphatase. Journal of Biological
Chemistry 2002;277:39566–73.
[6] Todd D, Creelan J, Mackie D, Rixon F, McNulty M. Purification and
biochemical characterization of chicken anaemia agent. Journal of
General Virology 1990;71:819.
[7] Koch G, van Roozelaar D, Verschueren C, van der Eb A, Noteborn M.
Immunogenic and protective properties of chicken anaemia virus
proteins expressed by baculovirus. Vaccine 1995;13:763–70.
[8] Vielitz E, Landgraf H. Anaemia-dermatitis of broilers: field observations on its occurrence, transmission and prevention. Avian
Pathology 1988;17:113–20.
[9] Steenhuisen W, Jagt H, Schrier C. The use of a live attenuated CAV
vaccine in breeder flocks in the Netherlands. In: Proceedings of the
international symposium on infectious bursal disease and infectious chicken anaemia. Rauischholzhausen, Germany: University of
Giesen; 1994. p. 482–97.
[10] Doria-Rose N, Haigwood N. DNA vaccine strategies: candidates
for immune modulation and immunization regimens. Methods
2003;31:207–16.
[11] Gurunathan S, Klinman D, Seder R. DNA vaccines: immunology, application, and optimization. Annual Review of Immunology
2000;18:927–74.
[12] Kowalczyk D, Ertl H. Immune responses to DNA vaccines. Cellular
and Molecular Life Sciences 1999;55:751–70.
[13] Noteborn M, Verschueren C, Koch G, Van der Eb A. Simultaneous
expression of recombinant baculovirus-encoded chicken anaemia
virus (CAV) proteins VP1 and VP2 is required for formation of
the CAV-specific neutralizing epitope. Journal of General Virology
1998;79:3073–7.
[14] Lacorte C, Lohuis H, Goldbach R, Prins M. Assessing the expression of chicken anemia virus proteins in plants. Virus Research
2007;129:80–6.
[15] Sambrook J, Russell D. Molecular cloning: a laboratory manual. CSHL
Press; 2001.
[16] Hailemariam Z, Omar A, Hair-Bejo M, Giap T. Detection and characterization of chicken anemia virus from commercial broiler breeder
chickens. Virology Journal 2008;5:128.
[17] Richter E, Wick G. Fluoro-immuno-cytoadherence (FICA): a new
method for the identification and enumeration of antigenbinding cells. Zeitschrift fur Immunitatsforsch Immunobiology
1977;152:351–62.
[18] Lehtoranta L, Villberg A, Santanen R, Ziegler T, novel A. colorimetric
neutralization assay for measuring antibodies to influenza viruses.
Journal of Virological Methods 2009;159:271–6.
[19] Markowski-Grimsrud C, Schat K. Infection with chicken anaemia
virus impairs the generation of pathogen-specific cytotoxic T lymphocytes. Immunology 2003;109:283–94.
[20] Rosenberger J, Cloud S. The isolation and characterization of chicken
anemia agent (CAA) from broilers in the United States. Avian Diseases
1989;33:707–13.
[21] Saif YM. Diseases of poultry. 11th ed. Wiley-Blackwell; 2003.
[22] Yuasa N, Noguchi T, Furuta K, Yoshida I. Maternal antibody and its
effect on the susceptibility of chicks to chicken anemia agent. Avian
Diseases 1980;24:197–201.
[23] Rosenberger J, Cloud S. Chicken anemia virus. Poultry Science
1998;77:1190–2.
[24] Malo A, Weingarten M. Determination of the minimum protective
neutralizing antibody titer to CAV in adult chickens. Intervet VSD
Newslett 1995;11:1–5.
[25] Doe B, Selby M, Barnett S, Baenziger J, Walker C. Induction of cytotoxic T lymphocytes by intramuscular immunization with plasmid
DNA is facilitated by bone marrow-derived cells. Proceedings of
the National Academy of Sciences of the United States of America
1996;93:8578–83.
[26] Hung C, He L, Juang J, Lin T, Ling M, Wu T. Improving DNA vaccine
potency by linking Marek’s disease virus type 1 VP22 to an antigen.
Journal of Virology 2002;76:2676–82.
236
H. Moeini et al. / Comparative Immunology, Microbiology and Infectious Diseases 34 (2011) 227–236
[27] Kuhober A, Pudollek H, Reifenberg K, Chisari F, Schlicht H, Reimann
J, et al. DNA immunization induces antibody and cytotoxic T cell
responses to hepatitis B core antigen in H-2b mice. The Journal of
Immunology 1996;156:3687–95.
[28] Schirmbeck R, Bohm W, Ando K, Chisari F, Reimann J. Nucleic acid
vaccination primes hepatitis B virus surface antigen-specific cytotoxic T lymphocytes in nonresponder mice. Journal of Virology
1995;69:5929–34.
[29] Ulmer J, Donnelly J, Parker S, Rhodes G, Felgner P, Dwarki V, et al. Heterogenous protection against influenza by injecting of DNA encoding
a viral protein. Science 1993;259:1745–9.
[30] Ulmer JB, Fu TM, Deck RR, Friedman A, Guan L, DeWitt C,
et al. Protective CD4+ and CD8+ cells against Influenza virus
induced by vaccination with nucleoprotein DNA. Journal of Virology
1998;72:5648–53.
[31] Feng C, Li Q, Zhang X, Dong K, Hu B, Guo X. Immune strategies
using single-component LipL32 and multi-component recombinant
[32]
[33]
[34]
[35]
[36]
LipL32-41-OmpL1 vaccines against leptospira. Brazilian Journal of
Medical and Biological Research 2009;42:796–803.
Han R, Cladel N, Reed C, Peng X, Budgeon L, Pickel M, et al.
DNA vaccination prevents and/or delays carcinoma development of
papillomavirus-induced skin papillomas on rabbits. Journal of Virology 2000;74:9712–6.
Kim S, Sung H, Han J, Jackwood D, Kwon H. Protection against
very virulent infectious bursal disease virus in chickens immunized with DNA vaccines. Veterinary Microbiology 2004;101:39–
51.
Wigley P, Kaiser P. Avian cytokines in health and disease. Brazilian
Journal of Poultry Science 2003;5:1–14.
Rincón M, Anguita J, Nakamura T, Fikrig E, Flavell R. Interleukin (IL)-6
directs the differentiation of IL-4-producing CD4+ T cells. The Journal
of Experimental Medicine 1997;185:461–70.
Goldsby RA, Kindt TJ, Osborne BA, Kuby J. Immunology. 5th ed. New
York, NY: W.H. Freeman; 2003.