Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Wheel of Amino Acids Wheel of Amino Acids
Document related concepts
Holliday junction wikipedia , lookup
Maurice Wilkins wikipedia , lookup
Transcriptional regulation wikipedia , lookup
Community fingerprinting wikipedia , lookup
Cell-penetrating peptide wikipedia , lookup
Silencer (genetics) wikipedia , lookup
Protein adsorption wikipedia , lookup
Peptide synthesis wikipedia , lookup
Molecular cloning wikipedia , lookup
Gel electrophoresis of nucleic acids wikipedia , lookup
Bottromycin wikipedia , lookup
Non-coding DNA wikipedia , lookup
DNA vaccination wikipedia , lookup
Protein (nutrient) wikipedia , lookup
Gene expression wikipedia , lookup
Proteolysis wikipedia , lookup
Two-hybrid screening wikipedia , lookup
DNA supercoil wikipedia , lookup
Molecular evolution wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Protein structure prediction wikipedia , lookup
Amino acid synthesis wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Biochemistry wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Expanded genetic code wikipedia , lookup
Transcript
Wheel of Amino Acids Wheel of Amino Acids In this activity you will use your knowledge of protein synthesis to decode the DNA strand and build a partial chain of amino acids (protein). In this activity you will use your knowledge of protein synthesis to decode the DNA strand and build a partial chain of amino acids (protein). Instructions Instructions Complete the chart below using the codon wheel and previous knowledge of DNA transcription and translation. Complete the chart below using the codon wheel and previous knowledge of DNA transcription and translation. 1. Parent Strand DNA 5’ End TAC GGC ---------2. Messenger RNA Strand 1. Parent Strand DNA 5’ End TAC GGC ---------2. Messenger RNA Strand ATG AAA 3. Amino Acid Sequence ------------ UGA 3’ End ----------- ------------ 4. ATG AAA 3. Amino Acid Sequence ------------ UGA 3’ End ----------- ------------ 4. DNA mRNA Amino Acid Proline CAA DNA mRNA Amino Acid Proline CAA GAU GAU Trytophan TAC Trytophan TAC UUU UUU 5. Given the DNA strand below create an amino acid sequence for building a protein. 5. Given the DNA strand below create an amino acid sequence for building a protein. DNA - TACCCGATACGATTGGCGGATAGCATCAGCATT DNA - TACCCGATACGATTGGCGGATAGCATCAGCATT Protein Synthesis Practice Protein Synthesis Practice
