Download HIV-1 Replication by Distinct Mechanisms Monocyte

M1 and M2a Polarization of Human
Monocyte-Derived Macrophages Inhibits
HIV-1 Replication by Distinct Mechanisms
This information is current as
of August 12, 2017.
Edana Cassol, Luca Cassetta, Chiara Rizzi, Massimo Alfano
and Guido Poli
J Immunol 2009; 182:6237-6246; ;
doi: 10.4049/jimmunol.0803447
http://www.jimmunol.org/content/182/10/6237
Subscription
Permissions
Email Alerts
This article cites 76 articles, 46 of which you can access for free at:
http://www.jimmunol.org/content/182/10/6237.full#ref-list-1
Information about subscribing to The Journal of Immunology is online at:
http://jimmunol.org/subscription
Submit copyright permission requests at:
http://www.aai.org/About/Publications/JI/copyright.html
Receive free email-alerts when new articles cite this article. Sign up at:
http://jimmunol.org/alerts
The Journal of Immunology is published twice each month by
The American Association of Immunologists, Inc.,
1451 Rockville Pike, Suite 650, Rockville, MD 20852
Copyright © 2009 by The American Association of
Immunologists, Inc. All rights reserved.
Print ISSN: 0022-1767 Online ISSN: 1550-6606.
Downloaded from http://www.jimmunol.org/ by guest on August 12, 2017
References
The Journal of Immunology
M1 and M2a Polarization of Human Monocyte-Derived
Macrophages Inhibits HIV-1 Replication by Distinct
Mechanisms1
Edana Cassol,2*†‡ Luca Cassetta,*† Chiara Rizzi,* Massimo Alfano,* and Guido Poli*†
M
ononuclear phagocytes play a pivotal role in a broad
range of innate and adaptive immune responses. In
addition, they are important targets for HIV-1 and
contribute to the dissemination and cell-to-cell spread of the virus
(1– 4). Unlike CD4⫹ T cells, mononuclear phagocytes, specifically
terminally differentiated macrophages, are refractory to the cytotoxic
effects of HIV-1 and, because of their longevity and ubiquitous
distribution in tissues and organs, serve as viral reservoirs throughout the course of HIV-1 disease (3–5). The early establishment of
such viral reservoirs during primary infection (6 – 8) has stimulated
interest in characterizing the mechanisms underlying the persistence and replication of HIV-1 in both CD4⫹ T cells and monocyte/macrophages (9, 10).
Mononuclear phagocytes respond to a variety of different cytokines and microbial gene products, and their susceptibility to
HIV-1 is profoundly influenced by these stimuli (11–16). IFN-␣/␤
potently inhibits HIV-1 replication in macrophages, whereas other
cytokines, including IL-6, stimulate virus replication (17–19). Depending on the stage of mononuclear phagocyte differentiation and
the timing of cytokine exposure, some cytokines can either promote or inhibit HIV-1 infection. IL-4 and IL-13, for example, enhance virus replication in monocytes but inhibit replication in dif-
*AIDS Immunopathogenesis Unit, Division of Immunology, Transplantation and Infectious Diseases, San Raffaele Scientific Institute, Milan, Italy; †Vita-Salute San
Raffaele University, School of Medicine, Milan, Italy; and ‡Medical Research Council Unit of Inflammation and Immunity, Department of Immunology, Faculty of
Health Sciences, University of Pretoria, Pretoria, South Africa
Received for publication October 14, 2008. Accepted for publication March 13, 2009.
The costs of publication of this article were defrayed in part by the payment of page
charges. This article must therefore be hereby marked advertisement in accordance
with 18 U.S.C. Section 1734 solely to indicate this fact.
1
The work was supported in part by the FP6 EU Grant, Europrise (to G.P.).
2
Address correspondence and reprint requests to Dr. Edana Cassol, P2/P3 Laboratories, DIBIT, Via Olgettina n. 58, 20132 Milan, Italy. E-mail address:
[email protected]
www.jimmunol.org/cgi/doi/10.4049/jimmunol.0803447
ferentiated monocyte-derived macrophages (MDM)3 (20, 21). On
the other hand, exposure of MDM to TNF-␣ before infection is
inhibitory, whereas stimulation of latently infected macrophages or
monocytic cell lines leads to the up-regulation of virus transcription and expression via activation of the cellular transcription factor NF-␬B (16, 22, 23).
A recent concept developed primarily in mouse models is the
observation that cytokine stimulation can trigger the polarization
of macrophages into opposing pro- and anti-inflammatory programs. By analogy with CD4⫹ Th cell differentiation, these polarization pathways have been designated M1 and M2 (24 –26).
M1 macrophages produce IL-1␤, IL-12, IL-23, and TNF-␣, as well
as reactive oxygen and nitrogen intermediates, support Th1 responses, and mediate resistance to tumors and intracellular pathogens (24, 27–29). Conversely, M2 cells secrete IL-10, express
scavenger and mannose receptors, contribute to Th2 responses,
enhance phagocytosis, eliminate parasites, and promote tissue repair (25–27, 30 –35). M2 macrophages are generally considered to
be more heterogeneous than M1 cells and, to reflect these differences, have been further subdivided into M2a, M2b, and M2c cells
(24). M2a (induced by exposure to IL-4 or IL-13) and M2b (induced by stimulation with immune complexes, TLR, or the IL-1
receptor antagonist (IL-1ra)) macrophages exert immunoregulatory functions and drive Th2 responses, whereas M2c cells (generated by stimulation with IL-10) play a predominant role in the
suppression of immune responses and tissue remodeling (24). Recent molecular profiling of human MDM has identified ⬎2000
transcripts that are differentially modulated during M1 vs M2a
polarization, giving rise to macrophages with highly specialized
3
Abbreviations used in this paper: MDM, monocyte-derived macrophage; IL-1ra,
IL-1 receptor antagonist; MFI, mean fluorescence intensity; NHS, normal human
serum; RT, reverse transcriptase.
Copyright © 2009 by The American Association of Immunologists, Inc. 0022-1767/09/$2.00
Downloaded from http://www.jimmunol.org/ by guest on August 12, 2017
The capacity of macrophages to support productive HIV-1 infection is known to be modulated by cytokines and other extracellular
stimuli. In this study, we demonstrate that cytokine-induced polarization of human monocyte-derived macrophage (MDM) into
either classical (M1) or alternatively activated (M2a) MDM is associated with a reduced capacity to support productive CCR5dependent (R5) HIV-1 infection. M1 polarization was associated with a significant down-regulation of CD4 receptors, increased
secretion of CCR5-binding chemokines (CCL3, CCL4, and CCL5), and a >90% decrease in HIV-1 DNA levels 48-h postinfection,
suggesting that the inhibition occurred at an early preintegration step in the viral life cycle. In contrast, M2a polarization had no
effect on either HIV-1 DNA or protein expression levels, indicating that inhibition occurred at a late/postintegration level in the
viral life cycle. M2a inhibition was sustained for up to 72-h postinfection, whereas M1-effects were more short-lived. Most
phenotypic and functional changes were fully reversible 7 days after removal of the polarizing stimulus, and a reciprocal downregulation of M1-related chemokines and cytokines was observed in M2a MDM and vice versa. Since reversion to a nonpolarized
MDM state was associated with a renewed capacity to support HIV replication to control levels, M1/M2a polarization may
represent a mechanism that allows macrophages to cycle between latent and productive HIV-1 infection. The Journal of Immunology, 2009, 182: 6237– 6246.
6238
phenotypic and functional properties (36). Although it is well
documented that cytokines play a critical role in the regulation of
HIV-1 replication (37), the potential effect of M1 and M2a polarization on virus infection and replication has not been specifically
investigated.
In this study, we investigated the effects of M1 (TNF-␣ plus
IFN-␥) and M2a (IL-4) polarization on the capacity of MDM to
support productive CCR5-dependent (R5) HIV-1 infection. The
study focuses primarily on M1 and M2a cells because these phenotypes mediate Th1 and Th2 responses, and it has been proposed
that a switch from a Th1 to a Th2 immune response may play a
role in the pathogenesis of HIV-1/AIDS (38, 39). We found that
both polarization pathways led to a decreased capacity to support
R5 HIV-1 replication in association with specific alterations in the
expression of cell surface receptors, chemokines, and cytokines
involved in HIV-1 entry, replication, and dissemination. However,
the quality, magnitude, and duration of these inhibitory responses
and the mechanisms underlying these responses were clearly different in M1 vs M2a MDM.
Reagents
Human recombinant cytokines were purchased from R&D Systems and
used at concentrations of 2 ng/ml (TNF-␣) and 20 ng/ml (IFN-␥ and IL-4),
respectively. All cytokines were declared by the manufacturer to contain
⬍0.1 ng of LPS per ␮g of protein. Brefeldin A and BSA were purchased
from Sigma-Aldrich. Ficoll-Hypaque was purchased from Amersham Biosciences. DMEM, PBS, FBS, normal human serum (NHS), penicillin,
streptomycin, and glutamine were obtained from Cambrex.
Isolation of human monocytes and differentiation into MDM
PBMC were isolated from the buffy coats of healthy HIV-1-seronegative
blood donors by Ficoll-Hypaque density gradient centrifugation. The cells
were then washed, resuspended in DMEM containing pen/strep (1%), glutamine (1%), heat-inactivated FBS (10%), and heat-inactivated NHS (5%)
(complete medium), and seeded into 75-cm2 flasks (Falcon; BD Biosciences Labware) at 8 ⫻ 106 cells/ml. Nonadherent cells, mostly T lymphocytes, were removed by gentle pipette aspiration after 2 h of incubation
at 37°C in a humidified atmosphere containing 5% CO2. An equal volume
of fresh complete medium was then added to each flask. After 24 h of
culture, adherent cells were washed twice with PBS, detached from the
flask by scraping with a rubber policeman, and counted after trypan blue
dye staining. The cells (ⱖ85% monocytes as determined by flow cytometric analysis after staining with anti-CD14 mAbs) were seeded into 48-well
plastic plates (Falcon) at the concentration of 2.5 ⫻ 105 cells/well and were
cultivated for 7– 8 additional days at 37°C in 5% CO2 to promote their full
differentiation into MDM (12). These MDM (ⱖ95% CD14⫹) were then
stimulated for 18 h with either TNF-␣ plus IFN-␥ or IL-4 to obtain M1 or
M2a phenotypes, respectively (24). Unpolarized control MDM were maintained in culture for 18 h in complete medium alone. At the end of the 18-h
period, MDM were washed with cytokine-free culture medium, resuspended in complete medium, and further analyzed in parallel cultures.
Flow cytometric analysis of cell surface determinants
Adherent MDM were washed with cold EDTA/PBS (2 mM) and detached
from the plastic plates by incubation with cold EDTA/PBS (2 mM) for 30
min at 4°C and scraping with a rubber policeman. Nonspecific binding of
Ab was eliminated by preincubating the cells in medium containing 10%
FBS and 5% NHS for 15 min at 4°C. The cells were then incubated with
anti-CD4 (PE) and anti-CXCR4 (PE) (BD Biosciences) mAbs for 30 min
at 4°C, washed with cold PBS, and fixed with 2% paraformaldehyde.
CCR5 expression was assessed using biotinylated human CCL4 (Fluorokine; R&D Systems). Flow cytometry was performed using a CYAN ADP
instrument (DakoCytomation), and the results were analyzed with the
FlowJo software version 8.4.3 (Tree Star). Results are reported as the percentage of positive cells and as mean fluorescence intensity (MFI), the
latter being used to describe the level of expression on a population of
positive cells.
To investigate the persistence of MDM polarization, M1, M2a, and control MDM were thoroughly washed and cultivated for 7 additional days in
the absence of further stimulation. These cells were then monitored for cell
surface Ag expression and cytokine/chemokine secretion after 0, 3, and 7
days postpolarization.
Cytokine and chemokine secretion and expression
Cytokines were quantified in culture supernatants of MDM 18 h after their
polarization (day 0) as well as on days 3 and 7 postpolarization. The levels
of CXCL8, CCL3, CCL22, and CCL24 released into the supernatants of
MDM cultures were quantified by commercial ELISA kits (R&D Systems),
whereas the concentrations of IL-1␤, IL-1ra, IL-6, IL-10, IL-12, CCL4,
CCL5, CCL2, and CXCL10 were determined in customized Bio-Plex
plates (Bio-Rad) following the manufacturer’s instructions.
Intracellular staining for CCL3 was determined after 18 h of MDM
polarization in medium containing brefeldin A (1 ␮g/ml). Control, M1-,
M2a-, and lipid A-stimulated MDM (1 ␮g/ml) were detached from the
plastic surface by scraping and fixed in 2% paraformaldehyde. The cells
were then permeabilized with a Saponin buffer (0.1% saponin and 0.5%
BSA in PBS) and stained with allophycocyanin-conjugated anti-CCL3
mAb for 30 min at 4° C. The cells were then washed twice with cold PBS
and analyzed with a CYAN ADP apparatus (DakoCytomation).
R5 HIV-1 infection of MDM
Control, M1, and M2a MDM were infected with the macrophage-tropic,
laboratory-adapted R5 strain HIV-1BaL at the multiplicity of infection of
0.1. In certain experiments, MDM were also infected with HIV-1BaL 3 and
7 days after polarization, as further specified. Multiple aliquots of culture
supernatants were collected every 3– 4 days over a 5-wk period and stored
at ⫺20°C to assess virus production. At the end of each infection experiment, supernatants were thawed and analyzed for their viral content by
measuring the levels of virion-associated reverse transcriptase (RT) activity present in the supernatant, as described previously (12).
Quantification of HIV-1 DNA by real-time PCR
Unpolarized control, M1, and M2a MDM were infected with DNase/RNasefree HIV-1BaL (multiplicity of infection ⫽ 0.1) and were then cultivated in
complete medium for 48 h, a period estimated to be required for completion of
a single round of HIV replication in macrophages (40). The infected MDM
(106 cells/ml) were then washed, resuspended in lysis buffer containing
polyoxyethylene 10, lauryl ether (0.1%), and proteinase K (0.1 mg/ml) from
Sigma-Aldrich, and digested at 65°C for 2 h; proteinase K was then heat
inactivated at 95°C for 15 min (41). An amount of lysate corresponding to
2.5 ⫻ 104 cells was amplified by real-time quantitative PCR reactions using
primers and a probe that recognize the HIV-1 gag gene (42, 43): forward
primer, 5⬘-ACATCAAGCAGCCATGCAAAT-3⬘; reverse primer, 5⬘-ATCT
GGCCTGGTGCAATAGG-3⬘; and probe, 5⬘-(FAM) CATCAATGAG
GAAGCTGCAGGAATGGGATAGA (TAMRA)-3⬘. This primer/probe
combination detects all forms of viral DNA synthesized after second-strand
transfer mediated by RT. The number of HIV-1 DNA copies were normalized to those of human GAPDH by an external standard curve showing
a linear distribution (r ⫽ 0.99) between 10 and 106 copies (40). The primers and probe for GAPDH were forward primer, 5⬘-ACCACAGTCCAT
GCATCACT-3⬘; reverse primer, 5⬘-GGCCATCACGCCACAGITT-3⬘;
and probe, 5⬘-(FAM) CCCAGAAGACTGTG GATGGCCCC (TAMRA)3⬘. Thermal cycling conditions for real-time PCR with SYBR Green quantification were 50°C for 2 min and 95°C for 15 min followed by 40 cycles
at 95°C for 15 s and 65°C for 1 min (43).
Western blot analysis of cell-associated HIV-1 proteins
MDM were scraped from the wells with a rubber policeman and lysed with
buffer C (20 mM HEPES, 0.4 M NaCl, 0.1 mM EDTA, 0.1 mM EGTA, 1.5
mM MgCl2, and 0.5% glycerol; 100 ␮l per million cells). Cellular proteins
were denatured in an equal volume of 2⫻ sample buffer (0.125 M Tris-HCl
(pH 6, 8), 4% SDS, 10% 2BME, and 20% glycerol) for 5 min at 100°C,
separated on a 10% SDS-PAGE gel, and transferred to a nitrocellulose
membrane (Hybond ECL; Amersham Biosciences) by electroblotting.
Membranes were blocked in 5% nonfat milk, 20 mM Tris (pH 7.6), 137
mM NaCl, and 0.2% Tween 20 for 30 min at room temperature and further
incubated for 1 h with the serum (1/1000 dilution) from an HIV-1⫹ individual containing high titers of anti-HIV-1 Abs. Ab binding was visualized
by using HRP-conjugated anti-human Abs (Amersham Biosciences). The
signal was detected using ECL reagents (Amersham Biosciences) according to the manufacturer’s instructions.
Statistical analysis
Results are reported as mean values ⫾ SD. To minimize interdonor variability, values were normalized relative to unstimulated control cells. Oneway ANOVA and the Tukey posttest were used for multivariate analysis.
Downloaded from http://www.jimmunol.org/ by guest on August 12, 2017
Materials and Methods
HIV-1 REPLICATION IN M1 AND M2a MDM
The Journal of Immunology
6239
To further compensate for interdonor variability, all assays were performed
on triplicate samples with MDM derived from four to six independent
donors, as further specified.
Results
M1 and M2a polarization shapes MDM morphology
Before polarization, control MDM showed approximately equal
numbers of spindle-shaped fibroblastoid and large flat-round/fried
egg-shaped cells (50.5 ⫾ 6.2% and 49.5 ⫾ 6.1%, n ⫽ 5), respectively (Fig. 1). Exposure to M1-inducing cytokines for 18 h led to
a significant increase in the percentage of fibroblastoid-like cells
(69.3 ⫾ 6.2%, n ⫽ 5, p ⫽ 0.027 vs controls) and in the length of
the cellular projections extending from the cell poles. Conversely,
exposure to IL-4 led to an increase in the percentage of flat-round
FIGURE 2. Stronger inhibition of R5
HIV-1 replication in M1 vs M2a MDM. A,
The effects of MDM polarization on HIV-1
replication kinetics were monitored by determination of the RT activity content in culture
supernatants over a 35-day infection period.
The results represent the average replication
(⫾SD) of infected MDM cultures established from 15 independent donors. B, Pie
chart showing the percent levels of suppression of HIV-1 in the 15 infected MDM cultures studied. Values ranged from near-complete/complete (76 –100%) inhibition in 80%
of independent M1 MDM cultures to
51–75% in the remaining 20% of cultures.
Lower levels of inhibition of virus replication were observed in M2a MDM.
cells (73.7 ⫾ 1.4%, n ⫽ 5, p ⫽ 0.016 vs controls; Fig. 1). When
compared with the flat-round cells in control cultures, M2a cells
exhibited a more condensed morphology with short cellular projections accumulating at the poles of the cell. Neither M1 nor M2a
activation affected MDM survival as assessed by trypan blue dye
exclusion. Thus, we can conclude that the polarization protocol
adopted in our study affected the majority of cells in the MDM
population, at least in terms of morphological features.
Both M1 and M2a polarization of human MDM inhibits R5
HIV-1 replication
To assess the relative capacities of M1 and M2a MDM to support
productive infection by R5 HIV-1, MDM cultures were established
from 15 independent HIV-1-seronegative donors and were either
Downloaded from http://www.jimmunol.org/ by guest on August 12, 2017
FIGURE 1. Morphology of differentially polarized MDM. A, Peripheral blood monocytes were differentiated for 7 days in complete medium containing human
serum and cultivated for an additional 18 h in the same medium (control MDM), or in complete medium containing M1 (TNF-␣ plus IFN-␥)- or M2a (IL-4)inducing cytokines (original magnification, ⫻40). B, Mean percentage of fibroblastoid vs flat-round cells in control M1 and M2a MDM established from the PBMC
of five independent healthy donors (ⴱ, p ⱕ 0.05; M1 vs M2 vs control MDM for both morphological types). Percentages were determined by counting the number
of fibroblastoid and flat-round cells from three individual fields for each of the three MDM cultures obtained from five different donors ⫾ SD.
6240
HIV-1 REPLICATION IN M1 AND M2a MDM
left unpolarized (controls) or were polarized with M1 (TNF-␣ plus
IFN-␥)- or M2a (IL-4)-inducing cytokines for 18 h before infection with R5 HIV-1BaL. Virus replication in control MDM increased progressively reaching peak levels 14 –18 days postinfection, followed by a drop to low levels of persistent replication (Fig.
2A). In contrast, HIV-1 replication was strongly inhibited in both
M1- and M2a-polarized MDM with the former showing a significantly stronger inhibition in comparison to the latter (Fig. 2A).
The levels of viral suppression in M1 MDM ranged from 51 to
75% in 20% of independent cultures to 76 –100% in the remaining
80% of cultures, whereas the levels of suppression in M2a MDM
ranged from ⬍25% in 7% of donors to 26 –50, 51–75, and ⬎76% in
7, 33, and 53% of independent MDM cultures, respectively (Fig. 2B).
(Fig. 3, upper left panel). A more prolonged suppression of virus
replication lasting for up to 25 days was observed in M1 MDM
(Fig. 3, upper left panel).
When infection was delayed until 3 days after polarization, M2a
MDM maintained their inhibitory phenotype. In contrast, M1
MDM had already lost their inhibitory phenotype and supported
HIV replication at the same level as control cells (Fig. 3, upper
right panel). When M1 and M2a MDM were infected 7 days after
polarization, no inhibitory effects on HIV-1 replication were observed in comparison to control cells (Fig. 3, lower panel). Thus,
the inhibitory effects of MDM polarization on HIV-1 replication
are transient, particularly in M1 MDM, and do not render these
cells permanently refractive to HIV-1 infection and replication.
Polarization-induced inhibition of HIV-1 replication is transient
and of shorter duration in M1 vs M2a MDM
M1 and M2a polarization differentially modulates the expression
of CD4, CCR5, and CXCR4
Next, we examined the duration of the inhibitory effect on HIV-1
replication following a single 18-h exposure to M1- and M2apolarizing cytokines. Control and polarized MDM were thoroughly washed and infected with HIV-1BaL either immediately
(day 0) or 3 or 7 days after polarization (Fig. 3). Exposure to
HIV-1 immediately after polarization led to a rapid decrease in
HIV-1 replication in both M1 and M2a MDM relative to control
cells with the nadir of inhibition in M2a MDM occurring on day 10
To investigate the effects of M1 and M2a polarization on MDM
susceptibility to HIV-1 infection, we monitored changes in the
expression of CD4, CCR5, and CXCR4, the primary receptor, and
the major coreceptors for HIV-1 entry into target cells, respectively (44, 45). M1, and to a lesser extent M2a, polarization resulted in a significant reduction in the percentage of MDM expressing CD4, a finding that may account, at least in part, for their
decreased capacity to support productive infection (Table I). In
Table I. Fold changes of HIV receptor and coreceptor expression in M1 and M2a MDM vs control MDMa
Receptor
N°
Parameter
Average Expression
(control) (%)
M1 (fold vs control)
M2a (fold vs control)
M1 vs control
M2a vs control
M1 vs M2a
CD4
5
5
0.32 ⫾ 0.08
0.91 ⫾ 0.05
0.50 ⫾ 0.09
1.14 ⫾ 0.21
1.87 ⫾ 0.72
0.91 ⫾ 0.11
**
*
**
5
0.14 ⫾ 0.08
0.92 ⫾ 0.07
0.28 ⫾ 0.23
1.13 ⫾ 0.29
1.27 ⫾ 0.06
0.98 ⫾ 0.01
**
*
*
CCR5
41 ⫾ 3.3
12 ⫾ 2.3
17 ⫾ 7.7
16 ⫾ 2.8
21 ⫾ 1.8
44 ⫾ 3.1
*
CXCR4
Positive cells
MFI
Positive cells
MFI
Positive cells
MFI
a
Mean fold change in the number of positive cells and MFI in M1 and M2a MDM vs. control MDM. MFI and expression of surface receptors/coreceptors was analyzed by
cytofluorimetry. ⴱ, p ⬍ 0.05; ⴱⴱ, p ⬍ 0.001, as assessed by one-way ANOVA and Tukey posttest. N° denotes the number of MDM donors studied.
Downloaded from http://www.jimmunol.org/ by guest on August 12, 2017
FIGURE 3. Time-dependent kinetics of inhibition of HIV-1 replication
in M1 and M2a MDM. M1, M2a, or
control MDM were infected either immediately after polarization (day 0) or
on days 3 and 7 after polarization, as
indicated by the arrows. The results
are shown as mean fold change in RT
activity relative to unpolarized control
MDM. These results were obtained
from a single MDM culture representative of five cultures established from
independent donors. The inhibitory effects were completely lost when M1
MDM were infected 3 days after polarization, unlike what was observed
for M2a MDM. The apparent increase
in the replicative capacity of M1 and
M2a MDM observed at late time
points in cells infected on days 0 or 7
is correlated to the low levels of virus
replication detected in control MDM
cultures, as shown in Fig. 1.
The Journal of Immunology
6241
Table II. Kinetics of CD4 expression following MDM polarizationa
Days after
polarization
N°
Polarization
% CD4⫹ MDM
M1 vs control
M2a vs control
M1 vs M2a
0
5
**
*
5
*
*
7
5
41 ⫾ 3.3
6 ⫾ 1.9
13 ⫾ 2.6
35 ⫾ 6.7
31 ⫾ 9.2
13 ⫾ 5.5
33 ⫾ 4.8
31 ⫾ 6.9
26 ⫾ 2.9
**
3
Control
M1
M2a
Control
M1
M2a
Control
M1
M2a
a
Mean CD4 expression on control, M1, and M2a MDM. ⴱ, p ⱕ 0.05; ⴱⴱ, p ⱕ 0.001, as assessed by one-way ANOVA and
Tukey posttest. N° denotes the number of individual MDM donors tested.
M1 and M2a polarization differentially modulates the secretion
of chemokines and cytokines relevant to HIV-1 replication
Next, we investigated the effects of M1 and M2a polarization on
the CCR5-binding chemokines CCL3, CCL4, and CCL5 that are
potent inhibitors of R5 HIV-1 entry in CD4⫹ T lymphocytes and
MDM (16, 48). Secretion of CCL3 and CCL4 was detected after
18 h of cytokine stimulation in all MDM cultures and was significantly up-regulated in M1 vs M2a MDM (25-fold in M1 vs ⬃2fold in M2a-MDM for CCL3; 14-fold in M1 vs ⬍2-fold in M2a for
CCL4) (Fig. 4A and Table III). CCL5, which was undetectable in
both control and M2a MDM, was significantly up-regulated in M1
MDM (range, 61–186 pg/ml) in three of six donors (Table III). We
further determined the intracellular levels of CCL3 in both unpolarized and polarized MDM. A clear increase in the percentage of
CCL3⫹ cells was observed in M1 vs control MDM (from 1–3 to
12–21%, with a mean increase of 7 ⫾ 2.31-fold vs Nil, n ⫽ 5, p ⫽
A
0.023), although no changes were detected in the MFI of CCL3⫹
M1 vs control MDM (Fig. 4B). Stimulation with lipid A, a highly
potent M1 stimulus (24), resulted in a greater (20-fold) increase in
both the number and MFI of MDM expressing intracellular CCL3
(Fig. 3B), indicating that the M1 polarizing cytokines used in this
study induced CCL3 production only in a subset of MDM.
In addition to increased secretion of CCR5-binding chemokines,
M1, and to a lesser extent M2a, polarization led to a significant
up-regulation of CXCL10 (215-fold in M1 and 25-fold in M2a
MDM vs controls), a chemokine previously linked to the up-regulation of HIV-1 replication in vitro (49) (Table III). CCL2, a
chemokine that is elevated in the cerebrospinal fluid of individuals
with HIV-1 and CMV encephalitis (50, 51), was unaffected by M1
polarization but was consistently down-regulated (0.5-fold) in M2a
MDM (Table II). This chemokine has been shown to enhance
HIV-1 replication in activated PBMC (52). CXCL8, a chemokine
that is also increased during HIV-1 infection (53) and that has been
shown to enhance HIV-1 replication in vitro (54, 55), was significantly up-regulated in M1-MDM. This chemokine was partially
down-regulated in four of five independent M2a MDM compared
with control cultures (Table III). Finally, CCL22, a chemokine
constitutively expressed by unpolarized MDM (11, 56) and originally described as an inhibitor of HIV-1 replication in both CD4⫹
T cells and MDM (12, 57), was significantly up-regulated in M2a
MDM vs M1 and control MDM (Table III).
In contrast to chemokines, polarization-induced changes in cytokine production were quantitatively modest. In particular, neither
IL-1␤ nor IL-1ra production was significantly modulated in M1 or
M2a MDM vs control cells. IL-6, a cytokine that, like IL-1, has
B
4,000
Nil
3,000
M1
10 4
10 4
M1
M2a
2,000
Lipid A
1,000
10 4
10 4
3.04%
CCL3
pg/ml
M2a
Control
21.3%
2.52%
89.3%
10 3
10 3
10 3
10 3
10 2
10 2
10 2
10 2
10 1
10 1
10 1
10 1
10 0
0
10000
20000
30000
10 0
10 0
10 0
0
10000
20000
30000
0
10000
20000
30000
0
10000
20000
30000
0
CCL3
CCL4
CCL5
SS
FIGURE 4. Differential secretion of CCR5-binding chemokines in M1 and M2a MDM. A, The secreted levels of CCL3, CCL4, and CCL5 in control,
M1 and M2a MDM cultures were determined after 18 h of cultivation in the presence of polarizing cytokines. These results represent the mean (⫾SD) levels
of cytokines secreted by MDM cultures established from six independent donors. B, Intracellular levels of CCL3 observed in control MDM and in MDM
stimulated with either M1- or M2a-polarizing cytokines or lipid A; the results shown were obtained from the MDM culture of a single donor and are
representative of five MDM cultures established from independent donors (fold induction of the MFI of intracellular CCL3 expression vs control MDM
was 1 ⫾ 0.2, 1 ⫾ 0.1, and 4 ⫾ 1 for M1, M2a, and lipid A, respectively; n ⫽ 5).
Downloaded from http://www.jimmunol.org/ by guest on August 12, 2017
contrast, expression of CCR5, the major coreceptor for macrophage-tropic strains of HIV-1, remained unchanged and, in some
donors, was even up-regulated on the surface of M2a MDM vs M1
and controls. CXCR4, an entry coreceptor for X4-dependent viruses (which do not usually cause productive infection in MDM)
(46, 47), was also down-regulated in polarized MDM vs controls
(Table I).
Removal of the polarizing cytokines led to a near complete reversal of M1 and M2a cell surface phenotypes by day 7. In particular, cell surface CD4 expression returned to control levels in
M1 MDM 3 days after the removal of the polarizing stimuli,
whereas this occurred more slowly in M2a MDM (Table II).
6242
HIV-1 REPLICATION IN M1 AND M2a MDM
Table III. Cytokine and chemokine secretion in polarized and unpolarized MDMa
Chemokine/Cytokine
N°
Range (control) (pg/ml)
Mean° ⫾ SD
M1
(fold vs control)
M2a
(fold vs control)
CCL2
CCL3
CCL4
CCL5
CCL22
CXCL10
CXCL8
IL-1␤
IL-1ra
IL-6
IL-10
4
6
6
6
4
4
5
4
6
4
6
2519 – 8506
26 –274
154 – 4532
ˆ n.d.
165– 886
185– 6186
118 –3607
0.17– 0.28
115–3031
0.38 –18
0.99 –18
5006 ⫾ 2783
82.5 ⫾ 96
222 ⫾ 58
ˆ n.d.
398 ⫾ 330
1734 ⫾ 2526
1267 ⫾ 1156
0.21 ⫾ 0.04
1572 ⫾ 1458
6.9 ⫾ 7.6
6.2 ⫾ 6.9
1.4 ⫾ 0.6
25 ⫾ 8.3
14 ⫾ 5.4
69 ⫾ 85.8
1 ⫾ 0.4
215 ⫾ 157
2.6 ⫾ 1.4
1.1 ⫾ 0.5
1.0 ⫾ 0.3
2.3 ⫾ 1.1
1.7 ⫾ 0.7
0.5 ⫾ 0.3
2.2 ⫾ 1.1
1.6 ⫾ 0.8
ˆ n.d.
3.9 ⫾ 0.3
2.5 ⫾ 3.3
0.45 ⫾ 0.4
1.1 ⫾ 0.3
0.9 ⫾ 0.3
1.0 ⫾ 0.3
5.2 ⫾ 3.5
M1 vs control
*
**
M2a vs control
M1 vs M2a
*
*
*
*
**
*
*
*
*
*
*
*
*
*
*
*
a
Mean fold change in chemokine/cytokine production (⫾SD) in M1 and M2a MDM relative to control MDM. °Control, unpolarized MDM. ⴱ, p ⱕ 0.05, as assessed by
one-way ANOVA and Tukey posttest. N° denotes the number of independent MDM cultures studied. ˆ n.d., not detectable.
“Contra-regulatory” effects of M1 and M2a polarization
Most secreted molecules, including CCL3, IL-6, and IL-10 returned to control levels 3 to 7 days after polarization (Fig. 5). In
M1
1000
10
1
0.1
0
1
2
3
4
5
6
7
8
IL-6
CXCL10
M2a
M1
CCL3
10
IL-1ra
IL-10
Fold Induction over control
FIGURE 5. Cross-down-regulation
of chemokines and cytokines secreted
by M1 and M2a MDM. CXCL10 and
CCL3 were expressed by M1 but not
by M2a MDM. Conversely, CCL22
and IL-10 were secreted by M2a but
not by M1 macrophages. Peak levels
of chemokine/cytokine secretion were
detected 24 h after stimulation (except
for CCL22, which reached peak levels
2 days later). A down-regulation of
M2a-associated cytokines and chemokines was commonly observed in M1
MDM and vice versa. No significant
modulation of IL-6 or IL-1ra (independently described as being associated with M1 and M2a patterns of polarization (24)) was observed in our
cell cultures. The results, expressed as
the mean fold variation (⫾SD) in chemokine/cytokine secretion vs unpolarized control MDM, represent the
mean values generated in MDM cultures established from four to six independent donors.
Fold Induction over control
100
CCL22
1
0.1
0
1
2
3
4
DAYS
5
6
7
8
M2a
Downloaded from http://www.jimmunol.org/ by guest on August 12, 2017
contrast, the secretion of CXCL10 remained significantly up-regulated for at least 7 days in M1 vs control and M2a MDM ( p ⫽
0.004; Fig. 5). Conversely, secretion of the M2a-associated chemokine CCL22 was further up-regulated after removal of IL-4 and
remained above control levels for at least 7 days ( p ⫽ 0.032; Fig.
5). In addition, we have also observed an impaired secretion of
chemokines and cytokines typically secreted by the opposite polarization program with peak secretion levels occurring ⬃3 days
postpolarization. In particular, secretion of M1-related CCL3,
CXCL10, and IL-6 was significantly decreased in M2a MDM.
Conversely, the release of the M2a-associated CCL22, IL-10, and
been reported to up-regulate HIV-1 expression in MDM and
chronically infected promonocytic cells (18), showed a relatively
weak 2-fold increase in M1 vs control MDM. Finally, IL-10, a
cytokine that has been accredited with both enhancing and suppressive effects on virus replication in monocytes, primary MDM,
and promonocytic cell lines (58 – 61), was significantly up-regulated in M2a MDM vs control and M1 MDM (Table III).
The Journal of Immunology
6243
CONT
M1
M2a
p=0.006
250
4,096
p=0.006
150
100
75
HIV DNA Copies/10 6 Cells
2,048
50
1,024
37
512
25
20
256
Control
M1
M2a
FIGURE 6. Inhibition of HIV DNA and protein synthesis in M1 but not in M2a MDM. A, Control, M1 and M2a MDM were infected with HIV-1BaL
and harvested after 48 h. Levels of HIV-1 gag DNA ranged from 52 to 4,463 copies per 1,000,000 cells in infected MDM, whereas uninfected MDM
routinely expressed ⬍1 copy viral RNA per 1,000,000 cells. These results represent the mean (⫾SD) of eight individual infections of independent MDM
cell cultures. Statistical differences were assessed using the multivariate one-way ANOVA and Tukey’s posttest. B, Accumulation of HIV-1 proteins was
determined in control, M1, and M2a MDM 7 days after infection using the serum from an HIV⫹ individual containing high titers of anti-HIV Abs. A sharp
decrease of viral protein synthesis was observed in M1 but not in M2a MDM; these results are representative of three independent infections with cells
of different donors.
IL-1ra was reduced in M1-MDM (Fig. 5). These patterns of cytokine and chemokine secretion suggest that the functional consequences of M1/M2a polarization may be further amplified by a
delayed down-modulation of soluble factors released by MDM
that have been polarized along the opposite program.
M1, but not M2a, polarization inhibits early events of R5 HIV-1
infection of MDM
To further examine the mechanisms underlying the inhibitory patterns associated with macrophage polarization, we quantified the
levels of viral DNA that accumulated during the first 48 h of infection in M1 and M2a or control MDM. This time point was
chosen because it is indicative of a single round of virus replication
in MDM (40). M1 polarization consistently led to a marked decrease in the accumulation of HIV-1 DNA (range, 54 –97%). In
contrast, no statistical differences were observed in terms of HIV-1
DNA accumulation in M2a vs control MDM (Fig. 6A). These results, taken together with the differences in the inhibitory kinetics
in M1 and M2a MDM, indicate a clear-cut difference in the HIV
inhibitory mechanisms induced by M1 vs M2a polarization.
To further characterize the steps in the viral life cycle that are
inhibited by M1 and M2a polarization, we investigated the accumulation of cell-associated viral proteins during the first 7 days of
infection using Western blotting. Consistent with the decreased
accumulation of viral DNA, a marked decrease of HIV-1 protein
synthesis was observed in M1 MDM (Fig. 6B). In contrast, M2a
polarization had no effect on the synthesis or accumulation of viral
proteins, despite the marked reduction in the levels of cell-free
HIV-1 released into the culture supernatant, as determined by the
RT activity (Figs. 2 and 3). In this regard, it should be emphasized
that the RT enzyme is almost exclusively associated with HIV-1
virions and is not shed by infected cells like the p24 Gag Ag (62)
(Fig. 6B). This observation strongly suggests that the polarization
of MDM into M2a cells induces a restriction in one or more late
steps of the viral life cycle.
Discussion
In this study, we demonstrate that the polarization of MDM into
M1 and M2a macrophages leads to a significant restriction in the
capacity of these cells to support productive R5 HIV-1 infection.
M1 polarization was associated with a more profound suppression
of HIV-1 replication that was rapidly lost when cells were infected
3 days after removal of the polarizing cytokines (TNF-␣ plus IFN␥). M1-dependent inhibition was also associated with a sharp decrease in HIV-1 DNA synthesis at 48 h and a decrease in the
accumulation of HIV-1 proteins, indicating that virus inhibition
occurred at an early, preintegration step of the HIV-1 life cycle.
This interpretation is supported by the detection of a clear-cut upregulation of CCR5-binding chemokines (CCL3, CCL4, and
CCL5) and a partial down-regulation of CD4 from the cell surface
of M1 cells. M2a polarization, on the other hand, resulted in a less
profound but more sustained inhibition of virus replication that
was not associated with any impairment of virus entry, reverse
transcription, or HIV protein accumulation, suggesting inhibition
occurred during late events in the HIV-1 life cycle. Both M1 and
M2a phenotypes were transient and reversible for most of the determinants investigated, including the capacity to support productive HIV-1 infection, despite a delayed wave of contra-regulatory
effects observed at the chemokine/cytokine level.
Collectively, our results indicate that an impairment of early
events in the HIV-1 life cycle is the main mechanism responsible
for the inhibition of HIV-1 infection in M1-MDM. This finding is
consistent with previous reports showing that both IFN-␥ and
TNF-␣ can down-regulate CD4, thereby limiting HIV-1 entry. In
this regard, previous studies have also shown that IFN-␥ decreases
CD4 expression in monocytes, whereas TNF-␣, either alone or in
Downloaded from http://www.jimmunol.org/ by guest on August 12, 2017
Actin
6244
MDM. CCL2 is involved in the early recruitment of monocytes to
inflammatory lesions (14) and has been shown to enhance the replication of X4 HIV-1 strains in activated PBMC (54). Neutralization of this chemokine has been shown to inhibit the late phase of
virion release in primary MDM (74). Thus, the reduction in CCL2
secretion may have contributed to the prolonged postentry inhibition of HIV-1 replication observed in M2a but not in M1 MDM.
A distinctive feature of M2a MDM polarization was the persistent up-regulation of CCL22 secretion, a finding that was not observed in either control or M1 MDM. The ability of IL-4 to upregulate CCL22 has been described previously, whereas its lack of
superinduction in M1 MDM is consistent with the known inhibitory effect of IFN-␥ on the expression of this chemokine (11, 24).
With respect to HIV-1, CCL22 was originally described as a suppressive factor released by activated CD8⫹ T cells as part of their
repertoire of nonlytic soluble inhibitory factors (51). Although this
observation was not confirmed by some laboratories (75, 76), we
have reported that CCL22 inhibits HIV-1 replication in MDM but
not in activated PBMC by acting at a postentry step of the viral life
cycle (12). These results are consistent with the pattern of inhibition of HIV-1 replication observed in M2a MDM.
Both M1 and M2a phenotypes were reversible 3–7 days after
removal of the inductive stimuli, although there were some exceptions. Of interest was the detection of a symmetrical wave of contra-modulatory effects that were temporally associated with the
loss of M1 and M2a polarization, suggesting that this phenomenon
may amplify and prolong the consequences of the initial M1 or
M2a polarization program. These findings extend recent work by
Porcheray et al. (33) who, by monitoring the differential expression
of CD163, CD206, CCL3, and CCL18, observed that macrophage
polarization was fully reversible and that differentially activated
macrophages remained susceptible to further changes in the microenvironment. In our study, a strong correlation was observed
between the return to a nonpolarized state and the loss of viral
inhibition with M1 cells exhibiting an earlier recovery in both the
expression of surface membrane CD4 and the capacity to support
HIV replication. With the exception of CXCL10 (M1) and CCL22
(M2a), both M1 and M2a MDM showed a complete reversion to
control levels 7 days after the removal of polarizing cytokines.
In conclusion, cytokine-mediated polarization of mature macrophages into M1 and M2a cells, as investigated in human MDM,
may be an important regulator of macrophage susceptibility to
HIV-1 infection and replication. The transient and reversible nature of the changes in MDM phenotype and activation status may
represent a mechanism through which these cells, which are typically resistant to the cytopathic effect of HIV-1 (3–5), cycle between a state of resistance or latent infection and productive viral
infection and spreading.
Acknowledgments
E.C. performed this study as partial fulfillment of her joint PhD in “Molecular and Cellular Biology” at the Vita-Salute University of Milano (Milan, Italy) and the Open University of London, U.K. We thank Giulia Della
Chiara for performing the analysis of p50 homodimers. E.C. conceived and
performed most experiments leading to the results shown and significantly
contributed to the writing of the manuscript; L.C. performed experiments
and Western blot for HIV-1 proteins and contributed to the writing of the
manuscript; C.R. optimized and performed PCR-based experiments of
quantification of HIV DNA and helped with cytokine quantification;
M.A. and G.P conceived the experimental design, supervised all the crude
results, and significantly contributed to the writing of the manuscript. All
authors contributed equally to the interpretation of the data.
Disclosures
The authors have no financial conflict of interest.
Downloaded from http://www.jimmunol.org/ by guest on August 12, 2017
combination with IL-13, down-regulates CCR5 and CXCR4, as
well as CD4, from the surface of MDM (16, 44, 45, 48). Our study
confirms and extends these observations to M1 MDM generated by
the short-term costimulation with TNF-␣ plus IFN-␥. Although
M1 polarization led to a marked reduction in CD4 and CXCR4, we
did not observe a down-regulation of CCR5, despite increased secretion of its ligands, namely CCL3, CCL4, and CCL5. In addition
to interfering with the entry of R5 HIV-1, it has been reported that
IFN-␥ up-regulates APOBEC-3G expression, which may further
restrict infection at an early postentry level (63).
A partial CD4 down-regulation was also observed in M2a
MDM, although to a lesser extent than in M1-MDM (Table III). As
previously reported for monocytes that have been preincubated
with IL-4 for 5 days (64), the decrease in CD4 on M2a MDM did
not lead to a reduction in the accumulation of HIV-1 DNA at 48 h.
In monocytes exposed to IL-4 before infection, virus production
was found to be highly dependent on an inhibition of cell proliferation during in vitro differentiation into macrophages (64). In
contrast, in mature macrophages already infected with HIV-1, IL-4
stimulation enhances HIV-1 transcription without affecting the levels of CCR5 expression (65). In our study, an IL-4-dependent increase in CCR5 expression was observed in some donors (Table I).
This increase may have compensated for the decreased levels of
CD4 expression on M2a cells consistent with the observation that
macrophages expressing high levels of CCR5 but low levels of
CD4 are fully susceptible to infection by R5 HIV-1 (66). Another
feature that, according to the literature, could have contributed to
the postentry restriction of HIV-1 expression in M2a MDM is the
accumulation of transcriptional inhibitory NF-␬B p50 homodimers
in the cell nucleus (67– 69). We investigated this hypothesis but
found no evidence of such a phenomenon under our experimental
conditions (data not shown). The detection of equivalent levels of
cell-associated HIV-1 proteins in control and M2a MDM also renders it unlikely that HIV-1 replication was inhibited before transcription. Furthermore, the latter finding suggests that the inhibition of HIV-1 replication observed in M2a MDM involves late,
posttranslational events in the virus life cycle. This is in contrast to
a study published by Schuitemaker et al. (64) who reported that the
IL-4-induced inhibition of HIV-1 replication in MDM occurs at
the level of reverse transcription. This apparent discrepancy is
most likely due to differences between the two models of MDM. In
the previous study, monocytes were differentiated into MDM for 5
days in the presence of IL-4 before infection (64), whereas in our
study, differentiated MDM were stimulated with IL-4 for only 18 h
before infection.
Another salient feature of M1 polarization was the strong and
sustained up-regulation of CXCL10 (for at least 7 days postpolarization), a chemokine that plays an important role in HIV-1 encephalitis (70, 71). Previous in vitro studies have shown that
CXCL10 stimulates HIV-1 replication by down-regulating the secretion of CCR5-binding chemokines, thereby enhancing viral entry (49, 72, 73). CXCL10-associated enhancement of HIV-1 infection was not observed in our system, although the prolonged
secretion of CXCL10 may have contributed to the rapid downregulation of CCL3 secretion (and potentially CCL4 and CCL5)
observed in M1 MDM (Fig. 6). In this regard, we observed that
only 20% of MDM were induced to secrete CCL3 following M1polarizing stimulation with TNF-␣ plus IFN-␥ while most cells
responded to lipid A (Fig. 4). This suggests that the MDM population consists of cells that differ in their ability to respond to M1
polarization (TNF-␣ and IFN-␥), at least in terms of CCL3
expression.
CCL2, a proinflammatory chemokine that was constitutively secreted by M1 and control MDM, was down-regulated in M2a
HIV-1 REPLICATION IN M1 AND M2a MDM
The Journal of Immunology
References
24. Mantovani, A., A. Sica, S. Sozzani, P. Allavena, A. Vecchi, and M. Locati. 2004.
The chemokine system in diverse forms of macrophage activation and polarization. Trends Immunol. 25: 677– 686.
25. Gordon, S. 2003. Alternative activation of macrophages. Nat. Rev. Immunol. 3:
23–35.
26. Mantovani, A., S. Sozzani, M. Locati, P. Allavena, and A. Sica. 2002. Macrophage polarization: tumor-associated macrophages as a paradigm for polarized
M2 mononuclear phagocytes. Trends Immunol. 23: 549 –555.
27. Goerdt, S., O. Politz, K. Schledzewski, R. Birk, A. Gratchev, P. Guillot,
N. Hakiy, C. D. Klemke, E. Dippel, V. Kodelja, and C. E. Orfanos. 1999. Alternative versus classical activation of macrophages. Pathobiology 67: 222–226.
28. Mantovani, A., A. Sica, and M. Locati. 2005. Macrophage polarization comes of
age. Immunity 23: 344 –346.
29. Mills, C. D., K. Kincaid, J. M. Alt, M. J. Heilman, and A. M. Hill. 2000. M-1/M-2
macrophages and the Th1/Th2 paradigm. J. Immunol. 164: 6166 – 6173.
30. Fadok, V. A., D. L. Bratton, A. Konowal, P. W. Freed, J. Y. Westcott, and
P. M. Henson. 1998. Macrophages that have ingested apoptotic cells in vitro
inhibit proinflammatory cytokine production through autocrine/paracrine mechanisms involving TGF-␤, PGE2, and PAF. J. Clin. Invest. 101: 890 – 898.
31. Goerdt, S., and C. E. Orfanos. 1999. Other functions, other genes: alternative
activation of antigen-presenting cells. Immunity 10: 137–142.
32. Munder, M., K. Eichmann, and M. Modolell. 1998. Alternative metabolic states
in murine macrophages reflected by the nitric oxide synthase/arginase balance:
competitive regulation by CD4⫹ T cells correlates with Th1/Th2 phenotype.
J. Immunol. 160: 5347–5354.
33. Porcheray, F., S. Viaud, A. C. Rimaniol, C. Leone, B. Samah,
N. Dereuddre-Bosquet, D. Dormont, and G. Gras. 2005. Macrophage activation
switching: an asset for the resolution of inflammation. Clin. Exp. Immunol. 142:
481– 489.
34. Stein, M., S. Keshav, N. Harris, and S. Gordon. 1992. Interleukin 4 potently
enhances murine macrophage mannose receptor activity: a marker of alternative
immunologic macrophage activation. J. Exp. Med. 176: 287–292.
35. Topoll, H. H., G. Zwadlo, D. E. Lange, and C. Sorg. 1989. Phenotypic dynamics
of macrophage subpopulations during human experimental gingivitis.
J. Periodontal Res. 24: 106 –112.
36. Martinez, F. O., S. Gordon, M. Locati, and A. Mantovani. 2006. Transcriptional
profiling of the human monocyte-to-macrophage differentiation and polarization:
new molecules and patterns of gene expression. J. Immunol. 177: 7303–7311.
37. Alfano, M., and G. Poli. 2001. Cytokine and chemokine based control of HIV
infection and replication. Curr. Pharm. Des. 7: 993–1013.
38. Clerici, M., and G. M. Shearer. 1994. The Th1-Th2 hypothesis of HIV infection:
new insights. Immunol. Today 15: 575–581.
39. Clerici, M., and G. M. Shearer. 1993. A Th13 Th2 switch is a critical step in the
etiology of HIV infection. Immunol. Today 14: 107–111.
40. Collin, M., and S. Gordon. 1994. The kinetics of human immunodeficiency virus
reverse transcription are slower in primary human macrophages than in a lymphoid cell line. Virology 200: 114 –120.
41. Monini, P., S. Colombini, M. Sturzl, D. Goletti, A. Cafaro, C. Sgadari, S. Butto,
M. Franco, P. Leone, S. Fais, et al. 1999. Reactivation and persistence of human
herpesvirus-8 infection in B cells and monocytes by Th-1 cytokines increased in
Kaposi’s sarcoma. Blood 93: 4044 – 4058.
42. Vicenzi, E., P. Panina-Bodignon, G. Vallanti, P. Di Lucia, and G. Poli. 2002.
Restricted replication of primary HIV-1 isolates using both CCR5 and CXCR4 in
Th2 but not in Th1 CD4⫹ T cells. J. Leukocyte Biol. 72: 913–920.
43. Alfano, M., J. C. Grivel, S. Ghezzi, D. Corti, M. Trimarchi, G. Poli, and
L. Margolis. 2005. Pertussis toxin B-oligomer dissociates T cell activation and
HIV replication in CD4 T cells released from infected lymphoid tissue. AIDS 19:
1007–1014.
44. Kozak, S. L., E. J. Platt, N. Madani, F. E. Ferro, Jr., K. Peden, and D. Kabat.
1997. CD4, CXCR-4, and CCR-5 dependencies for infections by primary patient
and laboratory-adapted isolates of human immunodeficiency virus type 1. J. Virol. 71: 873– 882.
45. Moore, J. P. 1997. Coreceptors: implications for HIV pathogenesis and therapy.
Science 276: 51–52.
46. Collman, R., N. F. Hassan, R. Walker, B. Godfrey, J. Cutilli, J. C. Hastings,
H. Friedman, S. D. Douglas, and N. Nathanson. 1989. Infection of monocytederived macrophages with human immunodeficiency virus type 1 (HIV-1):
monocyte-tropic and lymphocyte-tropic strains of HIV-1 show distinctive patterns of replication in a panel of cell types. J. Exp. Med. 170: 1149 –1163.
47. Schuitemaker, H., N. A. Kootstra, R. E. de Goede, F. de Wolf, F. Miedema, and
M. Tersmette. 1991. Monocytotropic human immunodeficiency virus type 1
(HIV-1) variants detectable in all stages of HIV-1 infection lack T cell line tropism and syncytium-inducing ability in primary T cell culture. J. Virol. 65:
356 –363.
48. Fantuzzi, L., F. Belardelli, and S. Gessani. 2003. Monocyte/macrophage-derived
CC chemokines and their modulation by HIV-1 and cytokines: a complex network of interactions influencing viral replication and AIDS pathogenesis. J. Leukocyte Biol. 74: 719 –725.
49. Lane, B. R., S. R. King, P. J. Bock, R. M. Strieter, M. J. Coffey, and
D. M. Markovitz. 2003. The C-X-C chemokine IP-10 stimulates HIV-1 replication. Virology 307: 122–134.
50. Cinque, P., L. Vago, M. Mengozzi, V. Torri, D. Ceresa, E. Vicenzi, P. Transidico,
A. Vagani, S. Sozzani, A. Mantovani, et al. 1998. Elevated cerebrospinal fluid
levels of monocyte chemotactic protein-1 correlate with HIV-1 encephalitis and
local viral replication. AIDS 12: 1327–1332.
51. Bernasconi, S., P. Cinque, G. Peri, S. Sozzani, A. Crociati, W. Torri, E. Vicenzi,
L. Vago, A. Lazzarin, G. Poli, and A. Mantovani. 1996. Selective elevation of
Downloaded from http://www.jimmunol.org/ by guest on August 12, 2017
1. van’t Wout, A. B., N. A. Kootstra, G. A. Mulder-Kampinga,
N. Albrecht-van Lent, H. J. Scherpbier, J. Veenstra, K. Boer, R. A. Coutinho,
F. Miedema, and H. Schuitemaker. 1994. Macrophage-tropic variants initiate
human immunodeficiency virus type 1 infection after sexual, parenteral, and vertical transmission. J. Clin. Invest. 94: 2060 –2067.
2. Connor, R. I., and D. D. Ho. 1994. Human immunodeficiency virus type 1 variants with increased replicative capacity develop during the asymptomatic stage
before disease progression. J. Virol. 68: 4400 – 4408.
3. Martin, J. C., and J. C. Bandres. 1999. Cells of the monocyte-macrophage lineage
and pathogenesis of HIV-1 infection. J. Acquir. Immune Defic. Syndr. 22:
413– 429.
4. Orenstein, J. M., C. Fox, and S. M. Wahl. 1997. Macrophages as a source of HIV
during opportunistic infections. Science 276: 1857–1861.
5. Embretson, J., M. Zupancic, J. L. Ribas, A. Burke, P. Racz, K. Tenner-Racz, and
A. T. Haase. 1993. Massive covert infection of helper T lymphocytes and macrophages by HIV during the incubation period of AIDS. Nature 362: 359 –362.
6. Persaud, D., Y. Zhou, J. M. Siliciano, and R. F. Siliciano. 2003. Latency in
human immunodeficiency virus type 1 infection: no easy answers. J. Virol. 77:
1659 –1665.
7. Wahl, S. M., T. Greenwell-Wild, G. Peng, G. Ma, J. M. Orenstein, and
N. Vazquez. 2003. Viral and host cofactors facilitate HIV-1 replication in macrophages. J. Leukocyte Biol. 74: 726 –735.
8. Igarashi, T., C. R. Brown, Y. Endo, A. Buckler-White, R. Plishka,
N. Bischofberger, V. Hirsch, and M. A. Martin. 2001. Macrophage are the principal reservoir and sustain high virus loads in rhesus macaques after the depletion
of CD4⫹ T cells by a highly pathogenic simian immunodeficiency virus/HIV type
1 chimera (SHIV): implications for HIV-1 infections of humans. Proc. Natl.
Acad. Sci. USA 98: 658 – 663.
9. Zhu, T., D. Muthui, S. Holte, D. Nickle, F. Feng, S. Brodie, Y. Hwangbo,
J. I. Mullins, and L. Corey. 2002. Evidence for human immunodeficiency virus
type 1 replication in vivo in CD14⫹ monocytes and its potential role as a source
of virus in patients on highly active antiretroviral therapy. J. Virol. 76: 707–716.
10. Llewellyn, N., R. Zioni, H. Zhu, T. Andrus, Y. Xu, L. Corey, and T. Zhu. 2006.
Continued evolution of HIV-1 circulating in blood monocytes with antiretroviral
therapy: genetic analysis of HIV-1 in monocytes and CD4⫹ T cells of patients
with discontinued therapy. J. Leukocyte Biol. 80: 1118 –1126.
11. Bonecchi, R., S. Sozzani, J. T. Stine, W. Luini, G. D’Amico, P. Allavena,
D. Chantry, and A. Mantovani. 1998. Divergent effects of interleukin 4 and interferon ␥ on macrophage-derived chemokine production: an amplification circuit
of polarized T helper 2 responses. Blood 92: 2668 –2671.
12. Cota, M., M. Mengozzi, E. Vicenzi, P. Panina-Bordignon, F. Sinigaglia,
P. Transidico, S. Sozzani, A. Mantovani, and G. Poli. 2000. Selective inhibition
of HIV replication in primary macrophages but not T lymphocytes by macrophage-derived chemokine. Proc. Natl. Acad. Sci. USA 97: 9162–9167.
13. de Waal Malefyt, R., C. G. Figdor, R. Huijbens, S. Mohan-Peterson, B. Bennett,
J. Culpepper, W. Dang, G. Zurawski, and J. E. de Vries. 1993. Effects of IL-13
on phenotype, cytokine production, and cytotoxic function of human monocytes.
Comparison with IL-4 and modulation by IFN-␥ or IL-10. J. Immunol. 151:
6370 – 6381.
14. Fantuzzi, L., P. Borghi, V. Ciolli, G. Pavlakis, F. Belardelli, and S. Gessani. 1999.
Loss of CCR2 expression and functional response to monocyte chemotactic protein (MCP-1) during the differentiation of human monocytes: role of secreted
MCP-1 in the regulation of the chemotactic response. Blood 94: 875– 883.
15. Perez-Bercoff, D., A. David, H. Sudry, F. Barre-Sinoussi, and G. Pancino. 2003.
Fc␥ receptor-mediated suppression of human immunodeficiency virus type 1 replication in primary human macrophages. J. Virol. 77: 4081– 4094.
16. Kedzierska, K., S. M. Crowe, S. Turville, and A. L. Cunningham. 2003. The
influence of cytokines, chemokines and their receptors on HIV-1 replication in
monocytes and macrophages. Rev. Med. Virol. 13: 39 –56.
17. Honda, Y., L. Rogers, K. Nakata, B. Y. Zhao, R. Pine, Y. Nakai, K. Kurosu,
W. N. Rom, and M. Weiden. 1998. Type I interferon induces inhibitory 16-kD
CCAAT/ enhancer binding protein (C/EBP)␤, repressing the HIV-1 long terminal
repeat in macrophages: pulmonary tuberculosis alters C/EBP expression, enhancing HIV-1 replication. J. Exp. Med. 188: 1255–1265.
18. Rizzi, C., M. P. Crippa, R. E. Jeeninga, B. Berkhout, F. Blasi, G. Poli, and
M. Alfano. 2006. Pertussis toxin B-oligomer suppresses IL-6 induced HIV-1 and
chemokine expression in chronically infected U1 cells via inhibition of activator
protein 1. J. Immunol. 176: 999 –1006.
19. Kedzierska, K., and S. M. Crowe. 2001. Cytokines and HIV-1: interactions and
clinical implications. Antivir. Chem. Chemother. 12: 133–150.
20. Montaner, L. J., R. T. Bailer, and S. Gordon. 1997. IL-13 acts on macrophages
to block the completion of reverse transcription, inhibit virus production, and
reduce virus infectivity. J. Leukocyte Biol. 62: 126 –132.
21. Naif, H. M., S. Li, M. Ho-Shon, J. M. Mathijs, P. Williamson, and
A. L. Cunningham. 1997. The state of maturation of monocytes into macrophages
determines the effects of IL-4 and IL-13 on HIV replication. J. Immunol. 158:
501–511.
22. Herbein, G., L. J. Montaner, and S. Gordon. 1996. Tumor necrosis factor alpha
inhibits entry of human immunodeficiency virus type 1 into primary human macrophages: a selective role for the 75-kilodalton receptor. J. Virol. 70: 7388 –7397.
23. Lane, B. R., D. M. Markovitz, N. L. Woodford, R. Rochford, R. M. Strieter, and
M. J. Coffey. 1999. TNF-␣ inhibits HIV-1 replication in peripheral blood monocytes and alveolar macrophages by inducing the production of RANTES and
decreasing C-C chemokine receptor 5 (CCR5) expression. J. Immunol. 163:
3653–3661.
6245
6246
52.
53.
54.
55.
56.
57.
58.
60.
61.
62.
63.
64.
65. Valentin, A., W. Lu, M. Rosati, R. Schneider, J. Albert, A. Karlsson, and
G. N. Pavlakis. 1998. Dual effect of interleukin 4 on HIV-1 expression: implications for viral phenotypic switch and disease progression. Proc. Natl. Acad. Sci.
USA 95: 8886 – 8891.
66. Fear, W. R., A. M. Kesson, H. Naif, G. W. Lynch, and A. L. Cunningham. 1998.
Differential tropism and chemokine receptor expression of human immunodeficiency virus type 1 in neonatal monocytes, monocyte-derived macrophages, and
placental macrophages. J. Virol. 72: 1334 –1344.
67. Saccani, A., T. Schioppa, C. Porta, S. K. Biswas, M. Nebuloni, L. Vago,
B. Bottazzi, M. P. Colombo, A. Mantovani, and A. Sica. 2006. p50 nuclear factor
␬B overexpression in tumor-associated macrophages inhibits M1 inflammatory
responses and antitumor resistance. Cancer Res. 66: 11432–11440.
68. Cao, S., X. Zhang, J. P. Edwards, and D. M. Mosser. 2006. NF-␬B1 (p50) homodimers differentially regulate pro- and anti-inflammatory cytokines in macrophages. J. Biol. Chem. 281: 26041–26050.
69. Lewin, S. R., P. Lambert, N. J. Deacon, J. Mills, and S. M. Crowe. 1997. Constitutive expression of p50 homodimer in freshly isolated human monocytes decreases with in vitro and in vivo differentiation: a possible mechanism influencing
human immunodeficiency virus replication in monocytes and mature macrophages. J. Virol. 71: 2114 –2119.
70. Kolb, S. A., B. Sporer, F. Lahrtz, U. Koedel, H. W. Pfister, and A. Fontana. 1999.
Identification of a T cell chemotactic factor in the cerebrospinal fluid of HIV-1infected individuals as interferon ␥ inducible protein 10. J. Neuroimmunol. 93:
172–181.
71. Sanders, V. J., C. A. Pittman, M. G. White, G. Wang, C. A. Wiley, and
C. L. Achim. 1998. Chemokines and receptors in HIV encephalitis. AIDS 12:
1021–1026.
72. Taub, D. D., A. R. Lloyd, K. Conlon, J. M. Wang, J. R. Ortaldo, A. Harada,
K. Matsushima, D. J. Kelvin, and J. J. Oppenheim. 1993. Recombinant human
interferon-inducible protein 10 is a chemoattractant for human monocytes and T
lymphocytes and promotes T cell adhesion to endothelial cells. J. Exp. Med. 177:
1809 –1814.
73. Taub, D. D., D. L. Longo, and W. J. Murphy. 1996. Human interferon-inducible
protein-10 induces mononuclear cell infiltration in mice and promotes the migration of human T lymphocytes into the peripheral tissues and human peripheral
blood lymphocytes-SCID mice. Blood 87: 1423–1431.
74. Fantuzzi, L., F. Spadaro, G. Vallanti, I. Canini, C. Ramoni, E. Vicenzi,
F. Belardelli, G. Poli, and S. Gessani. 2003. Endogenous CCL2 (monocyte chemotactic protein-1) modulates human immunodeficiency virus type-1 replication
and affects cytoskeleton organization in human monocyte-derived macrophages.
Blood 102: 2334 –2337.
75. Moriuchi, H., and M. Moriuchi. 1999. Dichotomous effects of macrophage-derived chemokine on HIV infection. AIDS 13: 994 –996.
76. Struyf, S., P. Proost, S. Sozzani, A. Mantovani, A. Wuyts, E. De Clercq,
D. Schols, and J. Van Damme. 1998. Enhanced anti-HIV-1 activity and altered
chemotactic potency of NH2-terminally processed macrophage-derived chemokine (MDC) imply an additional MDC receptor. J. Immunol. 161: 2672–2675.
Downloaded from http://www.jimmunol.org/ by guest on August 12, 2017
59.
monocyte chemotactic protein-1 in the cerebrospinal fluid of AIDS patients with
cytomegalovirus encephalitis. J. Infect. Dis. 174: 1098 –1101.
Vicenzi, E., M. Alfano, S. Ghezzi, A. Gatti, F. Veglia, A. Lazzarin, S. Sozzani,
A. Mantovani, and G. Poli. 2000. Divergent regulation of HIV-1 replication in
PBMC of infected individuals by CC chemokines: suppression by RANTES,
MIP-1␣, and MCP-3, and enhancement by MCP-1. J. Leukocyte Biol. 68:
405– 412.
Maurais, E., R. Cantin, and M. J. Tremblay. 2009. Human immunodeficiency
virus type 1-anchored CD40 ligand induces secretion of the chemokine interleukin-8 by human primary macrophages. Virology 385: 227–232.
Lane, B. R., K. Lore, P. J. Bock, J. Andersson, M. J. Coffey, R. M. Strieter, and
D. M. Markovitz. 2001. Interleukin-8 stimulates human immunodeficiency virus
type 1 replication and is a potential new target for antiretroviral therapy. J. Virol.
75: 8195– 8202.
Narimatsu, R., D. Wolday, and B. K. Patterson. 2005. IL-8 increases transmission
of HIV type 1 in cervical explant tissue. AIDS Res. Hum. Retroviruses 21:
228 –233.
Rodenburg, R. J., R. F. Brinkhuis, R. Peek, J. R. Westphal,
F. H. Van Den Hoogen, W. J. van Venrooij, and L. B. van de Putte. 1998.
Expression of macrophage-derived chemokine (MDC) mRNA in macrophages is
enhanced by interleukin 1␤, tumor necrosis factor ␣, and lipopolysaccharide.
J. Leukocyte Biol. 63: 606 – 611.
Pal, R., A. Garzino-Demo, P. D. Markham, J. Burns, M. Brown, R. C. Gallo, and
A. L. DeVico. 1997. Inhibition of HIV-1 infection by the ␤-chemokine MDC.
Science 278: 695– 698.
Kootstra, N. A., A. van ’t Wout, H. G. Huisman, F. Miedema, and
H. Schuitemaker. 1994. Interference of interleukin-10 with human immunodeficiency virus type 1 replication in primary monocyte-derived macrophages. J. Virol. 68: 6967– 6975.
Sozzani, S., S. Ghezzi, G. Iannolo, W. Luini, A. Borsatti, N. Polentarutti, A. Sica,
M. Locati, C. Mackay, T. N. Wells, et al. 1998. Interleukin 10 increases CCR5
expression and HIV infection in human monocytes. J. Exp. Med. 187: 439 – 444.
Weissman, D., G. Poli, and A. S. Fauci. 1994. Interleukin 10 blocks HIV replication in macrophages by inhibiting the autocrine loop of tumor necrosis factor
␣ and interleukin 6 induction of virus. AIDS Res. Hum. Retroviruses 10:
1199 –1206.
Weissman, D., G. Poli, and A. S. Fauci. 1995. IL-10 synergizes with multiple
cytokines in enhancing HIV production in cells of monocytic lineage. J. Acquir.
Immune Defic. Syndr. Hum. Retrovirol. 9: 442– 449.
Fernie, B. F., G. Poli, and A. S. Fauci. 1991. ␣ Interferon suppresses virion but
not soluble human immunodeficiency virus antigen production in chronically
infected T lymphocytic cells. J. Virol. 65: 3968 –3971.
Peng, G., K. J. Lei, W. Jin, T. Greenwell-Wild, and S. M. Wahl. 2006. Induction
of APOBEC3 family proteins, a defensive maneuver underlying interferon-induced anti-HIV-1 activity. J. Exp. Med. 203: 41– 46.
Schuitemaker, H., N. A. Kootstra, M. H. Koppelman, S. M. Bruisten,
H. G. Huisman, M. Tersmette, and F. Miedema. 1992. Proliferation-dependent
HIV-1 infection of monocytes occurs during differentiation into macrophages.
J. Clin. Invest. 89: 1154 –1160.
HIV-1 REPLICATION IN M1 AND M2a MDM