Download Phospholamban Is Present in Endothelial Cells and Modulates

Phospholamban Is Present in Endothelial Cells and
Modulates Endothelium-Dependent Relaxation
Evidence From Phospholamban Gene-Ablated Mice
Roy L. Sutliff, James B. Hoying, Vivek J. Kadambi, Evangelia G. Kranias, Richard J. Paul
Downloaded from http://circres.ahajournals.org/ by guest on August 11, 2017
Abstract—Vascular endothelial cells regulate vascular smooth muscle tone through Ca21-dependent production and release
of vasoactive molecules. Phospholamban (PLB) is a 24- to 27-kDa phosphoprotein that modulates activity of the
sarco(endo)plasmic reticulum Ca21 ATPase (SERCA). Expression of PLB is reportedly limited to cardiac, slow-twitch
skeletal and smooth muscle in which PLB is an important regulator of [Ca21]i and contractility in these muscles. In the
present study, we report the existence of PLB in the vascular endothelium, a nonmuscle tissue, and provide functional
data on PLB regulation of vascular contractility through its actions in the endothelium. Endothelium-dependent
relaxation to acetylcholine was attenuated in aorta of PLB-deficient (PLB-KO) mice compared with wild-type (WT)
controls. This effect was not due to actions of nitric oxide on the smooth muscle, because sodium nitroprusside–
mediated relaxation in either denuded or endothelium-intact aortas was unaffected by PLB ablation. Relative to denuded
vessels, relaxation to forskolin was enhanced in WT endothelium-intact aortas. The endothelium-dependent component
of this relaxation was attenuated in PLB-KO aortas. To investigate whether these changes were due to PLB, WT mouse
aorta endothelial cells were isolated. Both reverse transcriptase–polymerase chain reaction and Western blot analyses
revealed the presence of PLB in endothelial cells, which were shown to be .98% pure by diI-acetylated LDL uptake
and nuclear counterstaining. These data indicate that PLB is present and modulates vascular function as a result of its
actions in endothelial cells. The presence of PLB in endothelial cells opens new fields for investigation of Ca21
regulatory pathways in nonmuscle cells and for modulation of endothelial-vascular interactions. (Circ Res.
1999;84:360-364.)
Key Words: phospholamban n endothelium n vasorelaxation n SERCA n Ca21
V
shown to be an important modulator of cardiac muscle contractility (for review, see Reference 5) and the inotropic response of
the heart to b-adrenergic stimulation.6 In addition, contractility
in slow-twitch skeletal7 and vascular smooth muscle8 was
markedly affected by PLB gene ablation.
In the present study, we establish for the first time that PLB
is also expressed in the endothelium, a nonmuscle tissue.
Furthermore, the lack of expression of this protein in the
endothelium of the PLB-KO aorta is associated with altered
endothelium-dependent relaxation. Moreover, we show that
PLB is an important modulator of the endothelium-dependent
component of protein kinase A–mediated relaxation in mouse
aorta. This opens new fields for investigation of Ca21 regulatory pathways in nonmuscle cells and for modulation of
endothelial-vascular interactions.
ascular endothelial cells regulate tone by releasing
vasorelaxing factors such as endothelium-derived nitric
oxide (NO) or prostacyclin and endothelium-derived constricting factors such as endothelin. [Ca21]i levels modulate
the production and release of these vasoactive factors.1 In
general, agonist-mediated increases in [Ca21]i occur in a
biphasic manner. An initial transient increase in [Ca21]i
reflects inositol 1,4,5-trisphosphate–mediated release from
intracellular stores.2,3 This fractional Ca21 release from the
endoplasmic reticulum activates an influx of [Ca21]o.4 Restoration of [Ca21]i occurs via sequestration into intracellular
stores and extrusion through the plasma membrane.
Phospholamban (PLB) is a 24- to 27-kDa phosphoprotein that
modulates the activity of the sarco(endo)plasmic reticulum Ca21
ATPase (SERCA). PLB has 3 phosphorylation sites that are
critical for the regulation of Ca21 uptake into intracellular stores.
In its unphosphorylated form, PLB inhibits SERCA uptake of
Ca21. Phosphorylation of PLB relieves this inhibition by increasing the affinity of SERCA for Ca21. Using a mouse model in
which the PLB gene has been ablated (PLB-KO), PLB was
Materials and Methods
Generation of PLB-KO Mice
Mice deficient in the PLB gene were generated by gene-targeting
methodology in murine embryonic stem cells as previously de-
Received November 13, 1998; accepted January 4, 1999.
From the Departments of Molecular and Cellular Physiology (R.L.S., E.G.K., R.J.P.); Pharmacology and Cell Biophysics (V.J.K., R.J.P.); Molecular
Genetics (J.B.H.), University of Cincinnati College of Medicine, Cincinnati, Ohio.
Correspondence to Richard J. Paul, PhD, PO Box 670576, 231 Bethesda Ave, Cincinnati, OH 45267-0576. E-mail [email protected]
© 1999 American Heart Association, Inc.
Circulation Research is available at http://www.circresaha.org
360
Sutliff et al
February 19, 1999
361
Downloaded from http://circres.ahajournals.org/ by guest on August 11, 2017
Figure 1. ACh concentration-relaxation
relations. A, Representative tracing of
ACh-mediated relaxation of aortas from
WT and PLB-KO mice. B,
Concentration-relaxation curves in WT
(F) and PLB-KO ( f ) mouse aortas
demonstrated a decreased sensitivity
of the PLB-KO aorta to endotheliumdependent relaxation. *Statistically significant differences between WT and
PLB-KO at individual points, P,0.05
(2-way repeated-measures ANOVA).
Results are presented as the
mean6SEM of 7 paired WT and KO
aortas. PE indicates phenylephrine.
scribed.6 Homozygous breeding was used for the generation of both
the wild-type (WT) and PLB-KO mice. Both male and female mice
were used for the present study. Care was taken to ensure that
gender-matched mice were used for each experiment. All experiments were completed in accordance with institutional animal care
guidelines.
Aorta Force Measurements
Isometric forces were measured as described previously.8,9 Briefly,
aortic rings were threaded with 2 triangular 100-mm stainless steel
wires; each completed mounting formed a double triangle. The aorta
and holder were then mounted on a hook that was attached to a
Harvard Apparatus differential capacitor force transducer. Resting
tension on each aorta was set to 30 mN, to approximate an in vivo
aortic pressure of 100 mm Hg, and this passive tension was maintained throughout the experiment. For experiments using denuded
aortas, the endothelium was removed by rubbing the aorta between
the thumb and index finger. Removing the endothelium in this
manner does not affect force development in response to either KCl
or phenylephrine. Relaxation responses to acetylcholine (ACh, 1
nmol/L to 10 mmol/L), forskolin (1 nmol/L to 1 mmol/L), and
sodium nitroprusside (SNP) (0.1 to 300 nmol/L) were determined in
aortas contracted with phenylephrine (3 mmol/L). If the relaxation
response to ACh (10 mmol/L) of the denuded vessels exceeded 10%,
these data were excluded from analysis. Data were obtained using
MP100W hardware and analyzed using AcqKnowledge software
(Biopac, Goleta, Calif).
Endothelial Cell Isolation
Primary mouse aortic endothelial cells were isolated as described
previously.9 Briefly, endothelial cells were collected from a freshly
dissected thoracic aorta. The vessel was ligated at each end with a
5-0 silk suture, and a PBS solution (in mmol/L: KCl 2.68, KH2PO4
1.47, NaCl 136.9, and Na2HPO4 8.1) containing 8 mg/mL collagenase B and 8 mg/mL BSA was injected into the vessel. After a
40-minute incubation at 37°C, the vessel was opened longitudinally
and loosely adhered cells were dislodged by repeated flushing with
a pipette. These cells were collected, centrifuged, and resuspended in
DMEM containing 5.5 mmol/L glucose and 0.1% BSA and plated
onto glass coverslips coated with fibronectin. These cells were
allowed to grow for 4 passages. To confirm that these cells were
endothelial cells, separate coverslips were incubated with 10 mg/mL
diI-acetylated LDL for 4 hours at 37°C and then counterstained with
5 mg/mL bis-benzamide to identify individual cells. More than 98%
of the isolated cells, as identified by diI-acetylated LDL uptake and
nuclear counterstaining were determined to be endothelial cells.
Reverse Transcriptase–Polymerase Chain Reaction
(RT-PCR) of Isolated Cells
Primary endothelial cells from 2 aortas were isolated as described
above. Pooled endothelial cells and the remaining vessel medial
layers were each homogenized in 0.8 mL of RNAzol B (Tel-Test Inc,
Friendswood, Tex) and the RNA extracted, per the manufacturer’s
instructions, using glycogen as a carrier during RNA precipitation.
The entire RNA sample was transcribed into first-strand cDNA using
362
Phospholamban and Endothelium Function
Superscript Reverse Transcriptase (Gibco BRL, Grand Island, NY)
at 42°C. Serial dilutions (1:1, 1:2, 1:4, and 1:8) of the cDNA were
amplified by hot-start PCR for PLB (Tm556°C, 35 cycles) or a-actin
(Tm557°C, 27 cycles) transcripts. The primers used for detection
were as follows: a-actin, upper, AGACAGCTATGTGGGGGATG;
lower, GAAGGAA TAGCCACG CTCAG); PLB, upper, TGTGGGTTGCAAAGTTAGGC; lower, TGTG GGTTGCAA
AGTTAGGC.
Western Blot Analysis
Downloaded from http://circres.ahajournals.org/ by guest on August 11, 2017
Cell homogenates were solubilized in SDS sample buffer and loaded
onto a 10% to 20% gradient SDS polyacrylamide gel. Samples were
transferred electrophoretically onto a 0.22-mm nitrocellulose membrane. After blocking the nitrocellulose with 5% dry milk, the
membrane was incubated for 1 hour at room temperature with a
monoclonal antibody to PLB (1:1000 dilution). The antibody-antigen
complex was detected after incubation of the blot with horseradish
peroxidase– conjugated secondary antibody and visualized using
enhanced chemiluminescence Western blotting reagents (Amersham). Blots were quantitated by densitometry (Zenith soft laser
scanning densitometer).
Statistics
Data from concentration-relaxation curves were compared using
2-way ANOVA for repeated measures. EC50 values were determined
using a logistic fit with Origin software (Northampton, Mass) and
compared with t test analysis. Significance was defined as P,0.05
for all tests.
Results
Effects of PLB Gene Ablation on
Endothelium-Dependent Relaxation
To assess the effects of PLB gene ablation on endotheliumdependent relaxation, mouse aortas were stimulated with
3 mmol/L phenylephrine ('ED80) and subsequently treated
with ACh. Figure 1A depicts a typical tracing obtained from
WT and PLB-KO mouse aorta in response to cumulative
additions of ACh. Concentration-relaxation relationships indicated that the PLB-KO aortas were less responsive, particularly at lower concentrations of ACh, than the WT controls
(Figure 1B). Additionally, the EC50 values were significantly
greater in PLB-KO than WT aortas (4716140 versus
130637 nmol/L, n57; P,0.05).
Figure 2. Effects of PLB gene ablation on relaxation to the NO
donor SNP in WT (circles) and PLB-KO (squares) mouse aortas.
Endothelium-intact (solid lines) and denuded (broken lines) aortas were isometrically mounted, contracted with PE (3 mmol/L),
and their capacity to relax to the endothelium-independent
vasorelaxant SNP assessed. PLB gene ablation did not affect
the capacity of the smooth muscle to relax to NO. Results are
presented as the mean6SEM of 7 paired WT and KO aortas.
assessed the effects of forskolin, an adenylate cyclase activator, on relaxation in endothelium-intact and denuded aortas.
Concentration-dependent relaxation to forskolin was observed in both endothelium-intact and denuded aortas from
WT and PLB-KO mice. Evaluation of the forskolin
concentration-response curves (Figure 3) revealed that WT
aortas with an intact endothelium were significantly more
sensitive than their denuded counterparts (ED50531.063.3
versus 89.967.7 nmol/L, respectively, n57; P,0.01). Importantly, endothelium-intact aortas from PLB-KO showed a
much smaller increase in sensitivity (ED50549.064.8 and
74.9611.5 nmol/L in endothelium intact and denuded aortas,
SNP-Mediated Relaxation
Consistent with our previous report, endothelium-dependent
relaxation to ACh was abolished by pretreatment with Nvnitro-L-arginine (0.2 mmol/L, n53; data not shown), suggesting that NO is the primary mediator of ACh relaxation.9 To
determine if the differences in ACh-mediated relaxation were
attributable to differential responses of the vascular smooth
muscle to NO, concentration-relaxation relations to the NO
donor SNP were generated (Figure 2). SNP-mediated relaxation was unaffected by PLB gene ablation, indicating that
the differences obtained with ACh were due to the endothelium. Interestingly, the endothelium-intact preparations were
less sensitive to SNP than denuded aortas, although no
differences between WT and PLB-KO aortas were observed.
Forskolin-Mediated Relaxation
The A-kinase pathway has been implicated in modulation of
endothelium-dependent relaxation.10 –12 Because PLB is a
major effector of the A-kinase pathway in the heart,6,13 we
Figure 3. Relaxation to forskolin in WT (circles) and PLB-KO
(squares) mouse aortas. Endothelium-intact (solid lines) and
denuded (broken lines) mouse aortas were isometrically
mounted, contracted with phenylephrine (3 mmol/L), and
exposed to increasing concentrations of forskolin. Forskolin
concentration-relaxation curves revealed that the WT aortas with
an intact endothelium were significantly more sensitive to
forskolin-mediated relaxation than their denuded counterparts.
Endothelium-intact aortas from PLB-KO mice did not show this
increased sensitivity. Results are presented as the mean6SEM
of 7 paired WT and KO aortas.
Sutliff et al
Downloaded from http://circres.ahajournals.org/ by guest on August 11, 2017
Figure 4. Detection of PLB in endothelial cells. A, RT-PCR analysis of isolated mouse aortic endothelial cells (MAECs) and vascular smooth muscle cells (VSMCs) revealed the presence of
PLB in both cell types. Two independent preparations were
used for RT-PCR analysis. a-actin transcripts were detected in
only VSMCs, indicating that MAECs were devoid of vascular
smooth muscle contamination. B, Western blot analysis confirmed the presence of PLB in MAECs and A10 smooth muscle
cells. 3T3 fibroblasts and heart homogenates were loaded as
negative and positive controls, respectively.
respectively, n57; P.0.05). Thus, the differences in forskolin relaxation are mediated by the endothelium and depend on
the presence or absence of PLB.
Evidence for the Presence of PLB in
the Endothelium
Taken together, these observations provide functional evidence for PLB in the endothelium. Therefore, we directly
tested for the presence of PLB in endothelial cells using both
fresh isolates and primary cell cultures. Figure 4 demonstrates
the presence of PLB by both RT-PCR and Western blot
analyses. RT-PCR analyses of freshly isolated aortic endothelial cells and cells from the remaining aortic media
demonstrated the presence of PLB mRNA in both the
endothelium and vascular smooth muscle. In parallel control
experiments, a-actin transcripts were detected only in vascular smooth muscle and not in endothelial cells. This indicates
that there was no significant smooth muscle contamination of
the endothelial cell preparations (Figure 4A). Furthermore,
Western blot analysis of cultured mouse aortic endothelial
cells confirmed the presence of PLB in the endothelium
(Figure 4B).
Discussion
The present study establishes for the first time that PLB is
present in the endothelium and modulates endotheliumdependent relaxation of mouse aorta. The importance of PLB
in cardiovascular function in vivo has been further elucidated
through the generation of PLB gene-manipulated mouse
models.6,14 –17 PLB, by virtue of its regulatory actions on
SERCA, modulates Ca21 in the heart and underlies inotropic
responses to b-adrenoceptor stimulation.6,16 PLB in the vas-
February 19, 1999
363
cular smooth muscle is also an important determinant of
steady-state Ca21 and isometric force.8,18 However, there is
little known about the effects of PLB in nonmuscle tissue,
because it has only been reported to be present in cardiac,
slow skeletal, and smooth muscles. Our present data clearly
show that not only is PLB present in the endothelium, but it
can also modulate cardiovascular function through endothelium-mediated relaxation. Thus, PLB is important not only in
muscle tissue, as previously held, but also can regulate the
endothelium, a nonmuscle tissue.
Phosphorylation of PLB via the protein kinase A pathway
is an important regulator of [Ca21]i in cardiac muscle.6,13 The
A-kinase pathway has also been implicated in an endothelium-dependent component of b-adrenoceptor relaxation of
vascular tissues.10 –12 Consistent with this observation, we
also measured a significant increase in sensitivity to forskolin
in endothelium-intact aortas from WT mice. Importantly, this
difference in forskolin-mediated relaxation between endothelium-intact and denuded vessels was blunted in aortas from
PLB-KO mice. This suggests that PLB gene ablation results
in a loss of endothelium-dependent A-kinase vasorelaxation.
Our hypothesis is that unphosphorylated PLB is associated
with inhibition of Ca21 uptake into the endoplasmic reticulum, resulting in higher [Ca21]i and increased activation of
endothelial NO synthase. Phosphorylation or ablation of PLB
increases endoplasmic reticulum Ca21 uptake, leading to a
lower [Ca21]i and reduced endothelium-dependent relaxation.
Therefore, PLB influences endothelium-dependent relaxation
by modulating Ca21 availability for activation of endothelial
NO synthase.
These results are particularly interesting when considered
along with recent results demonstrating reduced endothelium-dependent relaxation in mice deficient in sarco(endo)plasmic reticulum Ca21-ATPase isoform 3 (SERCA3).9 Previously, we concluded that the SERCA3 isoform is an
important determinant of ACh-releasable Ca21 stores. Our
results showed that deletion of PLB, a protein associated with
inhibition of Ca21 sequestration, can also reduce endothelium-dependent relaxation. In this case, we hypothesized that
this reduction was attributable to enhanced endoplasmic
reticulum Ca21 uptake leading to lower [Ca21]i. Therefore, the
interplay between Ca21 release and uptake systems is an
important determinant of endothelial steady-state Ca21 levels
that elicits endothelium-dependent relaxation.
In summary, our present results clearly demonstrate that
PLB is present in the endothelium and can modulate vascular
contractility. Importantly, endothelial PLB plays a dominant
role in the endothelium-dependent component of A-kinase–
mediated relaxation. Therefore, PLB may play more important roles in cardiovascular regulation as well as in Ca21
homeostasis in nonmuscle tissues than previously thought.
Acknowledgments
This study was supported by HL-09781 (to R.L.S.); HL-54829 (to
R.J.P.); and HL-26057 and P40RR12358 (to E.G.K.). The authors
are grateful to Craig Weber for excellent technical assistance.
References
1. Newby AC, Henderson AH. Stimulus-secretion coupling in vascular
endothelial cells. Annu Rev Physiol. 1990;52:661– 674.
364
Phospholamban and Endothelium Function
Downloaded from http://circres.ahajournals.org/ by guest on August 11, 2017
2. Schilling WP, Cabello OA, Rajan L. Depletion of the inositol 1,4,5trisphosphate-sensitive intracellular Ca21 store in vascular endothelial
cells activates the agonist-/sensitive Ca(21)-influx pathway. Biochem J.
1992;284:521–530.
3. Colden-Stanfield M, Schilling WP, Ritchie AK, Eskin SG, Navarro LT,
Kunze DL. Bradykinin-induced increases in cytosolic calcium and ionic
currents in cultured bovine aortic endothelial cells. Circ Res. 1987;61:
632– 640.
4. Sasajima H, Wang X, van Breemen C. Fractional Ca21 release from the
endoplasmic reticulum activates Ca21 entry in freshly isolated rabbit aortic
endothelial cells. Biochem Biophys Res Commun. 1997;241:471–475.
5. Kadambi VJ, Kranias EG. Phospholamban: a protein coming of age.
Biochem Biophys Res Commun. 1997;239:1–5.
6. Luo W, Grupp IL, Harrer J, Ponniah S, Grupp G, Duffy JJ, Doetschman
T, Kranias EG. Targeted ablation of the phospholamban gene is associated with markedly enhanced myocardial contractility and loss of betaagonist stimulation. Circ Res. 1994;75:401– 409.
7. Slack JP, Grupp IL, Luo W, Kranias EG. Phospholamban ablation
enhances relaxation in the murine soleus. Am J Physiol. 1997;273:C1–C6.
8. Lalli J, Harrer JM, Luo W, Kranias EG, Paul RJ. Targeted ablation of the
phospholamban gene is associated with a marked decrease in sensitivity
in aortic smooth muscle. Circ Res. 1997;80:506 –513.
9. Liu LH, Paul RJ, Sutliff RL, Miller ML, Lorenz JN, Pun RY, Duffy JJ,
Doetschman T, Kimura Y, MacLennan DH, Hoying JB, Shull GE.
Defective endothelium-dependent relaxation of vascular smooth muscle
and endothelial cell Ca21 signaling in mice lacking sarco(endo)plasmic
reticulum Ca21-ATPase isoform 3. J Biol Chem. 1997;272:30538 –30545.
10. Kamata K, Miyata N, Kasuya Y. Involvement of endothelial cells in
relaxation and contraction responses of the aorta to isoproterenol in naive
11.
12.
13.
14.
15.
16.
17.
18.
and streptozotocin-induced diabetic rats. J Pharmacol Exp Ther. 1989;
249:890 – 894.
Graves J, Poston L. b-Adrenoceptor agonist mediated relaxation of rat
isolated resistance arteries: a role for the endothelium and nitric oxide.
Br J Pharmacol. 1993;108:631– 637.
Gray DW, Marshall I. Novel signal transduction pathway mediating
endothelium-dependent b-adrenoceptor vasorelaxation in rat thoracic
aorta. Br J Pharmacol. 1992;107:684 – 690.
Tada M, Kirchberger MA, Katz AM. Phosphorylation of a 22,000-dalton
component of the cardiac sarcoplasmic reticulum by adenosine 39:59monophosphate-dependent protein kinase. J Biol Chem. 1975;250:
2640 –2647.
Lorenz JN, Kranias EG. Regulatory effects of phospholamban on cardiac
function in intact mice. Am J Physiol. 1997;273:H2826 –H2831.
Luo W, Wolska BM, Grupp IL, Harrer JM, Haghighi K, Ferguson DG,
Slack JP, Grupp G, Doetschman T, Solaro RJ, Kranias EG. Phospholamban gene dosage effects in the mammalian heart. Circ Res. 1996;78:
839 – 847.
Kadambi VJ, Ponniah S, Harrer JM, Hoit BD, Dorn GW 2nd, Walsh RA,
Kranias EG. Cardiac-specific overexpression of phospholamban alters
calcium kinetics and resultant cardiomyocyte mechanics in transgenic
mice. J Clin Invest. 1996;97:533–539.
Santana LF, Kranias EG, Lederer WJ. Calcium sparks and excitationcontraction coupling in phospholamban-deficient mouse ventricular
myocytes. J Physiol (Lond). 1997;503:21–29.
Paul RJ. The role of phospholamban and SERCA3 in regulation of
smooth muscle-endothelial cell signalling mechanisms: evidence from
gene-ablated mice. Acta Physiol Scand. 1998;164:589 –597.
Phospholamban Is Present in Endothelial Cells and Modulates Endothelium-Dependent
Relaxation: Evidence From Phospholamban Gene-Ablated Mice
Roy L. Sutliff, James B. Hoying, Vivek J. Kadambi, Evangelia G. Kranias and Richard J. Paul
Downloaded from http://circres.ahajournals.org/ by guest on August 11, 2017
Circ Res. 1999;84:360-364
doi: 10.1161/01.RES.84.3.360
Circulation Research is published by the American Heart Association, 7272 Greenville Avenue, Dallas, TX 75231
Copyright © 1999 American Heart Association, Inc. All rights reserved.
Print ISSN: 0009-7330. Online ISSN: 1524-4571
The online version of this article, along with updated information and services, is located on the
World Wide Web at:
http://circres.ahajournals.org/content/84/3/360
Permissions: Requests for permissions to reproduce figures, tables, or portions of articles originally published
in Circulation Research can be obtained via RightsLink, a service of the Copyright Clearance Center, not the
Editorial Office. Once the online version of the published article for which permission is being requested is
located, click Request Permissions in the middle column of the Web page under Services. Further information
about this process is available in the Permissions and Rights Question and Answer document.
Reprints: Information about reprints can be found online at:
http://www.lww.com/reprints
Subscriptions: Information about subscribing to Circulation Research is online at:
http://circres.ahajournals.org//subscriptions/