Download Insulin-like growth factor binding protein-2 (IGFBP

Fish Physiol Biochem (2013) 39:1541–1554
DOI 10.1007/s10695-013-9807-5
Insulin-like growth factor binding protein-2 (IGFBP-2)
in Japanese flounder, Paralichthys olivaceus: molecular
cloning, expression patterns and hormonal regulation
during metamorphosis
Yuntong Zhang • Junling Zhang • Zhiyi Shi
Wanying Zhai • Xiaozhu Wang
•
Received: 14 October 2012 / Accepted: 17 May 2013 / Published online: 22 August 2013
Ó Springer Science+Business Media Dordrecht 2013
Abstract In this study, we cloned and characterized
cDNA sequences of two insulin-like growth factor
binding protein-2 (IGFBP-2a and IGFBP-2b) from
Japanese flounder, Paralichthys olivaceus. The fulllength cDNA of IGFBP-2a is 1,046 bp long and
consists an open frame (ORF) of 876 bp, a 50 untranslated region (UTR) of 125 bp and a 30 -UTR
of 45 bp. IGFBP-2b is 1,067 bp, including a 50 -UTR
of 53 bp, a 30 -UTR of 198 bp and an ORF of 816 bp.
Real-time quantitative PCR results revealed that
IGFBP-2a -2b mRNA was expressed in all detected
tissues. Interestingly, the levels of IGFBP-2a mRNA
in all detected tissues were higher in female than male,
but IGFBP-2b was precisely the opposite. At different
embryonic stages, the levels of IGFBP-2a mRNA
were typically higher than IGFBP-2b. After hatching,
IGFBP-2a mRNA was gradually decreased to a
relatively lower level. However, the expression of
IGFBP-2b mRNA was increased after hatching,
including 3, 7, 10, 14, 17, 20 and 23 days posthatching (dph), and it presents a higher level until 29
(metamorphic climax), 36 (post-climax) and 41 dph
Yuntong Zhang and Junling Zhang have contributed equally to
this work.
Y. Zhang J. Zhang Z. Shi (&) W. Zhai X. Wang
Key Laboratory of Freshwater Aquatic Genetic
Resources, Ministry of Agriculture, Shanghai Ocean
University, Shanghai 201306, People’s Republic of China
e-mail: [email protected]
(the end of metamorphosis). In levothyroxine sodium
salt (T4, the main form of thyroid hormone in
animals)-treated and thiourea (TU)-treated larvae,
the expressions of IGFBP-2a had not visibly changed,
except in T4-treated 17 dph larvae. The expressions of
IGFBP-2b mRNA were distinctly increased from 17 to
23 dph, but suddenly dropped to a lower level in and
after 29 dph. However, the levels of IGFBP-2b mRNA
during metamorphosis were greatly down-regulated
after TU treatment. These results provided basic
information for further studies on the role of IGF
system in flatfish development and metamorphosis.
Keywords Cloning Gene expression IGFBP-2 Paralichthys olivaceus Thyroid
hormone
Introduction
The insulin-like growth factor (IGF) system plays a pivotal
role in vertebrate growth, development, proliferation and
metabolic regulation. The IGF system is comprised of
IGFs (IGF-I and IGF-II), the binding proteins (IGFBP-1 to
-6) and the cell surface receptors (IGF-IR and IGF-IIR).
Most circulating IGFs are bound to specific high affinity
IGFBPs that protect them from degradation and modulate
their actions (Duan and Clemmons 1998; Jones and
Clemmons 1995; Rajaram et al. 1997).
In vertebrates, six IGFBPs have been cloned and
characterized (Duan and Xu 2005; Hwa et al. 1999;
123
1542
Jones and Clemmons 1995). Although the overall
structure is conserved and related with high degree to
each other, each IGFBP has unique properties and
performs the functions of potentiating or inhibition of
the biological activities of IGFs (Schneider et al.
2002). Among the six IGFBPs, IGFBP-2 is the second
most abundant form in serum (Clemmons 1997).
Recently, they only cloned one transcript of IGFBP-2
in chicken (Schoen et al. 1995), rat (Margot et al.
1989), rainbow trout (Oncorhynchus mykiss) (Kamangar et al. 2006), red seabream (Pagus major) (Funkenstein et al. 2002), goby (Gillichthys mirabilis)
(Gracey et al. 2001), and yellowtail (Seriola quinqueradiata) (Pedroso et al. 2009). However, two subtypes of IGFBP-2s have been identified in many
species, such as common carp (Cyprinus carpio)
(Chen et al. 2009), zebrafish (Danio rerio) (Duan et al.
1999; Zhou et al. 2008), O. Latipes, E. coioides,
S. aurata, F. obscurus and T. nigroviridis. Further
studies reported that two zebrafish IGFBP-2s mRNA
were expressed in liver, gonad, brain and many other
tissues (Duan et al. 1999; Funkenstein et al. 2002;
Kamangar et al. 2006), which suggest it has autocrine/
paracrine actions on regulating IGFs. However,
IGFBP-2a was only found in liver and brain; IGFBP2b was detected in liver, intestine, kidney, ovary and
muscle of female zebrafish, but only in liver of male
zebrafish. In addition, the expressions of two IGFBP2s demonstrated different patterns in zebrafish embryonic and larval stages. These results suggest that two
IGFBP-2s may have different physiological functions
on growth and development of fish. While, analyzing
the differential expression of two IGFBP-2s in staged
embryos and larval, and tissues of adult fish are very
conducive to illustrate the physiological significance
of fish growth and development.
The Japanese flounder (Paralichthys olivaceus) is
an important marine economic flatfish in aquaculture.
It undergoes a dramatic metamorphosis during larval
development by changing its body form from a
symmetrical bilateral pelagic larva to an asymmetrical
benthic juvenile. This biological process is principally
controlled by thyroid hormone (TH). Recently, it has
been revealed that the IGF system could be important
for metamorphic success in Atlantic halibut (Hippoglossus hippoglossus) (Hildahl et al. 2007a, b, 2008)
and Japanese flounder (P. olivaceus) (Zhang et al.
2011a, c). Recent IGFBP-2 mRNA was reduced by
growth hormone (GH) but increased by fasting in
123
Fish Physiol Biochem (2013) 39:1541–1554
zebrafish (Duan et al. 1999); 17b-estradiol could
inhibit IGFBP-2 mRNA expression in orange-spotted
ovary (Chen et al. 2010); IGFBP-2 mRNA was
reduced by GH but increased by insulin in common
carp (Chen et al. 2009). In hypothyroid mammals, TH
treatment slightly increases IGFBP-2 mRNA expression (Clemmons 1997). We have demonstrated that
TH affects the expression of IGF-I mRNA (Zhang
et al. 2011a) and IGFBP-1 mRNA (Zhai et al. 2012) in
P. olivaceus. But the relationship between IGFBP-2
and thyroid hormone has not been reported, and the
molecular mechanism of IGFs system modulates
flatfish metamorphosis is unknown. To understand
the function of IGFBP-2 in the growth, development
and metamorphosis of flatfish, we cloned and characterized the full-length cDNA of two P. olivaceus
IGFBP-2 subtypes, examined their expression patterns
during embryonic and larval development and in adult
tissues and also investigated the effects of TH and
thiourea (TU) on the levels of IGFBP-2 mRNA during
metamorphosis, thus helps further illustrate the functional role of IGF system in flatfish development.
Materials and methods
Animals and sample collection
Embryos, larvae and adult fish of P. olivaceus were
obtained from Beidaihe Central Experimental Station
(BCES), Chinese Academy of Fishery Sciences
(CAFS), Hebei, China. All the embryos and fishes
were maintained in circular culture tanks supplied
with seawater at 16 ± 2 °C.
Adult fish at same period were separated into two
groups (n = 3) based on gender. Tissues containing
heart, liver, spleen, stomach, kidney, brain, gill,
gonad, muscle and intestine were promptly dissected,
frozen in liquid nitrogen and stored at -80 °C until
RNA extraction.
Embryos and larvae were maintained under intensive-culture conditions in 300 L tanks. They (n = 3
pools, 15–30 specimens/pool) were periodically collected at 0, 0.5 h post-fertilization (hpf, fertilized egg),
9 hpf (blastocyst stage), 26 hpf (gastrula stage),
42.5 hpf (neurula stage), 48 hpf (blastopore-closing
stage), 71 hpf (heart-beating stage), 75 hpf (prehatching stage), 78.5 hpf (hatching stage) and 3 days
post-hatching (dph), 10, 14, 17, 20, 23, 29, 36 and
Fish Physiol Biochem (2013) 39:1541–1554
41 dph, respectively. The metamorphic stages of P.
olivaceus were defined as Pre-metamorphosis, the
stage prior to the start of eye migration (Stage D); the
right eye just start to migrate (Stage E); Pro-metamorphosis, the right eye moved toward the dorsal
margin, but still could not be seen from the left/ocular
side (Stage F); Climax metamorphosis, the right eye
became visible from the ocular side (Stage G); Postmetamorphosis, the right eye located on the dorsal
margin (Stage H); both eyes were completely located
on the left side of the head (Stage I) (Minami 1982;
Miwa and Inui 1987; Miwa et al. 1988). According to
this definition, larvae of 17, 20, 23, 29, 36 and 41 dph
represented stage D, stage E, stage F, stage G, stage H
and stage I, respectively. All the samples were frozen
in liquid nitrogen immediately and stored at -80 °C
until RNA extraction.
To explain the effect of TH, larvae were sampled at
15 dph and divided into three groups (5,000 fish per
group) (Inui and Miwa 1985). The three groups were
reared in seawater containing either 0.1 mg/L concentration of T4 (the main form of TH in animals),
30 mg/L of TU, or none, with daily water exchange of
one-third, keeping T4 and TU concentrations constant.
We collected the larvae of each group after 2, 5, 8, 14,
21 and 26, respectively, and rapidly frozen in liquid
nitrogen and stored at -80 °C until RNA extraction.
All animal protocols have obtained the consent of
the Review Committee for the Use of Animal Subjects
of Shanghai Ocean University, Shanghai, China.
1543
manufacturers’ instructions. According to the IGFBP-2s
cDNA sequences of P. olivaceus transcriptome, two
pairs of primers (IGFBP-2a-f, IGFBP-2a-r and IGFBP2b-f, IGFBP-2b-r) were designed in non-conservative
region for cloning and verifying the partial fragment of
P. olivaceus IGFBP-2. In PCR amplification, 1 lL
cDNA template, 2 lL of 109 Ex Taq buffer, 1.6 lL of
dNTP (2.5 mM of each), 1 lL of the forward and
reverse primers (10 lM), and 2.5 U of Ex TaqÒ DNA
polymerase (TaKaRa, Japan) were combined and added
up H2O to a total volume of 20 lL. After 4 min initial
denaturation at 94 °C was carried out, 35 cycles of
amplification were performed using a cycle profile of
94 °C for 30 s, a primer-dependent annealing temperature (Table 1) for 30 s, 72 °C for 30 s. Based on the
two IGFBP-2s partial fragment sequences, four pairs of
gene-specific primers were designed, respectively, for
30 -end and 50 -end cloning. Both 30 -end and 50 -end were
amplified by two round PCR using the 30 and 50 -Full
RACE Kit (TaKaRa, Japan). All the primers used were
listed in Table 1.
Amplification products were separated by agarose
gel electrophoresis. The aimed PCR products were
excised, and purified using a Gel Extraction Kit
(Tiangen, China) and then ligated into pMDÒ19-T
Vector (TaKaRa, Japan). The ligated products were
transformed into Escherichia coli strain DH5a competent cells. Positive colonies were selected by color
screening on LB plates containing X-gal and Amp.
Five of the positive clones were sequenced on an ABI
PRISM 3730 Automated Sequencer (ABI, USA).
RNA extraction
Total RNA from adult tissues, staged embryos, larvae
and treated larvae was extracted by TrizolÒ Reagent
(Invitrogen, USA) and treated with DNaseI (5 U/lL)
(TaKaRa, Japan) for 1 h. The quality and integrity of
RNAs were examined by agarose gel electrophoresis
and spectrophotometer NANODROP 2000C (Thermo,
USA). The samples with values of A260/A280 ratio
ranged from 1.8 to 2.1 can be used in reverse transcription reactions.
Cloning of IGFBP-2 cDNA
Total RNA (2 lg) from liver of P. olivaceus, which
treated with DNaseI (5 U/lL) (TaKaRa, Japan) for 1 h
was reverse-transcribed using PrimeScriptTM 1st Strand
cDNA Synthesis kit (TaKaRa, Japan), following the
Sequence analysis
The fragments were assembled together by DNAMAN
software. The potential open-reading frame was analyzed using ORF Finder (http://www.ncbi.nlm.nih.gov/
gorf/gorf.html/). The cDNA sequences and the derived
amino acid sequences were compared with the
sequences in the GenBank database using BLAST
program available for the NCBI website (http://www.
ncbi.nlm.nih.gov/guide/). Alignment of amino acid
sequences was achieved using DNAstar and CLUSTALW 1.8 program. The phylogenetic tree was constructed using MEGA 4.1 with Neighbor-Joining
method (bootstrap 1000). The possible signal peptide
was predicted by signal 4.0 Server (http://www.cbs.dtu.
dk/services/SignalP/).
123
1544
Table 1 Nucleotide
sequences of the primers
used for partial fragment,
30 -RACE, 50 -RACE and
real-time quantitative PCR
of P. olivaceus IGFBP-2s
cDNA
Fish Physiol Biochem (2013) 39:1541–1554
Primers
Sequences
Tm (°C)
Annealing
temp (°C)
Primers for partial fragment
IGFBP-2a-f
CGAGATGTGCGGCGTGTA
59.2
59.0
IGFBP-2a-r
IGFBP-2b-f
GGGATGATGGGATAGGTCGG
TTCCGATGTCCAAGTTGTAC
61.2
51.4
51.0
IGFBP-2b-r
CCACTTTTTG TCCACATC
45.0
Primers for 30 -RACE PCR
30 RACE outer primer
TACCGTCGTTCCACTAGTGATTT
60.8
–
30 RACE inner primer
CGCGGATCCTCCACTAGTGAT
TTCACTATAGG
79.8
–
30 -IGFBP-2a
CATATCCCCAACTGTGACAAGAG
58.8
56.0
30 -IGFBP-2a-nest
GGCAGTATAACCTCAAACAGTGCA
54.9
54.0
3 -IGFBP-2b
GTGCGGGGTCTATACACCGAGGT
66.2
62.0
30 -IGFBP-2b-nest
CACAGGGGCTGAATTACCTTTGC
64.9
61.0
0
Primers for 50 -RACE PCR
50 RACE outer primer
CATGGCTACATGCTGACAGCCTA
61.8
–
50 RACE inner primer
CGCGGATCCACAGCCTACTGAT
GATCAGTCGATG
84.7
–
50 -IGFBP-2a
CTGCACCAGTTGCTTCAGGGGAA
68.2
63.0
50 -IGFBP-2a-nest
GTTGCTTCAGGGGAAGCTCCGAG
68.3
63.0
50 -IGFBP-2b
CTAAACCCTGGATGAGCTGCTGC
65.2
61.0
50 -IGFBP-2b-nest
CCTCGGTGTATAGACCCCGCACAG
68.7
64.0
60.0
Primers for real-time quantitative PCR
f forward primer, r reverse
primer
qIGFBP-2a-f
TCTAAGATGCCCTTCAGAGATAAC
62.8
qIGFBP-2a-r
GGGATGATGGGATAGGTCGG
66.2
qIGFBP-2b-f
GTCCAGATACCGACGACGCCTAA
66.4
qIGFBP-2b-r
ATCCTGACAGAGTTTTGAAGA
54.5
b-actin-f
GGAAATCGTGCGTGACATTAAG
62.4
b-actin-r
CCTCTGGACAACGGAACCTCT
61.2
Real-time quantitative PCR
Total RNA (500 ng) from each sample was reversetranscribed using PrimeScriptTM RT reagent Kit (TaKaRa, Japan), according to the manufacturer’s instructions. Lack of genomic DNA contamination was
confirmed by PCR amplification of RNA samples in
the absence of cDNA synthesis. A 10 lL of each
reverse-transcribed product was mixed with 90 lL
sterile distilled water. This diluted cDNA was used as
the template of each real-time quantitative PCR. The
primers were designed using the Oligo 6.0 software and
examined by electrophoresis on agarose gel, and PCR
conditions were optimized by preliminary test to avoid
from dimer formation and unspecific amplifications.
123
60.0
60.0
Real-time quantitative PCR was carried out on the
CFX-96 (Bio-Rad). The 20 lL real-time PCR reactions
contained 2 lL cDNA template, 0.2 lL of each of the
gene-specific forward and reverse primers (qIGFBP-2af, qIGFBP-2a-r or qIGFBP-2b-f, qIGFBP-2b-r, 10 lM)
and 10 lL of 2 9 iQTM SYBRGreen Supermix (BioRad). The PCR amplification procedure was used as
follows: initial denaturation for 4 min at 95 °C,
followed by 40 cycles of 95 °C for 10 s, 60 °C for
30 s. A melting curve was collected using two
additional cycles by reading the fluorescence value
from 65 °C to 95 °C, in order to assess the specificity of
the PCR amplification. Negative controls contained
non-template controls (NTC), and interplate calibrator
(IPC) were performed. For normalization of the gene
Fish Physiol Biochem (2013) 39:1541–1554
expression data, all samples were run in parallel with
the internal control gene b-actin (primers: b-actin-f,
b-actin-r). Each assay was repeated in triplicate. To
estimate amplification efficiencies, a standard curve
was generated for each gene based on fivefold serial
dilutions of quantified larvae cDNA. All calibration
curves exhibited correlation coefficients higher than
0.99, and the corresponding efficiencies (E) of PCR
were from 0.95 to 0.99. Relative mRNA expressions for
two IGFBP-2s gene were determined using the 2-DDCT
method (Livak and Schmittgen 2001).
Statistical analysis
Quantitative data were expressed as mean ± Standard
Error (SE) (n = 3). Comparisons among different
stages and adult tissues were estimated by general
linear model (GLM) method. A probability level of
0.05 or 0.01 was used to indicate significance. All
statistics were performed using SPSS1 7.0 and SAS.
Results
Cloning and sequence analysis of P. olivaceus
IGFBP-2 cDNA
Using general-PCR and 30 - and 50 -RACE methods, we
cloned and characterized two IGFBP-2 subtypes
cDNA in P. olivaceus, and submitted them to Genbank
(IGFBP-2a: KC914560; IGFBP-2b: KC914561).
IGFBP-2a
Paralichthys olivaceus IGFBP-2a full-length cDNA
was cloned from the liver of adult P. olivaceus. The
complete cDNA is 1,046 bp long and consists an
open-reading frame (ORF) of 876 bp, encoding a
predicted polypeptide of 291 amino acid residues with
a putative signal peptide of 31 amino acids, a 125 bp
50 -untranslated region (UTR), and a 45 bp 30 -UTR.
Like other vertebrate IGFBPs, the mature P. olivaceus IGFBP-2a has two highly conserved cysteine-rich
domains: 12 cysteine residues in N-terminal and 6
cysteine residues in C-terminal. Typical IGFBPs motif
(GCGCCXXC) was existed within the N-terminal
domain of the peptide. And the characteristic Arg–
Gly–Asp (RGD) sequence was observed at the C-terminal domain of P. olivaceus IGFBP-2a, which was
1545
practically present in all IGFBP-2s. The homology
analysis based on the deduced amino acid sequences
revealed that the predicted P. olivaceus IGFBP-2
exhibited significant identities to other vertebrates (see
attached Fig. 1).
The homology analysis based on the deduced amino
acid sequences revealed that the predicted P. olivaceus
IGFBP-2a exhibited significant identities to other
vertebrates (Fig. 1). P. olivaceus IGFBP-2a protein
displayed the highest homology of 73.8 % to S. salar
IGFBP-2a, while it had lower identities to O. tshawytscha IGFBP-2a (72.5 %), O. mykiss (72.4 %), C. carpio
(68.7 %), D. rerio IGFBP-2a (66.3 %), E. coioides
(52.5 %), M. undulatus (50.5 %), S. quinqueradiata
(50.1 %), D. labrax (48.9 %), S. maximus (48.6 %),
G. gallus (44.3 %), M. musculus (44.0 %), O. aries
(43.0 %), H. sapiens (42.7 %), respectively.
IGFBP-2b
Similarly, P. olivaceus IGFBP-2b full-length cDNA
was obtained from liver of adult P. olivaceus. Its fulllength cDNA sequence is 1,067 bp long containing a
53 bp 50 -UTR, a 198 bp 30 -UTR and an open-reading
frame of 816 bp, which encodes a predicted polypeptide of 271 amino acid residues with a putative signal
peptide of 25 amino acids.
Analogously, the mature P. olivaceus IGFBP-2b
has two highly conserved cysteine-rich domains,
respectively, are 12 cysteine residues in N-terminal
and 6 cysteine residues in C-terminal, a typical
IGFBPs motif (GCGCCXXC) existed within the
N-terminal domain and the RGD sequence observed
at the C-terminal domain.
While, after the homology analysis, results display
that P. olivaceus IGFBP-2b protein had identities to
S. maximus (85.6 %), S. quinqueradiata (84.8 %),
E. coiodes (84.1 %), D. labrax (81.1 %), M. undulatus
(76.4 %), D. rerio IGFBP-2b (57.3 %), S. alpinus
IGFBP-2b (56.3 %), O. tshawytscha IGFBP-2b
(56.3 %), O. mykiss (55.2 %), C. carpio (54.2 %),
G. gallus (39.8 %), M. musculus (37.6 %), O. aries
(37.1 %) and H. sapiens (36.9 %), respectively.
A phylogenetic tree of vertebrate IGFBPs was
constructed to ascertain relationship of P. olivaceus
IGFBP-2s and other vertebrate IGFBPs (see attached
Fig. 2). The results indicate that P. olivaceus IGFBP2a is clustered with S. salar, O. mykiss, and
123
1546
123
Fish Physiol Biochem (2013) 39:1541–1554
Fish Physiol Biochem (2013) 39:1541–1554
b Fig. 1 Alignment of amino acid sequences of P. olivaceus
IGFBP-2s and other species IGFBP-2s. The identical, highly
and less conserved amino acid residues are indicated by different
colors, respectively. (Color figure online)
O. tshawytscha, while P. olivaceus IGFBP-2b is
located in the same group with P. adspersus IGFBP-2.
Differential expression of IGFBP-2 mRNAs
in adult tissues
The expression patterns of IGFBP-2 mRNAs in different tissues of both female and male adult P. olivaceus
were examined by real-time quantitative PCR (Fig. 3).
Both IGFBP-2 mRNAs were expressed in heart, liver,
spleen, stomach, kidney, brain, gill, gonad, muscle and
intestine, but the expression levels of IGFBP-2b in those
detected tissues was relatively higher than IGFBP-2a,
and largest gap distinctly displayed in liver. Interestingly, the levels of IGFBP-2a mRNA were higher in
female than male, and yet, IGFBP-2b was just opposite,
its levels in male were higher than in female (Fig. 3).
Expression of IGFBP-2 mRNAs during embryonic
and larval development
The temporal expression of IGFBP-2 mRNA during early
development was analyzed by real-time quantitative PCR.
And the results were presented in Fig. 4. Two IGFBP-2
mRNAs were observed in all detected stages; but the
transcripts of IGFBP-2b keep in a quite low level at
embryonic stages, yet IGFBP-2a was higher. The levels of
IGFBP-2a mRNA reached the peak at blastopore-closing
stage and then began to decrease until the end of
metamorphosis. The level of IGFBP-2 mRNA significantly increased at 3 dph, but it drop to a lower level at
7 dph. IGFBP-2 mRNA had a sharply increase in 10 dph,
and gradually decreased and got to a nearly identical level
with 7 dph at 23 dph, and it got to a higher level at 29 dph
when the larvae were just at metamorphic climax, and
slightly decreased at 36 dph, then, sharply increased to the
highest level at the end of metamorphosis.
Effect of thyroid hormone on the expression
of IGFBP-2 mRNAs during metamorphosis
In order to study the relationship between TH and the
expression levels of IGFBP-2 mRNAs, larvae at
15 dph were treated by exogenous TH (0.1 mg/L)
and TU (30 mg/L), respectively, and the levels of
1547
IGFBP-2 mRNAs were determined at 2, 5, 8, 14, 21 and
26 days after TH and TU treatment (Fig. 5). In THtreated larvae, IGFBP-2b mRNA showed dramatically
increase from 17 to 23 dph, but suddenly drop to a
lower level in and after 36 dph, compared with the
same stage of untreated group. The levels of IGFBP-2b
mRNA were visibly down-regulated in TU-treated
larvae, especially at 29, 36 and 41 dph. Generally,
IGFBP-2b mRNA exhibited higher expression levels
from metamorphic climax to the completion of metamorphosis than in embryonic and early larval stages.
Conversely, TH and TU have little effect on the levels
of IGFBP-2a in metamorphic stages, except 17 dph.
Discussion
In this study, the full-length cDNAs of two IGFBP-2
genes from P. olivaceus were cloned and characterized.
The deduced amino acid sequences of IGFBP-2a and
IGFBP-2b, respectively, are 42.7–73.8 and 36.9–85.6 %
homologous to the IGFBP-2s of mammal and other
teleosts. Like other vertebrate IGFBPs, two P. olivaceus
IGFBP-2s also have a cysteine-rich N- and cysteine-rich
C-terminal domain. The two cysteine-rich domains,
highly conserved among species, can specifically bind
IGFs (Forbes et al. 1998; Hobba et al. 1998; Hwa et al.
1999). A typical IGFBP motif (GCGCCXXC) was
existed in the N-domain of the P. olivaceus IGFBP-2s,
which are necessary to IGFs binding (Kim et al. 1997).
Residue Tyr-60 in the N-domain and a stretch of amino
acids (K222HGLYNLKQCKMSLN236) in the C-domain
of bovine IGFBP-2 has been shown to be important for
IGF binding (Forbes et al. 1998; Hobba et al. 1998).
These residues are well conserved in the P. olivaceus
IGFBP-2s mature protein (IGFBP-2a: Tyr-61 and
K200RGQYNLKQCKMSLH214; IGFBP-2b: Tyr-58
and R186HGLYNLKQCNMSTH200). A RGD motif
was also present in the C-domain of the P. olivaceus
IGFBP-2s. By the binding with a5b1 integrins in cell
surface, the RGD motif in human IGFBP-1 has been
shown to be responsible for the IGF-independent activity
of IGFBP-1 on cell migration (Jones et al. 1993). This
motif was also existed in IGFBP-2, which is essential for
IGFBP-2 to mediate IGF action of proliferation. But, it
reported that IGFBP-2 cell surface association was not
dependent on the RGD motif in rat. The mutational
sequence (RGD was replaced by RGE) of IGFBP-2 did
not alter its growth inhibitory effect and affect its capacity
123
1548
Fish Physiol Biochem (2013) 39:1541–1554
b Fig. 2 Phylogenetic tree based upon the alignment of amino
acid sequences of vertebrates IGFBPs and constructed using the
Neighbor-Joining bootstrap method by Mega 4.1 with 1000
bootstrap replications. The full length of IGFBPs amino acid
sequences used for analysis was extracted from GenBank. The
number shown at each branch indicated the bootstrap values (%)
of binding to cell surface in vivo (Hoeflich et al. 2002).
Unlike mammals, heparin-binding site (PKKLRPP) was
not perfectly conserved in fish IGFBP-2. The heparinbinding domain in IGFBPs binding to heparin or
glycosaminoglycans changed the configuration of those
IGFBPs, leading to significant lower affinity to IGF-I and
enable the IGFBPs complex to type I receptors on the cell
surface. The heparin-binding motif is also absent in
P. olivaceus and D. rerio IGFBP-2 (Duan et al. 1999). It
has proved that the mutants of D. rerio IGFBP-2 with
altered RGD and heparin-binding site had similar effects
in inhibiting growth and developmental rates, but altering
the IGF binding site abolishes its biological activity
(Zhou et al. 2008). Preliminary results demonstrated that
D. rerio IGFBP-2 did not localize to the cell surface, but
whether it has a growth inhibitory effect in P. olivaceus
like D. rerio IGFBP-2 needs further studies.
In addition, there were two IGFBP-2s in D. rerio,
O. Latipes, E. coioides, C. carpio, S. aurata, F. obscurus
and T. nigroviridis. In contrast to other species, there
only found one transcript such as chicken (Schoen et al.
1995), rat (Margot et al. 1989). At present, there were
two sequences of IGFBP-2 obtained in P. olivaceus, as
the E. coioides (Chen et al., 2010), by rapid amplification of cDNA ends technique. P. olivaceus IGFBP-2a
and IGFBP-2b share highly degree identity (51.1 %) in
the amino acid level.
In the present study, both IGFBP-2 mRNAs were
ubiquitously expressed in various tissues, suggesting
that IGFBP-2 is being synthesized in the liver, as well
as in extrahepatic tissues locally. The IGFBP-2a
mRNA in all detected tissues was rather lower,
especially in male fish; however, the IGFBP-2b
mRNA was extremely abundant in liver, but comparatively lower. The different spatial expression pattern
between two IGFBP-2s in P. olivaceus revealed that
IGFBP-2a and IGFBP-2b may have different functions on growth, development and even other physiological actions. The pervasive tissue distribution of
IGFBP-2s in P. olivaceus is consistent with the
123
Fish Physiol Biochem (2013) 39:1541–1554
Fig. 3 Relative expression levels of IGFBP-2 mRNAs in
different tissues of female and male P. olivaceus. Data were
expressed as the mean fold difference (mean ± SEM, n = 3)
from the calibrator group (heart of female P. olivaceus). a is
relative expression levels of IGFBP-2a mRNA in different
1549
tissues of female and male P. olivaceus; b is relative expression
levels of IGFBP-2b mRNA in different tissues of female and
male P. olivaceus. The asterisk represented the statistical
significant differences with the female fish (P \ 0.05)
Fig. 4 Relative expression
levels of IGFBP-2 mRNAs
during P. olivaceus
embryonic and larval
development. Data were
expressed as the mean fold
difference (mean ± SEM,
n = 3) from the calibrator
group (the value of IGFBP2b mRNA in 0 h embryo).
The asterisk represented the
statistical significant
differences between two
IGFBP-2s subtypes
(P \ 0.05)
expression of IGFBP-2 found in mammalian and other
fish species, whereas the extrahepatic tissue distributions of IGFBP-2 mRNA were practically different in
vertebrates. Higher level of IGFBP-2 mRNA was
found in the brain of D. rerio (Duan et al., 1999),
O. mykiss (Kamangar et al., 2006) and C. carpio (Chen
et al., 2009). However, in S. aurata (Funkenstein et al.,
2002) and P. olivaceus, the level of IGFBP-2 mRNA
in brain was relatively low. This phenomenon may
cause by the discrepancies of physical conditions and
life habits of different organisms. Interestingly, the
spatial expression pattern of IGFBP-2 mRNA in
P. olivaceus is not exactly consistent with that of
IGF-I (Zhang et al. 2011a). It reported that the affinity
of IGFBP-2 for IGF-II is fourfold higher than its
affinity for IGF-I. (Clemmons 1997) partially suggests
123
1550
Fish Physiol Biochem (2013) 39:1541–1554
Fig. 5 Relative expression levels of IGFBP-2 mRNAs in TH
and TU-treated larvae during P. olivaceus metamorphosis. Data
were expressed as the mean fold difference (mean ± SEM,
n = 3) from the calibrator group (untreated 17 dph larvae).
Figure 1a is relative expression levels of IGFBP-2a mRNA in
different tissues of female and male P. olivaceus; Fig. 1b is
relative expression levels of IGFBP-2b mRNA in different
tissues of female and male P. olivaceus. The asterisk
represented the statistical significant differences with the
untreated group (P \ 0.05). Control represented the untreated
group; TH represented the thyroid hormone-treated group; TU
represented the thiourea-treated group
that IGFBP-2 not only modulate the actions of IGF-I
but also IGF-II. Furthermore, IGFBP-2 also has its
IGF-independent actions. To know the regulation and
exact roles of IGFBP-2 in P. olivaceus still need
further investigation.
Interestingly, the levels of IGFBP-2b mRNA in all
detected tissues were higher in male than female
P. olivaceus; rather, the IGFBP-2a mRNA expression
levels in male were lower than in female. As we all
know, sexually dimorphic growth exists in many
teleosts. In P. olivaceus, females grow significantly
faster and larger than males. In vitro studies suggest
that IGFBP-2 is primarily inhibitory to IGF actions
(Clemmons 2001; Firth and Baxter 2002). Recent
studies also indicate that IGFBP-2 could inhibit the
growth of zebrafish by acting downstream in the GH–
IGF-I axis (Duan et al. 1999). These data indicate
that growth difference between male and female
P. olivaceus may have much to do with IGFBP-2b.
The decrease IGFBP-2b mRNA levels in female fish
was accompanied by the IGFBP-2a mRNA levels
increasing, which indicate that IGFBP-2a may cooperate with IGFBP-2b to exert other biological functions.
Remarkably, the expression of IGFBP-2b mRNA in
gonad, especially in ovary, is higher than other
extrahepatic tissues. This phenomenon is also found
in S. aurata (Funkenstein et al., 2002), O. mykiss
(Kamangar et al., 2006), C. carpio (Chen et al., 2009),
as well as in other animals. In S. aurata, a relatively
high expression level of IGFBP-2 mRNA was detected
in young gonads with a predominantly ovarian part,
consisting mainly of pre-vitellogenic oocytes (Funkenstein et al. 2002). A higher level of IGFBP-2
mRNA was also observed in E. coioides ovary (Chen
et al. 2010) and C. carpio gonad (Chen et al. 2009). In
human, high levels of IGFBP-2 were found in
follicular fluid from healthy, dominant follicles
(Hughes et al. 1997). In addition, high level of
IGFBP-2 mRNA in developing follicles was also
reported in chicken (Onagbesan et al. 1999; Schams
et al. 1999) and cattle (Armstrong et al. 1998; Yuan
et al. 1998). These results indicate that IGFBP-2 may
play an important role in animal gonadal development.
In D. rerio (Zhou et al., 2008), S. aurata (Funkenstein et al., 2002), C. carpio (Chen et al., 2009) and
E. coioides (Chen et al., 2010), IGFBP-2 mRNA was
expressed during fish embryonic development and
larvae at all the stages examined. Similarly, in our
present study, two IGFBP-2 mRNAs were detected in
all stages of embryonic development and sampled
larval stages. While the levels of IGFBP-2a mRNA
were obviously higher than IGFBP-2b at embryonic
stages suggesting that IGFBP-2a may play a major
role in embryonic development. It reported that
123
Fish Physiol Biochem (2013) 39:1541–1554
targeted knock-down of IGFBP-2 yielded embryos
with reduced blood cell densities, disruptions to blood
circulation, cardiac dysfunction and pronounced cerebral edema (Wood 2005). IGF-I, IGF-II, and IGF- IR
mRNAs were previously reported in unfertilized
D. rerio eggs (Maures et al. 2002), and Wood et al.
authenticated that knock-down of IGFBP-2 significantly reduces IGF-I mRNA levels in D. rerio
embryos (Wood 2005). Additionally, IGF-I and IGFIR were detected in embryonic development and
larvae stages (Zhang et al. 2011a, b, c). These data
suggest that IGFBP-2a may be involved in embryonic
and larval development by modulating IGFs actions.
With embryo hatching, the expression of IGFBP-2a
decreased and maintained a lower level indicate that
IGFBP-2b has gradually displaced the position of
IGFBP-2a in growth and development. It indicated
that IGFBP-2a plays a core role in embryonic development as well as IGFBP-2b in the larvae growth and
development.
In the present study, an abrupt increasing level of
IGFBP-2b mRNA was detected at 3 dph and then
dropped to a relative low level at 7 dph. Nutrition is a
regulator of IGFBP-2 expression (Clemmons 1997).
IGFBP-2 gene transcription was increased in starved
rodents, and plasma concentrations were increased in
fasted humans (Clemmons et al. 1991). In teleosts
such as D. rerio, three-week fasting increased the
IGFBP-2 mRNA tissue levels (Duan et al. 1999). The
3–4 dph is considered critical for the successful
transition from endogenous nutrition to exogenous
feeding, when the yolk sac is almost entirely absorbed
(Bao et al. 1998). After 3 dph, larvae started feeding
on nutritional supplements. Therefore, we speculate
that the expression of IGFBP-2b mRNA increased at
3 dph may be due to poor endogenous nutrition and
decreased at 7 dph may be owing to nutritional
supplements after starting feeding. As we all know
that the anlage of crow-like larval fin appeared and
followed by the six fin rays of crow-like larval fin
appeared one by one in pre-metamorphosis. IGFBP-2
is identified as a potent inhibitor of bone growth
(Eckstein et al. 2002) and cell proliferation (Hoeflich
et al. 1999). Research has shown that the P. olivaceus
larvae underwent a faster growth in pre-metamorphosis (Liu 1996). Therefore, keeping a lower IGFBP-2b
mRNA level and higher IGF-I mRNA level (Zhang
et al. 2011a, b) could be imperative to stimulate premetamorphic larval faster growth and initiate
1551
metamorphosis. Considering these data, we conjecture
that levels of IGFBP-2b mRNA observed from 10 to
23 dph put on a downward trend may be in relation to
the fin rays appearance and extension and necessary to
accelerate growth rate. At metamorphic climax,
IGFBP-2b mRNA was increased to a higher level
and maintained to the end of metamorphosis. Relatively higher expression of IGFBP-2b mRNA and
lower IGF-I mRNA expression (Zhang et al. 2011a, b)
during metamorphosis are consistent with the P.
olivaceus larvae showing that the increasing weight
rate evidently declined at this stage (Liu 1996). These
results suggest that IGFBP-2 could play a vital role in
modulating IGFs action during larval development
and metamorphosis of the P. olivaceus.
Previous studies have shown that TH treatment
slightly increases IGFBP-2 mRNA expression in
hypothyroid mammals (Clemmons 1997). Similarity
with mammals, the expression and secretion of fish
IGFBP-2 mRNA are also influenced by TH to some
extent. In the present study, we used exogenous TH
(0.1 mg/L) and TU (30 mg/L) treated the larvae at
15 dph to examine the effects of TH and TU on
IGFBP-2 mRNA expression during P. olivaceus
metamorphosis, found that IGFBP-2a mRNA level
only distinctly raised in TH-treated 17 dph larvae; in
TU-treated larvae and TH-treated larvae in other
stage, have no visible change. However, IGFBP-2b
mRNA level in TH-treated larvae showed obviously
rise before 29 dph and in TU-treated larvae was
markedly decreased during metamorphosis. This suggests that transcription of IGFBP-2b mRNA could be
stimulated by TH in certain range of concentrations,
while inhibited by high concentrations; TU could
down-regulate IGFBP-2b mRNA expression level by
inhibiting the secretion of endogenous TH; IGFBP-2b
was the main subtype of IGFBP-2 participating in
metamorphosis of Japanese flounder. Fu et al. (2012)
indicate that TH-treated larvae were smaller in size
than untreated and TU-treated larvae. Moreover,
administration of TH to pre-metamorphic P. olivaceus
larvae induced precocious metamorphosis, whereas a
TU induced metamorphic stasis (Inui and Miwa 1985;
Miwa and Inui 1987). Previous studies have shown
that IGF-I and IGFBP-1 mRNA levels were significantly altered in TH-treated larvae compared with
untreated larvae during the P. olivaceus metamorphosis
(Zhai et al. 2012; Zhang et al. 2011a) indicating that
the effect of TH on accelerating P. olivaceus
123
1552
metamorphosis may partly achieved by regulating
IGFs system.
In summary, the present study had cloned and
characterized the full-length cDNA of two IGFBP-2
genes and expression patterns of P. olivaceus IGFBP2s. IGFBP-2a mRNA was more evenly expressed in
all detected tissues, but IGFBP-2b mRNA was mainly
synthesized in the liver, suggesting that IGFBP-2 has
autocrine/paracrine actions on regulating IGFs system. Moreover, IGFBP-2a was mainly expressed in
embryonic stages, and IGFBP-2b was mainly
expressed in larval stages and adult fish. Furthermore,
IGFBP-2b mRNA, rather than IGFBP-2a, was reduced
by certain level of exogenous TH, while deduce by
high level of TH in P. olivaceus larvae. The results
showed that IGFBP-2b was the main subtype in
regulating P. olivaceus metamorphosis. IGFBP-2a and
IGFBP-2b may have different functions in IGFdependent and IGF-independent actions. Although
the exact mechanism is necessary to be elucidated,
these results suggest that the IGFBP-2 may be
involved in the IGF system regulating developmental
and metamorphic process in the P. olivaceus and
provide molecular base for the further study of IGFs
system and P. olivaceus metamorphosis.
Acknowledgments The authors wish to thank Prof. Haijin Liu
(Chinese Academy of Fishery Sciences) for providing embryos
and larvae samples and all the staff in Beidaihe Central
Experimental Station for their helps in the raising of
experimental fish. This research was supported by the
National Natural Science Foundation of China (No.
31172392), Leading Academic Discipline Project of Shanghai
Municipal Education Commission (No. S30701; No. J50701)
and Dr. Foundation of Shanghai Ocean University.
References
Armstrong D, Baxter G, Gutierrez C, Hogg C, Glazyrin A,
Campbell B, Bramley T, Webb R (1998) Insulin-like
growth factor binding protein-2 and-4 messenger ribonucleic acid expression in bovine ovarian follicles: effect of
gonadotropins and developmental status. Endocrinology
139:2146–2154
Bao B, Su J, Yin M (1998) Effect of delayed feeding on feeding
ability, survival and growth of red sea bream and olive flounder
larvae during early development[J]. J Fish China 22(1):33–38
Chen W, Li W, Lin H (2009) Common carp (Cyprinus carpio)
insulin-like growth factor binding protein-2 (IGFBP-2):
molecular cloning, expression profiles, and hormonal regulation in hepatocytes. Gen Comp Endocrinol 161:390–399
123
Fish Physiol Biochem (2013) 39:1541–1554
Chen W, Wang Y, Li W, Lin H (2010) Insulin-like growth factor
binding protein-2 (IGFBP-2) in orange-spotted grouper,
Epinephelus coioides: molecular characterization, expression profiles and regulation by 17b-estradiol in ovary.
Comp Biochem Physiol B: Biochem Mol Biol 157:
336–342
Clemmons DR (1997) Insulin-like growth factor binding proteins and their role in controlling IGF actions. Cytokine
Growth Factor Rev 8:45–62
Clemmons DR (2001) Use of mutagenesis to probe IGF-binding
protein structure/function relationships. Endocr Rev
22:800–817
Clemmons DR, Snyder DK, Busby WH Jr (1991) Variables
controlling the secretion of insulin-like growth factor
binding protein-2 in normal human subjects. J Clin Endocrinol Metab 73:727–733
Duan C, Clemmons DR (1998) Differential expression and
biological effects of insulin-like growth factor-binding
protein-4 and-5 in vascular smooth muscle cells. J Biol
Chem 273:16836–16842
Duan C, Xu Q (2005) Roles of insulin-like growth factor (IGF)
binding proteins in regulating IGF actions. Gen Comp
Endocrinol 142:44–52
Duan C, Ding J, Li Q, Tsai W, Pozios K (1999) Insulin-like
growth factor binding protein 2 is a growth inhibitory
protein conserved in zebrafish. Proc Natl Acad Sci
96:15274
Eckstein F, Pavicic T, Nedbal S, Schmidt C, Wehr U, Rambeck
W, Wolf E, Hoeflich A (2002) Insulin-like growth factorbinding protein-2 (IGFBP-2) overexpression negatively
regulates bone size and mass, but not density, in the
absence and presence of growth hormone/IGF-I excess in
transgenic mice. Anat Embryol 206:139–148
Firth SM, Baxter RC (2002) Cellular actions of the insulin-like
growth factor binding proteins. Endocr Rev 23:824–854
Forbes BE, Turner D, Hodge SJ, McNeil KA, Forsberg G,
Wallace JC (1998) Localization of an insulin-like growth
factor (IGF) binding site of bovine IGF binding protein-2
using disulfide mapping and deletion mutation analysis of
the C-terminal domain. J Biol Chem 273:4647–4652
Fu Y, Shi Z, Wang G, Li W, Zhang J, Jia L (2012) Expression
and regulation of miR-1, -133a, -206a, and MRFs by thyroid hormone during larval development in Paralichthys
olivaceus. Comp Biochem Physiol B: Biochem Mol Biol
161:226–232
Funkenstein B, Tsai W, Maures T, Duan C (2002) Ontogeny,
tissue distribution, and hormonal regulation of insulin-like
growth factor binding protein-2 (IGFBP-2) in a marine fish,
Sparus aurata. Gen Comp Endocrinol 128:112–122
Gracey AY, Troll JV, Somero GN (2001) Hypoxia-induced
gene expression profiling in the euryoxic fish Gillichthys
mirabilis. Proc Natl Acad Sci 98:1993
Hildahl J, Galay-Burgos M, Sweeney G, Einarsdóttir IE,
Björnsson BT (2007a) Identification of two isoforms of
Atlantic halibut insulin-like growth factor-I receptor genes
and quantitative gene expression during metamorphosis.
Comp Biochem Physiol B: Biochem Mol Biol 147:395–401
Hildahl J, Sweeney G, Galay-Burgos M, Einarsdóttir IE, Björnsson BT (2007b) Cloning of Atlantic halibut growth hormone
receptor genes and quantitative gene expression during
metamorphosis. Gen Comp Endocrinol 151:143–152
Fish Physiol Biochem (2013) 39:1541–1554
Hildahl J, Power DM, Björnsson BT, Einarsdóttir IE (2008)
Involvement of growth hormone-insulin-like growth factor
I system in cranial remodeling during halibut metamorphosis as indicated by tissue-and stage-specific receptor
gene expression and the presence of growth hormone
receptor protein. Cell Tissue Res 332:211–225
Hobba GD, Löthgren A, Holmberg E, Forbes BE, Francis GL,
Wallace JC (1998) Alanine screening mutagenesis establishes tyrosine 60 of bovine insulin-like growth factor
binding protein-2 as a determinant of insulin-like growth
factor binding. J Biol Chem 273:19691
Hoeflich A, Wu M, Mohan S, Föll J, Wanke R, Froehlich T,
Arnold GJ, Lahm H, Kolb HJ, Wolf E (1999) Overexpression of insulin-like growth factor-binding protein-2 in
transgenic mice reduces postnatal body weight gain.
Endocrinology 140:5488–5496
Hoeflich A, Reisinger R, Vargas G, Elmlinger M, Schuett B,
Jehle P, Renner-Müller I, Lahm H, Russo V, Wolf E (2002)
Mutation of the RGD sequence does not affect plasma
membrane association and growth inhibitory effects of
elevated IGFBP-2 in vivo. FEBS Lett 523:63–67
Hughes SCC, Mason H, Franks S, Holly J (1997) Modulation of
the insulin-like growth factor-binding proteins by follicle
size in the human ovary. J Endocrinol 154:35–43
Hwa V, Oh Y, Rosenfeld RG (1999) The insulin-like growth
factor-binding protein (IGFBP) superfamily. Endocr Rev
20:761
Inui Y, Miwa S (1985) Thyroid hormone induces metamorphosis of flounder larvae. Gen Comp Endocrinol
60:450–454
Jones JI, Clemmons DR (1995) Insulin-like growth factors and
their binding proteins: biological actions. Endocr Rev
16:3–34
Jones JI, Gockerman A, Busby WH, Wright G, Clemmons DR
(1993) Insulin-like growth factor binding protein 1 stimulates cell migration and binds to the alpha 5 beta 1 integrin
by means of its Arg-Gly-Asp sequence. Proc Natl Acad Sci
90:10553
Kamangar BB, Gabillard JC, Bobe J (2006) Insulin-like growth
factor-binding protein (IGFBP)-1,-2,-3,-4,-5, and-6 and
IGFBP-related protein 1 during rainbow trout post vitellogenesis and oocyte maturation: molecular characterization, expression profiles, and hormonal regulation.
Endocrinology 147:2399–2410
Kim HS, Nagalla SR, Oh Y, Wilson E, Roberts CT, Rosenfeld
RG (1997) Identification of a family of low-affinity insulinlike growth factor binding proteins (IGFBPs): characterization of connective tissue growth factor as a member of
the IGFBP superfamily. Proc Natl Acad Sci 94:12981
Liu L (1996) Growth and development of Paralichthys olivaceus in metamorphosis period at different temperatures.
Mar Sci 4:58–63
Livak KJ, Schmittgen TD (2001) Analysis of relative gene
expression data using real-time quantitative PCR and the
2-[Delta][Delta] CT method. Methods 25:402–408
Margot J, Binkert C, Mary JL, Landwehr J, Heinrich G, Schwander J (1989) A low molecular weight insulin-like
growth factor binding protein from rat: cDNA cloning and
1553
tissue distribution of its messenger RNA. Mol Endocrinol
3:1053–1060
Maures T, Chan SJ, Xu B, Sun H, Ding J, Duan C (2002)
Structural, biochemical, and expression analysis of two
distinct insulin-like growth factor I receptors and their
ligands in zebrafish*. Endocrinology 143:1858–1871
Minami T (1982) The early life history of a flounder Paralichthys olivaceus. Bull Jpn Soc Sci Fish 48:1581–1588
Miwa S, Inui Y (1987) Effects of various doses of thyroxine and
triiodothyronine on the metamorphosis of flounder (Paralichthys olivaceus). Gen Comp Endocrinol 67:356–363
Miwa S, Tagawa M, Inui Y, Hirano T (1988) Thyroxine surge in
metamorphosing flounder larvae. Gen Comp Endocrinol
70:158–163
Onagbesan O, Vleugels B, Buys N, Bruggeman V, Safi M,
Decuypere E (1999) Insulin-like growth factors in the
regulation of avian ovarian functions. Domest Anim
Endocrinol 17:299–313
Pedroso FL, Fukada H, Masumoto T (2009) Molecular characterization, tissue distribution patterns and nutritional
regulation of IGFBP-1, -2, -3 and -5 in yellowtail, Seriola
quinqueradiata. Gen Comp Endocrinol 161:344–353
Rajaram S, Baylink DJ, Mohan S (1997) Insulin-like growth
factor-binding proteins in serum and other biological fluids: regulation and functions. Endocr Rev 18:801–831
Schams D, Berisha B, Kosmann M, Einspanier R, Amselgruber
W (1999) Possible role of growth hormone, IGFs, and
IGF-binding proteins in the regulation of ovarian function
in large farm animals. Domest Anim Endocrinol 17:
279–285
Schneider M, Wolf E, Hoeflich A, Lahm H (2002) IGF-binding
protein-5: flexible player in the IGF system and effector on
its own. J Endocrinol 172:423–440
Schoen T, Mazuruk K, Waldbillig R, Potts J, Beebe D, Chader
G, Rodriguez I (1995) Cloning and characterization of a
chick embryo cDNA and gene for IGF-binding protein-2.
J Mol Endocrinol 15:49–59
Wood AW (2005) Targeted knockdown of insulin-like growth
factor binding protein-2 disrupts cardiovascular development in zebrafish embryos. Mol Endocrinol
19:1024–1034
Yuan W, Bao B, Garverick H, Youngquist R, Lucy M (1998)
Follicular dominance in cattle is associated with divergent
patterns of ovarian gene expression for insulin-like growth
factor (IGF)-I, IGF-II, and IGF binding protein-2 in dominant and subordinate follicles. Domest Anim Endocrinol
15:55–63
Zhai W, Zhang J, Shi Z, Fu Y (2012) Identification and
expression analysis of IGFBP-1 gene from Japanese
flounder (Paralichthys olivaceus). Comp Biochem Physiol
B: Biochem Mol Biol 161:413–420
Zhang J, Shi Z, Fu Y, Cheng Q (2011a) Gene expression and
thyroid hormone regulated transcript of Igf-I during
metamorphosis of the flounder, Paralichthys Olivaceus.
Acta Hydrobiol Sin 35:355–359
Zhang J, Shi Z, Fu Y, Zhai W (2011b) Expression patterns of
IGF-I and its receptor genes during embryonic development of Japanese flounder. J Fish Sci China 18:1219–1225
123
1554
Zhang J, Shi Z, Cheng Q, Chen X (2011c) Expression of insulinlike growth factor I receptors at mRNA and protein levels
during metamorphosis of Japanese flounder (Paralichthys
olivaceus). Gen Comp Endocrinol 173:78–85
123
Fish Physiol Biochem (2013) 39:1541–1554
Zhou J, Li W, Kamei H, Duan C (2008) Duplication of the
IGFBP-2 gene in teleost fish: protein structure and functionality conservation and gene expression divergence.
PLoS ONE 3:e3926