* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Supplementary Materials and Methods and Supplementary Figure
DNA damage theory of aging wikipedia , lookup
Epigenomics wikipedia , lookup
Cancer epigenetics wikipedia , lookup
Microevolution wikipedia , lookup
Point mutation wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Bisulfite sequencing wikipedia , lookup
Gene expression profiling wikipedia , lookup
Polycomb Group Proteins and Cancer wikipedia , lookup
Epigenetics in stem-cell differentiation wikipedia , lookup
Cell-free fetal DNA wikipedia , lookup
DNA vaccination wikipedia , lookup
Primary transcript wikipedia , lookup
Nutriepigenomics wikipedia , lookup
No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup
History of genetic engineering wikipedia , lookup
Gene therapy of the human retina wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Site-specific recombinase technology wikipedia , lookup
Supplementary methods Genotyping PCR was used to genotype the Zbtb4-/- mice using genomic DNA extracted from the tail or the brain. The genomic DNA was extracted by Proteinase K (Roche) digestion followed by an isopropanol precipitation. Genomic DNA was used for PCR with the following primers using GoTaq (Promega) according to the manufacturer's instructions; PAD882: 5’- TGCCCTTTGCTGTGGCCTGA-3 and PAD884: 5’-GCACCCTGGCTCCTTCCAGC-3’. Immunofluorescence and confocal imaging All coverslips were incubated 1 hour at room temperature with 0.1% bovine serum albumin (BSA) and next incubated 1 hour at RT with the antibodies directed against the following antigens: mouse anti-phospho-histone H3-Ser10 (Cell Signaling, 9706, 1:100), rat anti-BrdU (Abcam, ab6326, 1:200), rabbit anti-cleaved caspase 3 (Cell Signalling, 9661, 1:500), mouse anti-alpha-Tubulin (Abcam, ab7291, 1:2000), mouse anti-gamma-Tubulin (Abcam, ab11316, 1:500), rabbit anti-LAMIN B1 (Abcam, ab16048, 1:500), mouse anti-BUBR1 (Thermo Scientific, MA1-16577, 1:200). DNA was visualized with Hoechst 33342 (Sigma, 0.5 µg/ml) or DAPI in Vectashield (Vector Laboratories). Images were collected with either a LEICA DMI6000 B or a ZEISS LSM 710 Laser Scanning Confocal microscope with a 63×-immersion oil objective. Image capture was controlled by MetaMorph® Microscopy Automation & Image Analysis Software (LEICA) or Zen Software (ZEISS). For all samples, an optimal setting of the laser power and PMT voltage was chosen to avoid pixel saturation and minimize photobleaching. The settings were kept constant so that valid 1 comparisons could be made between measurements from different samples. FiJi (ImageJ) software was used for the 3D quantification analysis. RT-qPCR primers ZBTB4 : Forward (F) 5’-AGGAAGTACCCCTGCCGCTA-3’, Reverse (R) 5’- TTGTAGCCTCCATTGGGTGT-3’. BUB1B : (F) 5’-TAGGGCGTTTATGCAATGAGC-3’, (R) 5’-TCCTGAAATATCGCATCTGCTTT-3’. : MAD2L1 (F) 5’- GTTCTTCTCATTCGGCATCAACA-3’, (R) 5’-GAGTCCGTATTTCTGCACTCG-3’. BUB3 : (F) 5’-CTGCGCCTTCTACGATCCAA-3’, (R) 5’-GCATCATGGGTCCCAACAAGAT-3’. : CCNB1 (F) 5’-AATAAGGCGAAGATCAACATGGC-3’, (R) 5’- TTTGTTACCAATGTCCCCAAGAG-3’. B2M : (F) 5’-GGCTATCCACGTACTCCAAA-3’, (R) 5’-CGGCAGGCATACTCATCTTTTT-3’. RPLP0 : (F) 5’-TCCAGAGGCACCATTGAAATT3’, (R) 5’-TCGCTGGCTCCCACCTT-3’. TBP: (F) 5’-CCACTCACAGACTCTCACAAC-3’, (R) 5’-CTGCGGTACAATCCCAGAACT-3’. Ccnb1: (F) 5’-GCGTGTGCCTGTGACAGTTA-3’, (R) 5’-CCTAGCGTTTTTGCTTCCCTT-3’. Ccnb2 : (F) 5’-GCCAAGAGCCATGTGACTATC-3’, (R) 5’- CAGAGCTGGTACTTTGGTGTTC-3’. Bub1 : (F) 5’-AGAATGCTCTGTCAGCTCATCT-3’, (R) 5’-TGTCTTCACTAACCCACTGCT-3’. Bub1b : (F) 5’-GAGGCGAGTGAAGCCATGT-3’, (R) 5’-TCCAGAGTAAAAGCGGATTTCAG-3’. Mad2L1: (F) 5’- GTGTTCTCCGTTCGATCTAGTG-3’, (R) 5’-CCACGCTGATACAAAATGCTG-3’. Cdc25c : (F) 5’-GGCAAACCTAAGCATTCTGTCG-3’, (R) 5’-CCAGAGGTCCAGATGAATCCA-3’. Chk1 : (F) 5’-ATCGTGAACGCTTACTGAACAA-3’, (R) 5’-CTGACAGCTATCACTGGGCT3’. Plk1 : (F) 5’-TGTAGTTTTGGAGCTCTGTCG-3’, 2 (R) 5’- TCCCTGTGAATGACCTGATTG-3’. Plk4 : (F) 5’-GGATCGAGGACTTTAAGGTTGG-3’, (R) 5’-TCTCTGTACCATTCCAGCTTTG-3’. Cenpn : (F) 5’-CACAGTATTCACAGCCAAACC-3’, (R) 5’-CAATCTGATGGTGTTTGCTGG-3’. Vector Virus Production and Infection ZBTB4 shRNA plasmid vectors (Sigma) contain the following hairpin sequences: shZBTB4#1 (clone NM_020899.2-1293s1c1) CCGGCGCTATTGTGAGAAAGTGTTTCTCGAGAAACACTTTCTCACAATAGCGTTTTT shZBTB4 #2 (clone NM_020899.2-1389s1c1) CCGGGAGACCTTTGTCACTTACTATCTCGAGATAGTAAGTGACAAAGGTCTCTTTTT Western blotting Western blots were performed using the following antibodies: rabbit anti-ZBTB4 (homemade #120), mouse anti-BUB1B (Thermo Scientific, MA1-16577, 1:2000), rabbit anti-MAD2L1 (Abcam, ab97777, 1:500), mouse anti-Cyclin B1 (Thermo Scientific, MA5-14327, 1:500), rabbit anti-Hitone H3 (Abcam, ab1791, 1:10000), rabbit anti-p53 (Santa Cruz, sc-6243, 1:500), mouse anti-p21Cip1 (Santa Cruz, sc-6246, 1:1000), rabbit anti-p19ARF (Novus Biologicals, NB200-106 1:500), rabbit anti-Phospho Rb (Cell Signaling, 9308, 1 :1000), rabbit anti-p16Ink4a (Cell Signaling, 4824, 1:1000), mouse anti-CDK4 (Cell Signaling, 2906, 1:2000). Secondary HRP donkey anti-mouse IgG (Jackson ImmunoResearch, 715-035-150, 1 :10000) and HRP donkey anti-rabbit IgG (Jackson ImmunoResearch , 711-035-152, 1 :10000) Bands were visualized by horseradish peroxidase labeled antibodies and SuperSignal West Dura Extended Duration Substrate (Thermo Scientific). FiJi (ImageJ) software was used for the intensity quantification analysis. 3 Supplementary Figure Legends Figure S1. Controls related to Figure 1. A, Boxplots showing the percentage of the genome affected by Copy Number Alterations (CNA) in the indicated tumor types, comparing the lowest decile for ZBTB33 expression ("ZBTB33 low") to the remaining tumors ("Others"); p-value calculated by T-test, n.s: no statistically significant. B, Western blotting on whole-cell protein lysates from U2OS and HeLa expressing shCTRL, shZBTB4 #1 or shZBTB4 #2. H3: Histone H3. C, Quantification of panel B D, Quantification of anaphase U2OS cells showing lagging chromosomes after ZBTB4 knockdown with shZBTB4 #1 and #2. E, ZBTB4 knockdown in HCT116 cells leads to increased polynucleation. Figure S2. Illustrations and controls related to Figure 2. A, Representative mitosis of HeLa cells stably expressing EB3-GFP, H2B-mCherry and shCTRL or shZBTB4 captured by time-lapse videomicroscopy at 40X. Scale bar = 10 m. B, Representative gating of flow cytometry cell cycle analysis by PI and Br-dUTP staining, for cells of the indicated genotypes, before, during, and after nocodazole block. C, Summary of cell cycle analysis by PI and Br-dUTP staining showing percentage of cells in G1, S and G2/M (non gating cells excluded). Figure S3. Controls related to Figure 3. A, Diagram of the ZBTB4 protein indicating the BTB/POZ domain and the DNA binding domain, composed of 3 zinc fingers (ZF). The exons of the Zbtb4 gene are indicated in yellow and the coding exons appear in dark yellow. The portion of ZBTB4 protein encoded by exon 3 is 4 indicated. Exon 3 was replaced by a cassette introducing LoxP sites and the neo gene to generate the targeted allele. The knock-out allele of Zbtb4 lacks the entire exon 3. B, Primers used in PCR for genotyping are indicated on top. The figure shows a representative PCR on genomic DNA purified from brain of wild-type, Zbtb4+/- and Zbtb4-/- mice. The top band of the PCR is derived from the wild-type allele, whereas the lower band is derived from the targeted allele. C, Primers used in PCR for mRNA expression analysis are indicated on top. The relative expression level of Zbtb4 mRNA in the brain of wild-type, Zbtb4+/- and Zbtb4-/- adult mice is shown below. Expression values are normalized to a housekeeping gene and expression level in wild-type set up to 1 (n=3). D, Zbtb4+/+ and Zbtb4-/- MEF cultures at passages 5 were stained for senescenceassociated-beta-galactosidase activity (SA-β-gal) and quantified. E, Quantification of BrdUpositive cells in Zbtb4+/+ and Zbtb4-/- MEF cultures at passage 3. F, Flow cytometry analysis of the TUNEL-positive population in Zbtb4+/+ and Zbtb4-/- MEFs. G, Western blotting for p53 on total cellular extracts from Zbtb4+/+ and Zbtb4-/- MEFs and the indicated controls. Figure S4. Additional data related to Figure 4. A, Volcano plot, Log2FC against pvalue, of Zbtb4-/- vs WT MEFs, red dots indicates differentially expressed genes (pvalue ≤ 0.01). B, Gene sets significantly deregulated in Zbtb4-/MEFs, as determined using available genesets and GSEA analysis. Figure S5. Additional data related to Figure 5. Representative figures and quantification of -tubulin foci per cells. Figure S6. Additional data related to Figure 6. 5 A, The relative expression level of Zbtb4 mRNA in papillomas from Zbtb4+/+, Zbtb4+/- and Zbtb4-/- mice. Expression values are normalized to a housekeeping gene and expression level in wild-type set up to 1. B, As in A., but for keratoacanthomas. 6