Download JNK Regulates MCP-1 Expression in Adenovirus Type 19

JNK Regulates MCP-1 Expression in Adenovirus
Type 19 –Infected Human Corneal Fibroblasts
Jingnan Xiao1 and James Chodosh1,2,3
PURPOSE. Previous studies indicate that adenovirus type 19
(Ad19) infection of human corneal fibroblasts (HCFs) induces
the expression of several proinflammatory mediators, including IL-8 and monocyte chemoattractant protein-1 (MCP-1), and
that the tyrosine kinase c-Src and its downstream target, the
mitogen-activated protein kinase ERK1/2, mediate IL-8 expression. In this context, the authors sought to investigate the
potential role of another mitogen-activated protein kinase, cJun N-terminal kinase (JNK), in adenoviral ocular pathogenesis.
METHODS. Ad19- and mock-infected HCFs were solubilized at
various time points after infection, and cell lysates were subjected to SDS-PAGE followed by immunoblot analysis with a
panel of antibodies against components of the MKK7/JNK/cJun pathway or immunoprecipitated for JNK assay. The induction of chemokine mRNA and protein was determined by
real-time PCR and ELISA, respectively.
RESULTS. Ad19 induced the phosphorylation of MKK7, JNK, and
the downstream transcription factor c-Jun in HCFs at 15 and 30
minutes after infection. JNK activity was demonstrated at 30
minutes after infection using the GST– c-Jun fusion protein as a
target substrate. SP600125, a specific pharmacologic inhibitor of
JNK, blocked MCP-1 but not IL-8 mRNA and protein expression.
Finally, PP2, a specific inhibitor of c-Src previously shown to
inhibit the expression of both IL-8 and MCP-1 in Ad19-infected
HCFs, also blocked JNK phosphorylation after infection.
CONCLUSIONS. The MKK7/JNK/c-Jun cascade is rapidly activated
and mediates MCP-1 expression in Ad19-infected HCFs. Furthermore, the activation of c-Src on Ad19 infection appears to
regulate both the ERK and the JNK pathways. (Invest Ophthalmol Vis Sci. 2005;46:3777–3782) DOI:10.1167/iovs.05-0724
H
uman adenoviruses (Ad) have been identified as major
pathogens in eye, gastrointestinal, and respiratory infections.1 They are classified into six subgroups or species (A-F),
comprising 51 serotypes. Epidemic keratoconjunctivitis (EKC),
the only ocular adenoviral infection with significant corneal
involvement, is typically caused by infection with either Ad8,
Ad19, or Ad37, all from subgroup D.2
From the Departments of 1Ophthalmology, 2Cell Biology, and
Microbiology and Immunology, the Molecular Pathogenesis of Eye
Infection Research Center, Dean A. McGee Eye Institute, University of
Oklahoma Health Sciences Center, Oklahoma City, Oklahoma.
Presented in part at the annual meeting of the Association for
Research in Vision & Ophthalmology, Fort Lauderdale, Florida, May
2005.
Supported by United States Public Health Service Grants RO1
EY13124 and P30 EY12190 and by a Lew R. Wasserman Merit Award
(JC) from Research to Prevent Blindness, Inc.
Submitted for publication June 8, 2005; accepted August 19, 2005.
Disclosure: J. Xiao, None; J. Chodosh, None
The publication costs of this article were defrayed in part by page
charge payment. This article must therefore be marked “advertisement” in accordance with 18 U.S.C. §1734 solely to indicate this fact.
Corresponding author: James Chodosh, DMEI-OUHSC, 608 Stanton L. Young Boulevard, Oklahoma City, OK 73104;
[email protected].
3
Keratocytes, the resident cells of the corneal stroma, maintain the cornea in a precisely organized and transparent state.3
Moreover, keratocytes play an active role in host responses to
injury by production of a variety of cytokines and chemokines,
such as IL-1, IL-6, IL-8, monocyte chemoattractant protein
(MCP)-1, TNF-␣, RANTES, and granulocyte– colony-stimulating
factor (G-CSF), and expression of adhesion molecules including intercellular adhesion molecule (ICAM)-1.4 – 6 We have previously suggested that proinflammatory mediator expression
by Ad-infected keratocytes within the superficial corneal
stroma may play a role in the chronic and recurrent subepithelial stromal inflammation associated with EKC.7
MCP-1, a member of the CC subfamily of chemokines, is
chemotactic for monocytes, basophils, CD4⫹ and CD8⫹ lymphocytes, and T lymphocytes of the activated memory subset.8
MCP-1 has been implicated as an important mediator of monocyte and lymphocyte infiltration of tissues in a wide variety of
inflammatory diseases, such as glomerulonephritis, rheumatoid
arthritis, and bacterial meningitis (for a review, see Luster9). It
has been shown that inhibiting MCP-1 expression results in
reduced transmigration of monocytes through blood vessels10
and in diminished recruitment of T lymphocytes,8 suggesting a
critical role in acute inflammation. Human keratocytes produce
MCP-1 in response to a variety of cytokines, including IL-1␣ and
TNF-␣, and to lipopolysaccharide.6 We previously demonstrated, by DNA microarray studies, increased MCP-1 mRNA
expression in Ad19-infected keratocytes in vitro.11,12 However,
the mechanism(s) that mediate MCP-1 production in keratocytes remain largely unknown.
One means by which signals from extracellular stimuli are
transmitted to the nucleus to impact proinflammatory gene
expression is the activation of the mitogen-activated protein
kinase (MAPK) superfamily (for a review, see Johnson and
Lapadat13). In mammalian cells, there are three well-characterized MAPK subfamilies, including the ERK1/2, p38, and c-Jun
N-terminal stress-activated protein kinases (JNKs). The ERK1/2
pathway preferentially regulates cell growth and differentiation. The p38 and JNK pathways are activated in response to a
variety of stress inducers, including heat shock and UV irradiation.14,15 MAPK has been shown to be activated by Ad infection in several distinct in vitro models. For example, Ad5
infection of immortalized epithelial cell lines activated ERK,
p38 MAPK, and JNK pathways.16,17 Ad7 infection of A549
human lung carcinoma cells activated ERK1/2, leading to IL-8
expression.18 We showed that Ad19 infection of cultured keratocytes activated ERK1/2, and this activation mediated the
expression of IL-8 by these cells.11
In the present study, we focused on the activation of the JNK
signaling cascade and its potential role in MCP-1 activation in
Ad19-infected keratocytes. We demonstrate that Ad19 induces
MKK7/JNK/c-Jun activation in these cells in vitro, which results in
increased MCP-1 expression at the mRNA and protein levels.
METHODS
Antibodies and Reagents
Antibodies to MKK4, MKK7, JNK, phospho-MKK4, and phosphoMKK7 were obtained from Cell Signaling Technology (Beverly, MA),
Investigative Ophthalmology & Visual Science, October 2005, Vol. 46, No. 10
Copyright © Association for Research in Vision and Ophthalmology
Downloaded From: http://iovs.arvojournals.org/pdfaccess.ashx?url=/data/journals/iovs/933436/ on 08/03/2017
3777
3778
Xiao and Chodosh
and those to c-Jun, phospho-c-Jun, and phospho-JNK were obtained
from Santa Cruz Biotechnology (Santa Cruz, CA). The anti– human
MCP-1 antibody and the biotin-conjugated anti– human MCP-1 antibody
were from BD PharMingen (San Diego, CA). The Src inhibitor PP2, JNK
inhibitor SP600125, and MEK inhibitor PD098059 were purchased
from Calbiochem (La Jolla, CA). Actinomycin D was purchased from
Invitrogen (Carlsbad, CA).
Cell Culture and Viruses
IOVS, October 2005, Vol. 46, No. 10
nescence (ECL) kit (Amersham, Piscataway, NJ). Densitometric analysis of immunoblots where indicated was performed (ImageQuant 5.2;
Amersham, Piscataway, NJ) in the linear range of detection, and absolute values were then normalized.
JNK Assay
JNK activity was determined (JNK Assay Kit; Cell Signaling Technology). Briefly, endogenous JNK was immunoprecipitated from 250 ␮g
cell lysate with an N-terminal c-Jun (1– 89) fusion protein bound to
glutathione Sepharose beads overnight at 4°C. Precipitates were
washed twice with lysis buffer and twice with kinase buffer (25 mM
Tris, pH 7.5, 5 mM ␤-glycerophosphate, 2 mM dithiothreitol (DTT), 0.1
mM Na3VO4, and 10 mM MgCl2). The kinase reaction was initiated by
the addition of cold adenosine triphosphate (ATP; 100 ␮M). After the
cells were incubated for 30 minutes at 30°C, the reactions were
stopped with 3⫻ sample buffer. Proteins were resolved by 10% SDSPAGE followed by Western blot analysis. Membranes were probed
with antibodies against phospho-c-Jun (Ser 63).
Primary keratocytes were derived from donor corneas, as previously
described.19 Briefly, after mechanical debridement of the corneal epithelium and endothelium, corneas were cut into 2-mm diameter sections, and each section was placed in individual wells of six-well Falcon
tissue culture plates with Dulbecco’s modified Eagle’s medium
(DMEM) supplemented with 10% fetal bovine serum (FBS), penicillin G
sodium, and streptomycin sulfate at 37°C in 5% CO2. Corneal stromal
fragments were removed before confluence of each cell culture. Cells
from multiple donors were pooled, and the cell monolayers were used
at passage three. In the presence of 10% FBS, keratocytes maintain a
fibroblast phenotype and are referred to as human corneal fibroblasts
(HCFs). The fibroblast phenotype was confirmed by immunofluorescence staining with polyclonal anti–vimentin (positive reactivity) and
anti– cytokeratin (no reactivity) antibodies, as previously described.7
For inhibitor analysis, HCFs were pretreated with PP2 (10 ␮M),
SP600125 (10 ␮M), or PD098059 (50 ␮M) for 3 hours at 37°C before
infection. The cells were exposed to the inhibitors at the same concentrations throughout the infection process. Cell toxicity caused by
the inhibitors was ruled out after trypan blue exclusion on cells treated
with inhibitors for the same amount of time and at the same concentrations. The protocol for use of corneas from deceased human donors
was approved by the University of Oklahoma Institutional Review
Board and conformed to the tenets of the Declaration of Helsinki.
Ad19 was cultured directly from the cornea of a patient, as previously described,7 and was grown in lung carcinoma cells (A549 cells,
CCL 185; American Type Culture Collection, Manassas, VA) in MEM
with 2% FBS, penicillin G sodium, and streptomycin sulfate. The
Oklahoma State Department of Health confirmed the viral serotype.
Virus was purified from A549 cells by CsCl gradient, dialyzed against a
10 mM Tris (pH 8.0) buffer that contained 80 mM NaCl, 2 mM MgCl2,
and 10% glycerol, titered in triplicate, and stored at ⫺80°C.
Total RNA was isolated using a reagent (TRIzol; Invitrogen) according
to the manufacturer’s protocol. RNA concentrations were measured
spectrophotometrically, and the quality of each RNA sample was confirmed by calculating the ratio of optical density at 260:280 nm. A ratio
of 1.8 or higher indicated that samples contained only nondegraded
RNA. Reverse transcription of 1 ␮g RNA for cDNA synthesis was
performed, and quantitative real-time PCR was carried out (ABI Prism
7000 Sequence Detection System; PE Applied Biosystems, Foster City,
CA) according to the manufacturer’s instructions. Primers included the
following: MCP-1 (GenBank accession no. BC009716) forward, 5⬘
GCAATCAATGCCCCAGTCA 3⬘; reverse, 5⬘ TGCTGCTGGTGATTCTTCTATAGCT 3⬘; IL-8 (GenBank accession no. BT007067) forward, 5⬘
AGCTGGCCGTGGCTCTCT 3; reverse, 5⬘ CTGACATCTAAGTTCTTTAGCACTCCTT 3⬘; and GAPDH (GenBank accession no. X01677)
forward, 5⬘ ATTCCACCCATGGCAAATTC 3⬘; reverse, 5⬘ CGCTCCTGGAAGATGGTGAT 3⬘. Amplification curves were generated by monitoring the fluorescence of SYBR Green as a measure of its incorporation into the amplified product. GAPDH mRNA levels were used as an
internal control. The fold change in mRNA levels for MCP-1 and IL-8
was calculated using the 2-⌬⌬CT method, as previously described.20
Viral Infection
ELISA
Monolayer HCFs grown to 95% confluence in six-well plates were
washed in MEM with 2% FBS and were infected with purified Ad19 at
a multiplicity of infection (MOI) of 50 or mock infected with virus-free
dialysis buffer as a control. Virus was adsorbed at 37°C for 1 hour and
then incubated for 1 additional hour before RNA isolation. For protein
analyses, HCFs grown to 95% confluence in six-well plates were serumstarved for 18 to 24 hours before infection and were lysed after
infection at the indicated time points.
HCFs were infected in 48-well plates with purified Ad19 or were mock
infected with virus-free dialysis buffer as a control. Culture media were
collected 4 hours after infection, and the levels of MCP-1 were quantified by sandwich ELISA using capture and detection antibodies. The
detection limit was 10 pg/mL. Plates were read on a microplate reader
(SpectraMax M2; Molecular Devices, Sunnyvale, CA) and were analyzed with analysis software (SOFTmax; Molecular Devices). Means of
triplicate ELISA values for each of the virus- and mock-infected wells
were compared by ANOVA with Scheffé’s multiple comparison test.
Statistical significance was set at alpha ⫽ 0.01.
Immunoblot Analysis
Ad19- and mock-infected HCFs were lysed with chilled cell lysis buffer
(20 mM Tris, pH 7.4, 150 mM NaCl, 1 mM EDTA, 1 mM EGTA, 1%
Triton X-100, 2.5 mM sodium pyrophosphate, 1 mM ␤-glycerol phosphate, 1 mM Na3VO4, 1 ␮g/mL leupeptin, and 1 mM phenylmethylsulfonyl fluoride [PMSF]) and were incubated at 4°C for 5 minutes. Cell
lysates were cleared by centrifugation at 21,000g for 15 minutes. The
protein concentration of each supernatant was measured by BCA
analysis (Pierce, Rockford, IL) and equalized. Cell lysates were subsequently separated by 10% SDS-PAGE and transferred onto nitrocellulose membranes (BioRad, Hercules, CA). The membranes were
blocked for 1 hour with 4% BSA in TTBS (0.05% Tween-20) and
incubated with primary antibody at 4°C overnight. After three washes
for 10 minutes each in TTBS, the membranes were incubated with
peroxidase-conjugated secondary antibodies for 1 hour at room temperature, washed again, and visualized with an enhanced chemilumi-
Real-Time PCR
RESULTS
JNK Is Activated in Ad19-Infected Human
Corneal Fibroblasts
We have previously shown that infection of HCFs by Ad19
activates the tyrosine kinases c-Src and ERK1/2 and that
ERK1/2 acts downstream of c-Src.11 Because JNK has also been
shown to be activated by Src kinases,21 we first examined
whether JNK was activated in HCFs in response to Ad19
infection. HCFs were Ad19 or mock infected for 15 and 30
minutes before cell lysis. Cell lysates were prepared for Western blot analysis and JNK assay using appropriate antibodies.
The phospho-JNK antibodies used recognize JNK only when
Downloaded From: http://iovs.arvojournals.org/pdfaccess.ashx?url=/data/journals/iovs/933436/ on 08/03/2017
JNK, MCP-1, and Ad19
IOVS, October 2005, Vol. 46, No. 10
3779
FIGURE 2. Effect of Ad19 infection on c-Jun phosphorylation in HCFs.
By Western blot analysis, Ad19 infection–induced phosphorylation of
c-Jun was apparent at 15 and 30 minutes after infection. There was also
an observed increase in total c-Jun protein at 30 minutes after infection, but densitometric analysis (relative fold difference shown above
the blot) revealed an increase in phosphorylation of c-Jun even when
the change in total c-Jun was taken into account.
Ad19 Infection Results in Phosphorylation of
MKK7 but Not MKK4
FIGURE 1. Effect of Ad19 infection on JNK activation in HCF. (A) Cells
were infected with Ad19 or mock infected with virus-free dialysis
buffer for 15 or 30 minutes. Cells were then lysed, and cell lysates were
subjected to Western blot analysis with antibodies against JNK and
phospho-JNK. Reactivity against the 46- and 54-kDa forms of phosphoJNK was seen at both time points in the Ad19-infected cells. (B) In vitro
JNK assay performed at 30 minutes after infection shows increased
phosphorylation of the c-Jun substrate signifying JNK activity on Ad19
infection of HCFs.
MKK4 and MKK7 function as upstream activators of JNK by
phosphorylation at JNK threonine 183 and tyrosine 185 residues.14 To demonstrate whether MKK4 or MKK7 is phosphorylated in Ad19 infection of HCFs, lysates from Ad19- or mockinfected HCFs were subjected to Western blot analysis using
antibodies against phosphorylated and total MKK4 and MKK7.
As shown in Figure 3, MKK7 was phosphorylated by Ad19
infection of HCF at 15 and 30 minutes after infection, whereas
MKK4 was not. These observations suggest that activation of
JNK in Ad19-infected HCFs may be dependent on the activation of MKK7 but not of MKK4.
c-Src Regulates JNK Activation
phosphorylated on threonine 183 and tyrosine 185 residues. As
shown in Figure 1A, infection of HCFs with Ad19 resulted in an
increase in both phosphorylated forms of JNK (46 and 54 kDa)
at 15 and 30 minutes after infection, whereas total JNK levels
remained unchanged.
JNK activity was further examined by kinase assay. The
activity of immunoprecipitated JNK from Ad19- or mock-infected HCFs was assayed using an exogenous GST– c-Jun fusion
protein as substrate. Ad19 induced an increase in the ability of
JNK to phosphorylate GST– c-Jun substrate at 30 minutes after
infection compared with mock treatment (Fig. 1B).
As discussed, we have previously shown that the tyrosine
kinase c-Src is rapidly activated in HCFs in response to Ad19
Phosphorylation of c-Jun by Ad19
One of the main downstream substrates for activated JNK is the
transcription factor c-Jun (for a review, see Davis14). JNK
phosphorylates c-Jun at serine residues 63 and 73, and activated c-Jun in turn binds to 12-O-tetradecanoylphorbol-13-acetate (TPA) response elements.14 To determine whether Ad19
infection of HCF also results in c-Jun phosphorylation, lysates
from Ad19- or mock-infected HCFs were subjected to Western
blot analysis using antibodies against phosphorylated and total
c-Jun. As shown in Figure 2, infection of HCF by Ad19 resulted
in increased c-Jun phosphorylation at 15 and 30 minutes after
infection. Notably, total c-Jun also increased at 30 minutes after
infection. However, densitometry performed on phosphorylated and total c-Jun bands still showed a relative increase in
c-Jun phosphorylation at 30 minutes when normalized for total
c-Jun. By densitometry, infection with Ad19 increased c-Jun
phosphorylation by 5.8- and 2.3-fold at 15 and 30 minutes after
infection, respectively (Fig. 2).
FIGURE 3. Phosphorylation of MKK4 and MKK7 in HCFs on Ad19
infection. Western blot analysis of phosphorylated and total MKK4 and
MKK7 at 15 and 30 minutes after Ad19 infection reveals phosphorylation of MKK7 but not of MKK4 at both time points.
Downloaded From: http://iovs.arvojournals.org/pdfaccess.ashx?url=/data/journals/iovs/933436/ on 08/03/2017
3780
Xiao and Chodosh
IOVS, October 2005, Vol. 46, No. 10
FIGURE 4. Analysis of relationship between c-Src and JNK in Ad19infected HCFs. Cells were incubated with the Src inhibitor PP2 (10
␮M) before Ad19 or mock infection. Thirty minutes after infection,
Western blot analysis using antibodies against phospho-JNK and total
JNK reveals a reduction in phospho-JNK reactivity when the cells were
pretreated with PP2, consistent with JNK acting downstream of c-Src
in the signaling cascade induced by infection.
infection.11 Given that JNK has been shown to be an important
downstream target for activated Src kinases,21 we sought to
examine whether the activation of JNK is regulated by c-Src.
HCFs were preincubated with PP2 (10 ␮M), a selective inhibitor of Src kinase family members,22 followed by Ad19 or mock
infection. Cell lysates were prepared at 30 minutes after infection and were analyzed by Western blotting. As seen in Figure
4, 10 ␮M PP2 dramatically reduced Ad19-induced JNK phosphorylation, suggesting that JNK acts downstream of c-Src in
Ad19-infected HCFs.
Ad19-Induced MCP-1 mRNA Expression Is
Reduced by the JNK-Specific Inhibitor SP600125
By DNA microarray analysis, we have previously shown that
Ad19 upregulates MCP-1 mRNA expression in HCFs and that
the c-Src inhibitor PP2 reduces MCP-1 mRNA levels, suggesting
that c-Src regulates MCP-1 expression at the transcriptional
level.11 Because MAPK may act downstream of c-Src, we investigated whether JNK or ERK1/2 is responsible for the expression of this proinflammatory mediator. Reverse-transcription
PCR suggested that MCP-1 transcription was reduced in the
presence of SP600125 (10 ␮M), a specific JNK inhibitor (Fig.
5).23 Subsequent quantitative real-time PCR was performed to
compare the levels of MCP-1 mRNA in Ad19-infected cells with
those in mock-infected HCFs, in the presence or absence of
SP600125 and PD098059, the latter a specific inhibitor of
ERK1/2 activation.24 As shown in Table 1, the level of MCP-1
mRNA was increased 5.1-fold by Ad19 compared with mock
infection, whereas SP600125 reduced the MCP-1 mRNA level
in Ad19-infected cells to 1.6-fold over mock-infected cells.
SP600125 had no effect on IL-8 mRNA levels (data not shown).
Interestingly, the ERK1/2 activation inhibitor PD098059 failed
to reduce MCP-1 mRNA levels (data not shown), indicating that
the activation of JNK, but not of ERK1/2, is required for
Ad19-induced transcription of MCP-1.
To determine whether Ad19 infection directly upregulates
MCP-1 transcription or merely increases the stability of MCP-1
mRNA, HCFs were also infected in the presence or absence of
actinomycin D (10 ␮g/mL), an inhibitor of RNA polymerase. By
real-time PCR, actinomycin D lowered MCP-1 mRNA levels in
Ad19-infected HCF to levels similar to those of mock-infected
control cells, suggesting a direct effect of Ad19 infection on
MCP-1 transcription (data not shown).
FIGURE 5. RT-PCR analysis of MCP-1 expression after Ad19 infection.
HCFs were mock infected, infected with Ad19, or pretreated with the
JNK inhibitor SP600125 (10 ␮M) before infection. One hour after
infection, MCP-1 mRNA levels were increased in the Ad19-infected
cells, and this increase was blocked by pretreatment with SP600125,
suggesting that MCP-1 transcription in Ad19-infected HCFs occurs
downstream of JNK activation. GAPDH mRNA levels are also shown as
a control.
Ad19-Induced MCP-1 Protein Expression Is
Reduced by the JNK-Specific Inhibitor SP600125
We also tested MCP-1 expression at the protein level with
ELISA. As shown in Figure 6, Ad19 infection significantly increased MCP-1 levels in HCF compared with mock-infected
control cells (1281.9 ⫾ 69.6 vs. 292.5 ⫾ 9.6 pg/mL), whereas
SP600125 (10 ␮M) reduced MCP-1 expression by Ad-19 –infected HCF (231.0 ⫾ 16.0 vs. 1281.9 ⫾ 69.6; P ⬍ 0.01, both
comparisons). These observations suggest that the activation of
JNK is required for MCP-1 gene transcription and subsequent
protein synthesis in Ad19-infected HCFs.
DISCUSSION
Adenoviral internalization into target cells is an active cellmediated process that uses intracellular signaling to direct
clathrin-mediated endocytosis of the virus.25 The initial attachment of adenoviruses to the cell is mediated by interaction
between the penton fiber knob, the viral capsid protein most
distal from the viral surface, and on the cellular side either CAR
(coxsackievirus and Ad receptor)26 or CD46 (membrane cofactor protein).27–29 This primary interaction facilitates an essential secondary interaction between the viral penton base proTABLE 1. Real-Time PCR Analysis of the Effect of the JNK Inhibitor
SP600125 on Ad19-Induced MCP-1 mRNA Expression
Treatment
Fold Increase
Ad19/mock
Ad19 plus SP600125 (10 ␮M)/mock
5.1
1.6
Downloaded From: http://iovs.arvojournals.org/pdfaccess.ashx?url=/data/journals/iovs/933436/ on 08/03/2017
JNK, MCP-1, and Ad19
IOVS, October 2005, Vol. 46, No. 10
FIGURE 6. ELISA analysis of MCP-1 expression after Ad19 infection.
HCFs were mock infected, infected with Ad19, or infected with Ad19
after pretreatment with the JNK inhibitor SP600125 (10 ␮M). At 4
hours after infection, MCP-1 protein levels were significantly increased,
and this increase was blocked by pretreatment with SP600125 (P ⬍
0.01, both comparisons), suggesting that MCP-1 transcription in Ad19infected HCF occurs downstream of JNK activation. Error bars represent the SD of the mean. The ELISA shown is representative of three
independent experiments with similar results.
tein on the proximal surface of the viral capsid and the cellular
integrins ␣v␤3 or ␣v␤5 (for a review, see Chang and Karin30).
This latter contact causes aggregation of the integrins and
induces virus internalization through a phosphoinositide-3 kinase– dependent pathway.31 Coincident intracellular signaling
events associated with integrin aggregation after adenoviral
binding have evoked considerable interest with regard to adenoviral gene therapy. For example, a recombinant Ad5 vector
was shown to activate ERK1/2, p38, and JNK2 in cultured
rheumatoid synoviocytes,32 and similar signaling events in immortalized epithelial cells lines led to the upregulation of IL-816
and ICAM-1,17 events not thought beneficial to the success of
gene therapy. In this light, we previously found that Ad19
binding to HCF activates the non–receptor tyrosine kinase
c-Src and its downstream target, ERK1/2, and that the activity
of both kinases is necessary for subsequent IL-8 expression.11
We show here that Ad19 infection of HCFs leads to activation
of the JNK pathway, also downstream of c-Src, and that this
activation leads to increased expression of MCP-1.
The stress-induced JNK cascade is activated in response to
many environmental stimuli and acts on multiple cellular functions.14 In particular, the JNK pathway influences the expression of proinflammatory mediators, including IL-6, IL-8,
ICAM-1, MCP-1,33,34 cyclooxygenase-2 (COX-2), and prostaglandin E2 (PGE2),32 consistent with its central role in inflammation. We show that the activation of JNK directly or indirectly induces MCP-1 because the JNK inhibitor SP600125
reduced MCP-1 mRNA and protein expression. In contrast,
SP600125 at the same concentration (10 ␮M) had no effect on
IL-8 mRNA and protein expression (data not shown), previously shown to be under the regulation of ERK1/2.11 Taken
together, our findings suggest that the JNK pathway is important to MCP-1 but not IL-8 expression. The human MCP-1
promoter contains binding sites for AP-1 and NF-␬B, whereas
the IL-8 promoter contains binding sites for AP-1, NF-␬B, and
NF-IL6.35 One of the plausible explanations for our findings is
3781
that MCP-1 regulation by the JNK pathway is largely mediated
by the AP-1 sites, whereas IL-8 regulation by the ERK1/2 cascade may be more dependent on NF-␬B or NF-IL6. We also
recently observed in Ad19-infected HCFs that p38 is activated
and acts downstream of c-Src and that its activation increases
the expression of IL-8 but not of MCP-1 (JX and JC, unpublished observation, 2005). Taken together, these studies suggest a prominent role for c-Src in the regulation of downstream
MAPK activation and serve to focus our attention on the
MAPKs as proteins that may determine the specificity of chemokine induction in infection. Interestingly, we also noted the
increased expression of total c-Jun protein at 30 or more
minutes after infection in repeated experiments, consistent
with prior evidence that Ad19 infection induces the transcription of c-Jun.11 However, the increased phosphorylation of
c-Jun resulting from Ad19 infection was seen as early as 15
minutes after infection, before any increase in total c-Jun protein.
The development of chronic multifocal subepithelial corneal infiltrates after acute infection is one of the hallmarks of
EKC36 and is a major cause of long-term morbidity in the
disorder.37 Cellular components of the infiltrates in human
EKC remain unknown. Experimentally, infiltrating cells within
the corneal stroma of scarified, Ad8-infected cotton rats were
primarily polymorphonuclear neutrophils.38 Later in the
course of infection in rabbits that received intracorneal injections of Ad5, CD4⫹ and CD8⫹ T lymphocytes and CD18⫹ cells
predominated within corneal stromal infiltrates.39 Our previous demonstration that the infection of human corneal fibroblasts in vitro with Ad19 induces the upregulation of IL-8
protein,7 the paradigm chemoattractant for neutrophils, together with data presented herein that infected corneal fibroblasts also express increased MCP-1 protein, known to be
chemotactic for lymphocytes and monocytes, suggest that increased expression of chemokines by infected keratocytes may
be responsible for the formation of subepithelial infiltrates in
human EKC. The characterization of MCP-1 as a target gene for
the JNK signaling cascade on Ad19 infection of human corneal
cells implicates JNK as an important mediator of inflammation
in adenovirus keratitis. Along with c-Src and ERK1/2, JNK may
provide a potential therapeutic target in the corneas of human
patients with EKC.
Acknowledgment
The authors thank Roger Astley for assisting with cell cultures and virus
purification.
References
1. Lukashok SA, Horwitz MS. New perspectives in adenoviruses. Curr
Clin Top Infect Dis. 1998;18:286 –305.
2. Kemp MC, Hierholzer JC, Cabradilla CP, Obijeski JF. The changing
etiology of epidemic keratoconjunctivitis: antigenic and restriction
enzyme analyses of adenovirus types 19 and 37 isolated over a
10-year period. J Infect Dis. 1983;148:24 –33.
3. Muller LJ, Pels L, Vrensen GF. Novel aspects of the ultrastructural
organization of human corneal keratocytes. Invest Ophthalmol Vis
Sci. 1995;36:2557–2567.
4. Kennedy M, Kim KH, Harten B, et al. Ultraviolet irradiation induces
the production of multiple cytokines by human corneal cells.
Invest Ophthalmol Vis Sci. 1997;38:2483–2491.
5. Hong J-W, Liu JJ, Lee J-S, et al. Proinflammatory chemokine induction in keratocytes and inflammatory cell infiltration into the cornea. Invest Ophthalmol Vis Sci. 2001;42:2795–2803.
6. Kumagai N, Fukuda K, Fujitsu Y, Lu Y, Chikamoto N, Nishida T.
Lipopolysaccharide-induced expression of intercellular adhesion
molecule-1 and chemokines in cultured human corneal fibroblasts.
Invest Ophthalmol Vis Sci. 2005;46:114 –120.
Downloaded From: http://iovs.arvojournals.org/pdfaccess.ashx?url=/data/journals/iovs/933436/ on 08/03/2017
3782
Xiao and Chodosh
7. Chodosh J, Astley RA, Butler MG, Kennedy RC. Adenovirus
keratitis: a role for interleukin-8. Invest Ophthalmol Vis Sci. 2000;
41:783–789.
8. Carr MW, Roth SJ, Luther E, Rose SS, Springer TA. Monocyte
chemoattractant protein 1 acts as a T-lymphocyte chemoattractant.
Proc Natl Acad Sci USA. 1994;91:3652–3656.
9. Luster AD. Mechanisms of disease: chemokines– chemotactic cytokines that mediate inflammation. N Engl J Med. 1998;338:436 –
445.
10. Randolph GJ, Furie MB. A soluble gradient of endogenous monocyte chemoattractant protein-1 promotes the transendothelial migration of monocytes in vitro. J Immunol. 1995;155:3610 –3618.
11. Natarajan K, Rajala MS, Chodosh J. Corneal IL-8 expression following adenovirus infection is mediated by c-Src activation in human
corneal fibroblasts. J Immunol. 2003;170:6234 – 6243.
12. Natarajan K, Shepard LA, Chodosh J. The use of DNA array technology in studies of ocular viral pathogenesis. DNA Cell Biol.
2002;21:483– 490.
13. Johnson GL, Lapadat R. Mitogen-activated protein kinase pathways
mediated by ERK, JNK, and p38 protein kinases. Science. 2002;
298:1911–1912.
14. Davis RJ. Signal transduction by the JNK group of MAP kinases.
Cell. 2000;103:239 –252.
15. Chang L, Karin M. Mammalian MAP kinase signaling cascades.
Nature. 2001;410:37– 40.
16. Bruder JT, Kovesdi I. Adenovirus infection stimulates the Raf/
MAPK signaling pathway and induces interleukin-8 expression.
J Virol. 1997;71:398 – 404.
17. Tamanini A, Rolfini R, Nicolis E, Melotti P, Cabrini G. MAP kinases
and NF-␬B collaborate to induce ICAM-1 gene expression in the
early phase of adenovirus infection. Virology. 2003;307:228 –242.
18. Alcorn MJ, Booth JL, Coggeshall KM, Metcalf JP. Adenovirus type
7 induces interleukin-8 production via activation of extracellular
regulated kinase 1/2. J Virol. 2001;75:6450 – 6459.
19. Cubitt CL, Tang Q, Monteiro CA, Lausch RN, Oakes JE. IL-8 gene
expression in cultures of human corneal epithelial cells and keratocytes. Invest Ophthalmol Vis Sci. 1993;34:3199 –3206.
20. Livak KJ, Schmittgen TD. Analysis of relative gene expression data
using real-time quantitative PCR and the 2-⌬⌬CT method. Methods.
2001;25:402– 408.
21. Yoshizumi M, Abe J, Haendeler J, Huang Q, Berk BC. Src and Cas
mediate JNK activation but not ERK1/2 and p38 kinases by reactive oxygen species. J Biol Chem. 2000;275:11706 –11712.
22. Hanke JH, Gardner JP, Dow RL, et al. Discovery of a novel, potent,
and Src family-selective tyrosine kinase inhibitor: study of Lck- and
FynT-dependent T cell activation. J Biol Chem. 1996;271:695–701.
23. Bennett BL, Sasaki DT, Murray BW, et al. SP600125, an anthrapyrazolone inhibitor of Jun N-terminal kinase. Proc Natl Acad Sci USA.
2001;98:13681–13686.
IOVS, October 2005, Vol. 46, No. 10
24. Dudley DT, Pang L, Decker SJ, Bridges AJ, Saltiel AR. A synthetic
inhibitor of the mitogen-activated protein kinase cascade. Proc
Natl Acad Sci USA. 1995;92:7686 –7689.
25. Wang K, Huang S, Kapoor-Munshi A, Nemerow G. Adenovirus
internalization and infection require dynamin. J Virol. 1998;72:
3455–3458.
26. Bergelson JM, Cunningham JA, Droguett G, et al. Isolation of a
common receptor for Coxsackie B viruses and adenoviruses 2 and
5. Science. 1997;275:1320 –1323.
27. Gaggar A, Shayakhmetov DM, Lieber A. CD46 is a cellular receptor
for group B adenoviruses. Nat Med. 2003;9:1408 –1412.
28. Segerman A, Atkinson JP, Marttila M, Dennerquist V, Wadell G,
Arnberg N. Adenovirus type 11 uses CD46 as a cellular receptor.
J Virol. 2003;77:9183–9191.
29. Wu E, Trauger SA, Pache L, et al. Membrane cofactor protein is a
receptor for adenoviruses associated with epidemic keratoconjunctivitis. J Virol. 2004;78:3897–3905.
30. Nemerow GR, Stewart PL. Role of ␣v integrins in adenovirus cell
entry and gene delivery. Microbiol Mol Biol Rev. 1999;63:725–
734.
31. Li E, Stupack D, Klemke R, Cheresh DA, Nemerow GR. Adenovirus
endocytosis via ␣v integrins requires phosphoinositide-3-OH kinase. J Virol. 1998;72:2055–2061.
32. Crofford LJ, McDonagh KT, Guo S, et al. Adenovirus binding to
cultured synoviocytes triggers signaling through MAPK pathways
and induces expression of cyclooxygenase-2. J Gene Med. 2005;
7:288 –296.
33. Arndt PG, Suzuki N, Avdi NJ, Malcolm KC, Worthen GS. Lipopolysaccharide-induced c-Jun NH2-terminal kinase activation in human neutrophils: role of phosphatidylinositol 3-Kinase and Sykmediated pathways. J Biol Chem. 2004;279:10883–10891.
34. Lund S, Porzgen P, Mortensen AL, et al. Inhibition of microglial
inflammation by the MLK inhibitor CEP-1347. J Neurochem. 2005;
92:1439 –1451.
35. Roebuck KA, Carpenter LR, Lakshminarayanan V, Page SM, Moy
JN, Thomas LL. Stimulus-specific regulation of chemokine expression involves differential activation of the redox-responsive transcription factors AP-1 and NF-␬B. J Leukoc Biol. 1999;65:291–298.
36. Gordon YJ, Aoki K, Kinchington PR. Adenovirus keratoconjunctivitis. In: Pepose JS, Holland GN, Wilhelmus KR, eds. Ocular Infection and Immunity. St. Louis, MO: CV Mosby;1996:877– 894.
37. Butt AL, Chodosh J. Adenoviral keratoconjunctivitis in a tertiary
care eye clinic. Cornea. In press.
38. Tsai JC, Garlinghouse G, McDonnell PJ, Trousdale MD. An experimental animal model of adenovirus-induced ocular disease: the
cotton rat. Arch Ophthalmol. 1992;110:1167–1170.
39. Trousdale MD, Nobrega R, Wood RL, et al. Studies of adenovirusinduced eye disease in the rabbit model. Invest Ophthalmol Vis
Sci. 1995;36:2740 –2748.
Downloaded From: http://iovs.arvojournals.org/pdfaccess.ashx?url=/data/journals/iovs/933436/ on 08/03/2017