Download Sequencing and analysis of the nucleocapsid (N) and polymerase (L)

Survey
yes no Was this document useful for you?
   Thank you for your participation!

* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project

Transcript
Journal of General Virology (1995), 76, 593-602. Printed in Great Britain
593
Sequencing and analysis of the nucleocapsid (N) and polymerase (L)
genes and the terminal extragenic domains of the vaccine strain of
rinderpest virus
Michael D. Baron* and Tom Barrett
A F R C Institute for Animal Health, Pirbright Laboratory, Ash Road, Woking, Surrey GU24 ONF, UK
The nucleocapsid (N) and polymerase (L) genes of the
vaccine strain of rinderpest, and the 5' and 3' terminal
domains of the genome have been sequenced. Together
with previously published data, this completes the
sequence of the entire genome of rinderpest virus. The
viral genome is 15 881 bases in length, similar to that of
measles virus and slightly longer than that of canine
distemper virus. The L gene is identical in length to that
of measles virus, encoding a 2183 amino acid protein
with a calculated M r of 248 100. The L protein sequence
ofmorbilliviruses is highly conserved, more than 75 % of
residues being identical or conserved in all three
sequences currently available. The N protein was, as for
the other sequenced genes where comparison is possible,
essentially identical to that of the virulent parent. In
addition, we have determined the terminal sequences of
two virulent strains of rinderpest and compared the
sequences of virulent and non-virulent strains.
Introduction
contains six genes, encoding the surface glycoproteins H
and F, responsible for viral attachment to and fusion
with the host cell, the nucleocapsid (N) protein, the
envelope matrix (M) protein, the polymerase or large (L)
protein and the polymerase-associated (P) protein; the
gene order (3' to 5' on the genome) is N P - M - F - H - L ,
as determined by transcriptional mapping for MV, CDV
and RPV (Barrett et al., 1991; Dowling et al., 1986;
Rima et al., 1986). The P gene also encodes the nonstructural proteins C and V (Baron et al., 1993). Short
extragenic sequences are found at the 5' and 3' ends of
the genome. As part of our investigations into virulence
factors in RPV, we have cloned the entire genome of the
vaccine strain (RPV-R), sometimes known as the
Plowright vaccine. This strain was derived by repeated
passage in primary bovine kidney cells (Plowright &
Ferris, 1962) from the virulent Kabete 'O' strain (RPVK), first isolated in 1911. In previous work we have
determined the sequences of the F (Evans et al., 1994)
and H (Chamberlain, 1992) genes, the P gene (Baron et
al., 1993) and the M gene (Baron et al., 1994). We report
here the sequences of the N and L genes of RPV-R,
together with the 5' and 3' terminal sequences. These
data complete the first full sequence of a strain of
rinderpest virus.
Rinderpest virus (RPV) belongs to the morbilliviruses, a
genus of the family Paramyxoviridae, and is thus related
to measles virus (MV), canine and phocid distemper
viruses (CDV and PDV) and peste-des-petits ruminants
virus (PPRV). Rinderpest, the disease, is economically
highly important, affecting domestic cattle and wild
bovids. Widespread in sub-Saharan Africa in the mid1980s, it has now been restricted to parts of East Africa
by the efforts of the Pan African Rinderpest Campaign
(PARC). The disease remains enzootic in most of the
Indian subcontinent, as well as several countries in the
Near and Middle East, with recent outbreaks in Oman,
the United Arab Emirates, Saudi Arabia and Turkey.
All the morbilliviruses are related serologically, and
available sequence data shows that there is a high degree
of homology at the sequence level (for review see Barrett
et al., 1991).
The Paramyxoviridae possess an ssRNA genome of
negative polarity; in the morbilliviruses this genome
* Author for correspondence. Fax +44 1483232448. e-mail
[email protected]
All the sequencespresentedin this paper havebeen submittedto the
EMBLdatabase. Accessionnumbersare: RPV-R3' extragenicregion,
Z30701; RPV-R N gene, X68311; RPV-R L gene and 5' extragenic
region, Z30698; RPV-K 3' extragenic region, Z33634; RPV-K 5"
extragenicregion,Z33635; RPV-Kw3' extragenicregionand N gene,
Z34262; RPV-Kw5' extragenicregion,Z33636;entireRPV-Rgenome,
Z30697.
0001-2775 © 1995SGM
Methods
RNA purification and cDNA library construction. Poly(A)÷RNA was
isolated fromRPV-R infectedVero cellsand oligo(dT)-primedcDNA
synthesizedas previouslydescribed (Baron et al., 1993); EcoRI-NotI
adaptors (Pharmacia) were added, the cDNA ligated to 2gtll arms
Downloaded from www.microbiologyresearch.org by
IP: 78.47.19.138
On: Sun, 02 Oct 2016 20:14:21
594
M. D. Baron and T. Barrett
(Boehringer Mannheim) and packaged using GigaPack (Stratagene).
For the genomic library, virus was partially purified from the medium
of infected Vero cells by sucrose density gradient centrifugation
(Barrett et al., 1989). RNA was purified by two sequential extractions
with phenol, one extraction with phenol~chloroform-isoamyl alcohol
(25:24: 1, by vol.) and one with chloroform-isoamyl alcohol (24: 1,
v/v), precipitated with ethanol and dissolved in diethyl pyrocarbonatetreated water. Random hexanncleotides (Boehringer Mannheim) were
used to prime eDNA synthesis and the eDNA ligated into 2gtll as
described above. Analysis of the fraction of insert-containing phage
that were positive for RPV-R sequence suggested that 40% of the
original RNA preparation was viral RNA. Viral RNA from another,
more recent, virulent Middle Eastern strain [Kuwait/g2/1 (Taylor,
1986); RPV-Kw] that had been passaged five times in Vero cells was
isolated in the same way. Total cytoplasmic RNA isolated from tissues
of a cow infected with RPV-K has previously been described (Baron et
al., 1994).
Full-length N clones were isolated from the first library by screening
with D-74, a previously identified N-gene specific eDNA (Diallo et al.,
1989). L gene-specific clones were isolated from the genomic library by
screening with the 4962 bp XmnI-XmnI fragment of the measles L gene
isolated from plasmid peMV(-)2ip (the kind gift of M. Billeter and R.
Cattaneo). Probes were either labelled with biotin-dUTP and positive
clones detected as previously described (Baron et al., 1993) or were
labelled and detected using the ECL direct-labelling system
(Amersham). The size of inserts in positive clones was determined by
PCR (Dorfman et al., 1989), and large inserts were cut from purified 2
DNA (Windle, 1988) with NotI and ligated into NotI-cut pBluescript
KS(+) (N clones) or pGEM-5Zf(+) (L clones).
Sequencing. A single eDNA clone (N1) spanning almost the entire
length of the N gene was identified, isolated and restriction fragments
subcloned into M13tgl30 for sequencing. The complete sequence was
determined on both strands. The ends of L-positive clones were
sequenced to map their position in the gene, and a set of overlapping
clones were identified that spanned almost the entire length of the gene.
Three clones (L17, L18 and L20) and part of a fourfll (L9) with a
combined length of 8 kb were sequenced on both strands from nested
deletion sets created using the Erase-a-Base system (Promega). A fulllength L gene was assembled in pGEM-5Zf( + ) from components of all
four L clones plus the terminal sequence isolated as below.
Determining the sequence o f the 5' and 3" ends o f the genome. The
leader and trailer sequences were determined using a modification of
the 5' RACE method (Frohman et al., 1988; Loh et al., 1989) as
developed by Shuster et al. (1992). Briefly, an mRNA-sense primer
corresponding to a sequence near the end of the L mRNA (RPVL1 :
5' GTAGGCTGGTGAGTAATCT Y) was annealed to RNA isolated
from partly purified virus (prepared as for library construction), and
extended using MMLV (mouse mammary leukaemia virus) reverse
transcriptase (Life Technologies). RNA was hydrolysed by adding
NaOH to 0-3 M and heating for 30 min at 50 °C. After neutralization by
adding HC1 to 0.3 M, the primer extension product was purified using
a Glass-Max spun column (Life Technologies), eluting the ssDNA in
50 gl of water; 10 pl of this ssDNA was then tailed with poly(dA) or
poly(dC) in a 201~1 reaction mixture containing 0.5x reverse
transcriptase buffer, 200pM-dATP or -dCTP and 10U terminal
deoxynucleotide transferase (Pbarmacia) for 5 rain at 37 °C (Shuster et
al., 1992). PCR was used to amplify 5 gl of the tailed DNA in a 50 gl
reaction mixture containing 100 pmol of a second L specific primer
(RPVL6: 5' GTAATCTCAAGTCTGGATACC 3') and 100 pmol of
either a NotI-(dT)a~ primer/adaptor (Pharmacia) or a special mixed
dG-dI primer (Y-RACE primer; Life Technologies). The amplification
conditions were: 94 °C, 5 min; 35 cycles of (94 °C, 45 s; 50 °C, 1 rain;
72 °C, 2 min); 72 °C, I5 rain. In the case of the dA-tailed cDNA, the
annealing temperature for the first two cycles was reduced to 30 °C.
Since other primer extension experiments suggested that the purified
virus contained significant quantities of anti-genomes (positive sense
RNA), we repeated the above procedure using primers corresponding
to the 3' end of the N gene (5' end of the N mRNA), amplifying DNA
fragments of the expected size in each case; the N primers used were
RPVN4 (5' CAAGCCATCCTTTGTCA 3') (primer extension) and
RPVN6 (5' TGATTCCCCGGATAGCC 3') (PCR). PCR amplified
DNA was gel-purified, cloned into pGEM-T (Promega) and sequenced
on both strands. Sequences were determined from at least three
independently amplified clones. The method was also successfully
applied to total cytoplasmic RNA from RPV-K-infected cattle; in this
case the PCR for the 3" end of the genome also produced an amplified
product from the N mRNA, sequencing of which confirmed the start
point of the N gene (see Results). In order to determine the exact 3' end
of the L gene we used the NotI-(dT)a 8 primer/adaptor to prime reverse
transcription on poly(A)+ RNA from RPV-R-infected cells, and then
PCR to amplify the terminal region using the primer/adaptor and
RPVLI as primers. The reaction conditions were essentially as
previously described (Baron et al., 1994).
The intergenic sequence between the F and H genes was determined
from clones of PCR-amplified vRNA. The amplification used primers
corresponding to F mRNA (F13: 5' CGGGTCTTAAACCAGACCTC 3') or complementary to H mRNA (H5 : 5' GATACCTGCGATAGCTAATAGCCCG Y). Sequence was determined from two independently amplified clones.
Computer analysis' o f sequence. Sequence data for different genes was
assembled using the Staden package (Staden, 1980, 1982); further
analysis used programs of the University of Wisconsin (GCG) package
(Genetics Computer Group, 1991). Protein alignment figures were
produced with the help of the program ALSCRIPT (Barton, 1993).
Results and Discussion
Of several isolated N gene-specific clones, one (N1) was
chosen for complete sequencing. The clone began at
genome position 80 and extended to the poly(A) tail. The
3' end of the gene was determined from clone P14 (Baron
et al., 1993), which was derived from a bicistronic N-P
RNA and therefore contained the intergenic junction. [It
should be noted that although this is technically the 5'
end of the gene (the genome being of negative polarity),
it is normal to consider the genes in positive sense.] The
5' end of the gene, and the upstream leader sequence,
were determined by 5' RACE as described in Methods.
The complete gene sequence, and all other gene sequences
analysed in this paper, have been deposited in the EMBL
database.
The N gene starts at the AGGA sequence at position
56, following the intergenic CTT trinucleotide, as shown
by 5' RACE (data not shown). The single large open
reading frame (ORF) in the N gene encodes a protein of
525 amino acids with a calculated M r of 58053, slightly
smaller than that determined by SDS-PAGE for the
native N protein in infected cells (Diallo et al., 1987), but
essentially the same as that calculated for other morbillivirus N proteins. Sequences from two other RPV N
genes have been published, those of the parental RPV-K
(Ismail et at., 1994) and of the lapinized RPV vaccine
Downloaded from www.microbiologyresearch.org by
IP: 78.47.19.138
On: Sun, 02 Oct 2016 20:14:21
595
Completion of rinderpest virus sequence
RPV-R
RPV-K
RPV-Kw
RPV-L
1
A
RPV-R
RPV-K
RPV-Kw
RPV-L
RPV-R
RPV-K
50
75
RPV-R
RPV-K
RPV-Kw
RPV-L
RPV-R
RPV-K
RPV-Kw
RPVoL
25
.
.
.
R
100
.
I
i,
~
~
•
m
•
•
, ~ Q
i
-
'
~R
125
150
:
~
l)
D
G
17S
~.
~
A
A
T
L
~
200
::
.':'
Do:
225
',',':"
,,,
250
T g l ~
T
!ii
:
'..
:
275
:
:
',
.
300
RPV-Kw
RPV-L
325
RPV-R
RPV-K
RPV-Kw
RPV-L
RPV-R
RPV-K
RPV-Kw
RPV-L
3S0
I?.~
N
S
375
400
L'
425
• RItI'~k~IY~IDB~,I~'I~GlflI,II:'I~,IINII,
I~m~IDNUOA # '
45O
RPV-R ~
A
P ~I['~IT
R T ~ ' ~ [ ~ [ l ~ : ~ H rr.4[~lG~m'~K [~P ~ [ ~ S ]~A M
RPV-K
RT m ~ m ~ H
G
K PI~(' S A M
RPV-Kw
RPV-L ~Kl~l-'PR~l~V L ~'~g~J"r.'.'.'.'.'.'.'.WITWA ~[~Jl~ [ ~ i ~ Y [~A[~DIUI~N PJIA ~ [ ' l p fflv K
RPV-R
RPV-K
RPV-Kw
RPV-L
500
'
P o
G I~IT LT~N
475
L
L
P
A
V
A
ES
GS
GN
525
Fig. 1. C o m p a r i s o n o f the N p r o t e i n sequences o f f o u r strains o f RPV. Positions w h e r e the sequence is c o m p l e t e l y c o n s e r v e d are s h o w n
as w h i t e c h a r a c t e r s o n a black b a c k g r o u n d a n d w h e r e there are similar residues as b l a c k - o n - g r e y . T h e sequences o f the R P V - L a n d
R P V - K N proteins were t a k e n f r o m K a m a t a et al. (1991) a n d Ismail et aL (1994) respectively,
strain (RPV-L) (Kamata et al., 1991). In neither case was
sequence data obtained for the 3' extragenic region. In
addition, we have determined the 3' end and the N gene
of another, more recent, virulent Middle Eastern strain
[Kuwait/82/1 (Taylor, 1986); RPV-Kw]. The deduced
amino acid sequences of all four N proteins were aligned
(Fig. 1). The N proteins from RPV-R and that from
RPV-K are 99.2 % identical, in accord with comparisons
of other proteins from these two strains (Baron et al.,
1994); there are only three differences in the amino acid
sequences of these two proteins, and two of those are
conservative changes (E/D at position 190 and I / L at
position 523). At position 380, RPV-R has L and RPVK has P, a non-conservative difference. However, both
the other N protein sequences have L at this position. It
seems unlikely, therefore, that changes in the N protein
are involved in the phenotypic change from the extremely
virulent RPV-K to the avirulent RPV-R. The lapinized
strain, although also avirulent in cattle, is quite distantly
related to either strain, the N protein being only 90.7 %
identical to that of RPV-R. This probably reflects the
fact that this strain is of geographically and temporally
distant origin (Asian) and has been adapted to growth in
rabbits, and subsequently in Vero cells. The sequence of
the N gene of RPV-Kw is intermediate between the
RPV-R and RPV-L sequences, being 93' 1% identical to
the former and 93"7 % identical to the latter.
It has previously been observed (Diallo et al., 1994;
Kamata et al., 1991 ; Rozenblatt et al., 1985) that the N
proteins of morbilliviruses are much more conserved
over the first 400 amino acids. This also applies to a
comparison of the N proteins from the four RPV strains,
in that RPV-R/K N is ~ 99 % identical to the others
over the first 400 amino acids, while for the remaining
125 amino acids the level of identity is reduced to 73.6 %
(RPV-L) or 79'2% (RPV-Kw) (Fig. 1). Studies on
Sendai virus (SeV), a related paramyxovirus, have shown
that the highly conserved region contains all the
necessary structural information for self-assembly into
nucleocapsids (Buchholz et al., 1993; Curran et al.,
1993), whereas the carboxyterminal 'tail' is in some way
involved in replication (Curran et al., 1993), perhaps
through binding to the P protein (Homann et al., 1991).
Since there are only limited homologies between the NP
protein of SeV and the morbillivirus N proteins (Morgan,
1991), it will be important to investigate whether a
Downloaded from www.microbiologyresearch.org by
IP: 78.47.19.138
On: Sun, 02 Oct 2016 20:14:21
Downloaded from www.microbiologyresearch.org by
IP: 78.47.19.138
On: Sun, 02 Oct 2016 20:14:21
MDG
I
I
SVKT
NVSL
LM
L
13~
YR
YQ
Cdv
vo
N
Pvvv
P
T
V~
m HA
O
H
.
A
T
Q
°
~
HNDSDLI
TY
I
1
+
.
QT
HI):,
~l
L
I.
L
R~CHTILIKTVS
NNHHCCFF T
. . . . . .
:RH:~ LT
C.$Q .
CN
S P
AT
l+
E
"
O
DT
SKQVNQ
....
RDPS
QFKKNKDSKHEMPD
ENREGI
~P
A
T
SJ~l
NL
CA
D
G"
RSLF
KOTTLY
K
LIS
RNI
FI~IRGNSI
|,~
~
RMRHD[I]$
RNAQASGEG~
DNI
I NGRWI
LAA
I AA
Motif A
ON
I L~S
V
D p~
•
DNLS
VS
KF
~1 T m~L
D+ T ~
L C*
~C
Q.
P
.
S
]~
.
.
.
.
.
.
"
~:~
YK
A
N
G
Y
L
L
E
E
E
¥~
AV
T
KG
EL
E
Y
A
T
N
F
V ~ M Q P G M F ~ Q V ~ K ~ E N t ~ L Q F I ~ p I ~ S
EV
PIEQRGCNTGGPDQI
VI RQOQDTOHPENM
S
A~
TVS
TVS
KRSRHEFKATDSST
G
TLS
KS KKYEFKS
TDI YN~G~t~ITv$
C
Plra~
. . . . . . . . . . . . . . . . . . . . . .
K C
iiv-I~
:
N
Q
A
I
~
S
'
"IIIII:t:tlIit~'
~
+
TA :
C ~ D
T N"
TN
TN
G.
L+A
YYQS~,
. . . . . .
HKYt
HAYI
G~KKC~ND"
NLN
ETANSR
DLGI
Ol
G.
LGG . . . . . .
ALDKTI
~.Y
LSLCT~STYLNP
KK
TY
L$
K|K
GTK
.
K
"
.
.
Q
O
L
L
MR
MR
H:D:
''VKG
+ ~.
VKG
LTRYG~QL~I~ELKA.
G
G
S
R
R
TIP
PV
P
R
K
.V~l]~I
BG
,RC
ER
ET
.
R
S
R
R
~
4S0
'
QI ~1
.
.
.
.
I
N
N
.
.
YAQ
.
.
.
.
KLK
.
.
.
.
CH
.
HC
HC
D
D
$
FE
P
EY
.
Q .
DO
DQ
GD
DD
R. Q QDH& S6
I. S
SO
ONVP
YKVP
DK¥I
DTAL
.
A
CT
.
.
NK
SK
.
.
................
NO+
CD
DP
NK
E~
.
.
.
.
.
M
M
R
R
HN R
HN
R
KY
KY
VS
VS
.
.
.
.
.
~
1+
L
.
H
SA H
:SA
Y
Y
I
l
It~lE AHIS LIDII
I
I
PY
PY
AV
ST
IS VIII
S;
S
|
I
TDS VYNNS
KS S E KgN~
GMGNKNS
GGYWDE
K
YNBVYNNS
KS HTDDLKTYNKI
S NLNL8
S NQ
. . . . . . . . . . . . . . . . . . . . . . . . . .
....... ,,...,,.,
BDHP
I~I VDL~ . . . . .
A. N
I . P
ADTSQF+
S DPT
L.
DLD5
DLDA
V
EK
"
KTDSK
. . . . . . . . . . . .
N'~HRI
N
+
.
Y
+ * "
7OO
S~KAKRYTRDNI
SSQOFHTI
~ n$ mRS T ADNMTLAHS
~u $
m. . . . . .
TNASNB
I EHEKLK~SESDK
.
.
AH
KY
KH
ms C
L F P | ~ E
KT ~ 9 ~ P
MSlII
LNI TEEDQFIKR
PK~KKDISHRGLTNQRKSLKPAPYRGTRHSV$SPSSRYI
I
.
.
....
L
$ H I Q
~
SVS
PR . . . . . . . .
Sl S
PR . . . . . . . .
.ISNKSNEYNDNYNNY
AVS
SQI
....
.
.
~!K
E~N
E~N
$K
K L Q $ gY Q~G N N ~ + ~ K
L~LFHNBO~YII
KEIGFI
N
F F P T~N
ST ~ Q ~ P
F F P AL~N P T ~ I Q ~ I P
GFFPD
NST
O
~
NLAFQ
DAV
R
S
VIE
o,o
DK~YN
QTLS
. . . MQSSG
MQ$$Q
.....
E!
A A WHD $ D~K
1 RIAI
S K~HTTYKS
mm. . . . . . . . . .
NI ....iF, DIDK¥LIGDIV SiKL ~ I
FN
FN
H
T
T
L
.
.
VT
Y~P
K+EF
$ L
~+
E+ V T
E
T
G
YC
VADRM
G
YC
SEKE
CT . . . .
~
....
~
S
F i g . 2. F o r l e g e n d see p a g e 5 9 8 ,
ETC
Q
NKL
V ~ E ~ Q S
LblS g,~llL
F N
N
F
F
.
0
~DI M G
T
S
$
P I~IN L I W ~ $ ~ N
..... o
M~AKD
T T SQ
+mm+m
.ALQRE
CP
~0
T~V
SLY...
DEAGI
L+
, I DIK
LKNGF
EEGF
.... "II R....
NGG
I KH~
I K
+I wKH~
' ° ' .L D. S."G.'.F"
NI TKH.
C K"
CQ
R
LmL
TITIAQ....
m''+.ii+ilNi!Hi+E
. + + +.
I M L,
D
P
T
....LCT+....S,.GP+...$ --E L.QL.D TV.K~,,.S
NI
E
L
K
°"°°EI " °P "
[""""
S B( IATTNIKKI
. . N. H.NP.YY I( ~
+
. I T Y K S i T S
HVLLD
V
. A. . . . .E.Y. . .R
VA
EY
R
VS
EY
R
G RDLWI
N~LSK
AS KP~D . . . . . .
GS NYDLNBBINN
K K ImM C
S mQ ....
KmW~IIH W F N L
. . . . . .
l LTQ . . . . . . .
~0
D ~ ~ N ~ S ~ A ~ H A ~ T L M ~ V L N Q ~ S r I ~ i ~ s r l I L B ~ S
D
I,
K
S
S
HA
LM
VMNQ
S
S
F R L P K K V~flI~IE~I ~[~NIPITICI~P
. . . .
GCFMPLSL
, ~F~mg~
+~.
E~T
Y C~.V~i~WN
[ $ & C & K~P
F NNVILTQLFLYGII~CI
]"
'-";" "+1"
~
.Q D
. L. T. P.D.
" '~+
Q+L
$ M~:}~2~I H K ~ C F D A $
FA
LI'~IL t E R D L I v L $ ~ Y ~ E
.++ .~+~,
QC
E,g~K.. ~ Y V ~ K N ~ ]
. H
T
K Q N Y N G Y L L~P ~ P
Wl S NC~NTImNKSNGIIECG..
T l)mLRI" I"I".N TS
!
~
CTC
2OO
K Y H K G I E
K,
D
0
O
RRL HH ~ Y ~ [ ~ ¢ , I Y
CWII~I ~ M
r E T A M V~P
R Y T EL~L E U ~ R V ~ K ~ G
K E $ Q H ~'.~Y~ i l I - ~ l F ~ . ~ ] Y
C~,
I~L~mM T E T A m T ~ A
R Y T E rlBL G m ~ R Y ~_~I~K ~ G
DLTSHI
~Y
M
YC
EY
MTDTAMA
ORYST
HV
RY
,D
FNTENHT!
Q
Im~ T m~L
Y~K
DONGFSD
GTYHE~
I E.
A
OY[
I TDO
H T;G I
SF
O O N OF Y . . . . . . . . • . . . .
~lIo F , ~ . ~ . . . . ~ H i,~T Ol"~l~F~ S F
TSRDVYT~AEADT
S~LAI~HGTS~DEK~I):~SF
rE.
.R
' GTNS
TEDNI
+~L~L~D
N~ICNT
L
F . . . . . . . . . .
F
D Q K N P~ H + P
, NSNRL
4OO
F N MG K D Y N L+E
I TVTTYNQFITWKD,
N A I V L P L R W L T Y Y K L~+IT Y P ~ L
H
SLR
AROKKATEK
FHAQORVI
FI
PK G + T B L M N D I ~ J T m I ~ ' k ~ I F T ~ K H ~ v S L + + + ' ' ~ K ~ C F D A D A G R
N
E
K E ~ NI
D
E
D
NI
NCt+IVNQS~N~NHVVK+~L~GI'~g~+St
M
"|"
Q
CNQE
N
N CNKL
TQS
Y
.
| 'YY I " IN I " R+G ' IA Q
.Y .
NDQLPL~KNWD~LVKE$C~V~+AGT+SQC~QN~SYG[.t+IITGRGNLFTRSEELSODRRD.
....
.......
o ......
MS KE~F
KLHI
e Ol N$ K~T E LLL KADRTY
Q . . . . . .
KNH$ T~IQ . . . . .
D N $ V I Tm
T RI~ +I K D . . . . . . . . .
, . + + . O H S ++~. N A q + S U'r ^+~+~. m c
V H
VH
HGN
.
A
V
KK
QA Q K N L ~ S
AN
I TVE
I . . .
PVI
.
RI'P++Q~DTBC^, "~ "~• '
R~-~IT~R
~R
K
]~THA
TT
.
•
,
.
P
I
DF KI
,.o .....
L P L~P
I S RQNP
NQ
.
NQ
NQ
.....
+V
'K..........~T~L'
". A" . . i~i.~~II____T~,__+
+ . ~ K +~~,'"
""+ i+'~'i+~'+
N] + LIE~ L I ' EC ~ ' I F
ltrsv
Pinfl3
SeV
Cdv
+'+
P,r,n+
MUS~
N.
GmQ+Cr
ltrsv
G
s.v
pIId1]
S
Cdv
t
N
O
SMV~u
T
.
Q
KARN
gl++ m+
L
F Y N~M~N
SL
V
Y
....
Itrsv
SeV
SL
S L
Q
SR ~ I .V
P ITP.TEE. . .
+
T
H A. F .
~v~
IVI vVSyLy + C Q
* If...K
.
PAHSH:
PKHNH
RI
. ....
YLKNDYTNL
ESSQNPSD
MDSLS
MDSLS
MDSVS
' "Q.......+DTR . G L + + P + .......,V~M.F--+V S.+"~
M.
"nil2
Sv5
yD~R
.
LKR
K T ~gqF
TNQK
MHQS
.
S NNGQDE
RSY ......
~;Y
K
ttl~v
P
KS.
NG
qmT
,
F NGP
+ ~ L
GS YI
S
g S S V H T $ H R R R Y V P $ F F S O D~]IF E ~ : ~ I ~ R ~ I ~ ] I A ~ $ ~ H
$ ~~ K K S$CSI TT H T C H R R R H T p V F F T G S ~ I V E ~ E ~ I ~ R : D ! J ~ I A ~ S
HNCRKRRQNPVF
KGE
L N ~S~R
~D~
C
Q~
Q
m m
L~
S F S E CNAL
TH+~+,P D L R K G H W Q E V V N V
D$ YLKGVI
KE KD~K
GNV
GEl
+KA+
D V K~/~Y A I ~ I ~ N K ~ G L
N
RNF ~!
YLT
~MP~Vm-~ P I ~ L F
F
TE
P~ L L FL B FF ~I ~ T T EE ~ S
Cdv
p
~v$
~AQR ~ VN
NNVS
SSN
I I NCI E
SemQXX ms
PI.I12
Plnfl3
Hlsv
$ ~
sN"'"
ANV
L I EHMNLKKLNI
MDP I I NGNS
~v
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
Cdv
.........................................................................
.
. .. . .. .. . .. . . . .
. . .. .. . .. .. . .. . .. .
. . .. .. . .. .. . .
. . .. .. . .. .. . .. . . . .
. . .. .. . .. .. . .. . .. .
. . .. .. . .. .. . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
Downloaded from www.microbiologyresearch.org by
IP: 78.47.19.138
On: Sun, 02 Oct 2016 20:14:21
VRV
V
~
T
S
~
S
VA
VR
QSrlIIt~T
Y D0~I r~P Q . .
vs
i POgT]~S
NLLYL$
o~
VQPF
+P,.
YNpa'~B~ + E K P N [
,,, ...mr,- ,) ~ m m +
R
KM
D ~Q~F~
~S
Q ~i~L
O
A~H~A~]~G.
g~Ggf~l ~
T
y y N g~N ~ L
~G[~L~L~'~J~G:.~++E+~HL F RL S S T ~ T + G D S N T ~ / ~ V + E T
~I
V
C R ~ K
R
S
T
NAK
NAA
mm~ + + m , +m+ . m m t m . m m ~
*
.
.
.
.
T~ j ~ p
Hrs,
Cdv
SeV
R~F~s
Pl~2
v
v
ND ~ L
16~
or~v+l
QL~K~$
K~FEKII]WGEG~H~M[I~
F K L M~WN F~E
P~NEI
L~ Q ~ L ~ I
I N~;~K~ImFNAYKT
NL
+ E
R
~ H
S
N
V
o ore,) + m . Q . .
A ~1~1 E ~ i r ~
~E
~
v
I
GSDE~.~BH[~Sfi*
~
V
V
V
SI
V
O
~
C
AA
QSS
V
R
R
KQ
KQ
K
VFI
~
[]
Q
Q
Y
Y
P
K
I~t KP
BVRP
mamm
RKG~
~IM~ K R G G ~
. ....
A
Y
DDR~NK
16,50
$ $ WT N ~ F ~ Y T Y M T ~ R ~ P
N
S
p
A
r~MPIIF~S G L I I I G V
ADL
DK
~T
.
~ A
mm+
.
~ R
ANT ~ .
~ K, ~ V ~ .
~ ' ~ A ~ T ~ D ~ G
y A F MS ~.
~SO
~G T ~L
I
T
N
VAR
~
Q
+" ~ + "
T H
HPD
. AT
. . . . ."~"
. .""+"
.
Mp A~S
y
RI
DQRVV
T~KYGDE
DDKKV
O T A L N N~A A T ~ L ~ , ~ A
MN L D ~ T ~ H ~ Y ~ A ~ L
Dy ~ K ~ D
A ~ G
1700
Vg Q
K
R
+K
. oo
v[l
. . . . . v, I~+~+]II]
S
S L T R O]K RGIP T K [ ~ I ~
LSFI
o
| Ig Y T T S T I m s G% I ~ l m X Y N I N
F i g . 2.
For legend see p.
598.
USQD..
A$1~H..
R~KGCHS
PK~WFLKRi~INYAEIt
QG~L~Y~YMT~R~g~P
GMAI T G~
S T ~ ] ~ L ~ C I
NL D~A~NSI'~H~A~L
D Y T K ~ D A ~ G T
KQ
S [~K Y O~G~L~T
S FL~Ar~I~$ K S V FI~v F V N A ~ t ~ R + ~ F
WH S O { ~ E ~ H ~ ( ~ S ~ O ~ O
N. ~ H ~ C
NM~$
C VM
S I~IK y O MIG ! ~ L ! ~ S $ F I l l s r ~ l ~ s K G V F L'4V ~ V N A r l ~ ~ F
W H C G~E
r ~ H ~ : ~ S ~ O A O N . ~ H .T ~F~'~C N ~ T
C Y M
$ r~lK y O ~ G I~L ~ F S F L ~ S ~ $
K G V F i~11 ~ A N A
~
~
F
WD $ G ~ E ~ H ~ S ~ O ~ Q
N. ~ H ~ C
N ~ N
C y M
R REE
w
H
VRI
KDTSHAVL
V SNA
+
PWNAG
E
Y:
N~S
QDK
L
SVCK
SVDL
Q~I
SI
LT
F A~;~A 1
QB L E
R ~ j ~ D N D P AS N P P ~ . ~ I ~
m+ + +tmmmmmmmm.o,, s . . . .
, I ~ D D K ~ K G I
T
A
M
Rtq~'llF~c GArlEB ~
: " ~ S
GC~D ~
~
L$ YYTNH~DKLQD~$
.
SAS
~
: ~]i~:
S
. . . . . . . . . . . . . . .
. . . . . . . . . .
CVF
S
GP~I ~
H~ I V T ~ A ~ E $
A
I T [~.~Ai:1 E A i i A ~ M ,~L~L~U]~G ~ A
SC
S
,m+~m~,,.uu.m,m,+m,,+m.,
CVF
LCLTA
L~L~SM!R[~IH:~:~R R H E T ~ V I ~ . .
Ecr~sVN~G~+~SGCQ~OD
D K E T 8 $ ~
~SIkt~K[~IY~RRHE
S~L L~;1.. ASL.~SHN~QJ~.~QRI
AN~.I VLRGN|
CTEGAI
HR
+: L . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . .
+
I+"
mmvm~m+ m y
[~l~U l~r~ H~ I
~ M ~ K
~ g ~ A
E~
O
~ J ~
;+ ~ " r ~ L ~ .
AVA
v
NLLY~$1~y~RT~-~TR~VH$
M~I~I~Iv
C ~m'~l~ff'~N ~
ST
A
S
1) ~ J ~ P ~ A
A S
N~ . . . . . .
~K~L~V
i ~l~y T ~ O . . . . . . . . . . . . . .
"
K
Q
R
YL~C..¥HK'G'~GKAKLECDMNTSD~LCVL~EL~D$Sy~S~$KVFLEQ~I~YI
Y~D S VF VYS[~IWAL~E
L $ ~Q~LI,*II
E P R~T
V Y L *r~OCT A~N W~:'~D [~H~]HI~P
E P R ~L~[~T I Y L rb~O C A A ~ N W ~ D
~ H FAH l i p
E p RiL~T V y L ~O C A A~N W~S
~HJ~HI~Ip
D P
CSTF
Ol L NQF +~ S
GL~I
S Y T K~D~V
TNVCPNRI]~I
S ~Y T ~ N ~ C
VVEQF.
S N ~ C C Y T
O H ~ / ' N ~ V $~.~I~;~G O ~ O ~ , ~ S ~ : ~ [ ~ ' ~ F ~ L
V
D H ~ N ~ 1 S ~:~,J~G O ~L~O) ~ S ~ F
~L I
D H : ~ N ~ V T ~ I ~ . ~ G O~ l D ~ ! ~ $ ~ I E ~
F . S S
DN~K
MI~£
ND
D~
SL
F
VI
!
F~S~:S
ATS I VND~QA~]YT
T V S
[~C~$
E~ M ~ [ ~ S
.
S N U~V [j]~I~T m S
T r~v K~ q r ~ Q
....
EJr~w T |~IF~ K O I~IA O ] ~ S I ~
O]~N
R S [k~$ L . . . .
H MU'~/ARL~A R ~ P I ~ Y ~ V ~ J E V I v
HMrI~AKL~AKC~E;~PI~Y[~V~L~I
. . . . . . .
"I+
Q.
T
$
A
R~PSLttE
KFRRSl-CT)~IPLI+31~IS~I~It~+R~ATE+~IYTO~HI~RH~VI~FVT~STSOLYH++~AKS~S+~OL+~K..
F
LC+~
PL +
NA
I +R:O]AT++ Y T O + + H R R H
VEFV'i"
STPOLYH
AKS
+ S:
OL
K..
~k~s OHP R PGLRK+
VI PRN
F
+ D b E l T Q E N ~ K L ~+t'it]P D ~ K ~ V ~ L
PPRST
E L F S K V R D v V H T V O MT y ~ S O D E y ~ R A T S I C ~ T ~ . ~ A
O T~Q
+ .
NPEST
e L I R V r E ~]E
P ~ / ] ~ K D P ~ 7 ~ K ~ V ~ L S ~ g ~ M V I ~ D H $ Y T I D MN Y~l~]3 D T D I ]~H A ~ S I C ~ T ] W A
D T~Q
. .
HL~K~PI
FTGD~DI
HKLKQVI
QK, . QHMF~t~Ph]KIStmTQYV'BLFImSNK~LKSGSHVNSNLILAHKm~SD~FHN~L~y~LSTNLAGHWI
~D~E ~ Q
[~]~]I~I~T[e]I~S~F~I~IFNMRYKKO~LGKPL]:~NNG~MESPQEAN
~r~~ ~Ng'~I~JI~T[-~'~$~,:~F[~YLFRLEST~GHNPI~[~J[]~t~BD~]~KESFNDEH
Cdv
SeV
um
P ~1 R ~ ' ~ / ~ S . ~ V ~ ] ~ I ~ T ~rJ~5 ~ ' ~ ] ~ O
~ S
I.j%,~Q O H C l ~ l l , ~ T ~ I k ~ A ~ , . , I ~ I A P ~ + ~ F I , I ~ N
FKGKNW
RCAV
. . .
AN
F
:Et
ME N L $ I t ~ ] ~ S ~ J ~ y ~ l E
+ + + ' + - ' + 0 + ° ° ® ' + + + * + - ° + * -
AS~
D M K ~:~F~iS
....
DS0
~
L.
R
r~r~SQY;~/Ig//JLl~Acr/IE/J[Rl~N~r31]l~o~Rf~l
L~
: T
[-q~id~Q~M~KTMP~YNRQ~L~KKQ~fDQ~D~LAKL~k~`~f+~NKDEFMEE[]~f~+~TL~Y~KA~K+F~QYL~L+TV$~R~CE~PA~|PAY
T
R
G
D
Q
.+m.:,.-,+++++~++-..-.+m,,~+,,,
Itrsv
~
E
~
-. . . . .
G
R
V H N~
~
K
~QHP
R~S~Vrl...
~N
N P HL~s ;I~A ~...
EVMDD
....
~
......
H
H
Cdv
+"
Plma~
A~
~,
LNA:~[~HV~)'~I~'~I]IJ.~°~SIII',IKL$1~ATI,~LNI~pIIIE~'J~p+~<~L~H~C~:~!
T O]t~O~dA T e M MR g~[~[ t L L ] l ~ R ~ m r L O C N R D K R E I ~ $
E
Hrs,
+NT +
H
H
~++.++...u~.++.--.-l+.~
~
C V O S ~ ] I R :~.~I~IN ~ I A R F ~ I
H ~IP ~ [ ~ U ~ l K B ~ ! ~ I H ! ~ O S K r ~ D ~ G I ~ I A
S ~J[~t~D wr,~s * ~ ] [ ~ : ~ A I ~ l ~ p C V O $ m~'~R :~!~K~N ~ U ~ A R H O p y O Q S K S D A E R r ~ H i ~ E
8 Q ~ A ~ A
~RVJ:~T::R~SNk~dlDY EQ~F R A G M V L ~ T G f l K R N
....
V~'?~O K s E ; S r ' ~ V ~ Q ~ A L ~ S
~!1 ~ T : R T : [ ~ S T ~ D Y E:Q!F R A G ] , ~ R ~ F S G K G H D . . .
OI~'~DQ]D;~S~V~OJ[~]A~]N
M~+'
N H D L V + . . . . . . ~}+~R L , + . . . . . . . ,+ E Y E Y+M
+I~:
rIG
~K
QNT
RH
KHAQYT:
YLYPP
YLVPSR+
Cd~
......
m~
......
......
EEl
V R ~P~D S
. . . . . .
LKL~K
El
CNNFG
QRLHD
,,,-~.o ....
ER
CL
FRNVWLY~A~QI~KNHALCk~NK~YLD~LKVLKHLKT~FNLDN~DTA~T~YMN~ML~G~p
K T L $ +~+
I ,)I~
E
+~++
.N.T.N.Y. L. .S.Y N ~ P m . ~ . ,L N P
LI
Pl~2
YR~ESLLCS
E ~ ' ~ H ~O~M~T O y ~ D
~
NHV
QT~AQAD~
.,- .r . ~ , . ,
NL
AS RE~
[::IIK +~,~F!D~YPlAI~IT I ~ I ~ L
K I ~II~'~I:~L ~ S L,~GI~IT ] . . l ~ S A ~ R
O~l E P ......
N YSPI
O CI~A~YKTC
C S
GMTI . .
P T :~ P T
RDQ ......
Cd~
Cdv
StY
EQ
+,,.l+X+ .H~.,,
TYKQ
,,
LSHSE
t~S L ~ D ~ [ ~ K P ~ . . . . . .
Motif B
.....
T
~v~
nil2 ~ I N ~ V ~ D ~ C ~ . y L ~ / ~ Y M T I i K ~ S Y D ~ [ p S p Q . . V S I F G D Q ~ T L E
tT/NII~V~D~C~K~Y
. . . . . .
X
M
I,
ANT
Hrs,
T
.ld+-,H.id,,~+,,H~~,<ldHid~+~w~
s
o,,.'
Plr~++
SvS
r~
598
M . D. B a r o n a n d T. B a r r e t t
m~m
~mm
m[.,z
mmm
atmat
...
,m~m
. ,,J.m
. ,>>>
. ,mmz
. ,~.a.m
. ,a.~h .
Z'zZ
.....
ZZZwww~O~
m ~ m _ _ _ a. ~,.::g:
N
..;~zzz..J
~moocmm
<Z>_l-l>.>.¢.
c~ O'3 ;> *-.'.~'<~
z~<mwwmm~
~
m~mwwmmmm
~.~m----~Z
z
z
z
~
m
:=::t0oom~t~
mc~m~-wzwc:.
....
>u.wt~w
lo~www:~m
;~Z;~O00
mY,;[
~mmmm:<mm
.,a.owP-m
z.
•
,
.>>~.>
f~
0 <o~om
m.,a
>>.<>z¢<~<.
-6
<4<>>->>.>~
;~zmmwt~
m~;~
l-m.lk>->-
~,m m
"N
ZZ:[OQOM~t"
>>¢<->_..m
-N
,a,a~....~
=0~
...=:z.a
om ¢Izto,( <z~
>.>. > . o o o
<~¢,J
.~.au>>>.~.a
> * . ; . c~ m c ~ . . . ~ Z
~
~zzzzz~
m. o~U)l-
¢~=ooo,.a,.a
~.a~]¢]¢o._
Z
:=~m<<>
>~.,z
Z~>tnt~z
~.a
.
>.:>.>z>.a.~
>.>. z
mm
~ OOt-~-I- mm.a
J ~
>.> > xlg,.amz
u> t-<<~.~.;¢
~,.;www,.;,.~
. . . . . . .
,.1[-~.<~-<>>
==
~m . . . . . . .
mm~ ......
~
o~1.
m : = ~ = > < c v . v. z
~ ~.~ ~
ZZZm¢¢ZZ.
~mmpO~;~OZ
~ ~ ' ~ ,.~
~¢= < o o o 0 ~ . = :
.¢*~_l_mm<
ml~ m>>l-,.l.1
~
~
~
o ~
~.~
.~ -~ ~
~'~
g<t-¢¢¢--~<
<z;.gx¢~>.
.Zt.
m~.zw~)¢
.a.a.aooo
:: mz
m ma~--..*,
m >.
,d ~ , d t - . m O m m ~
m < <.J..t~,.
Z
~.Zm . . .~mm
<<<zzx~mz
mzzzoz--m
~:=<ooomtam
I~z z ~ - ~
~o~wwoOm
..,a<<<,a.~
m~ Z>>~;-;.
z
0
=<z--><<z
>__u.u.u...m
¢:~=¢=zzzzz>
..-<<<v.t.~.
m..o~oz>=
. 7 . ¢. > = ~ : ~
Z=
m z m ¢- ~ t l . ~- , . a .
a. i - . w ¢ ¢ ¢ ~ m
<m
,a ,.~ ,J.a :,. > ~ !¢ z,
~mm
.....
. . . . . . .
z
~ m m m m m .
~ att.,wtatcm m ~
~m~¢tc~mmo
zm<__
. r., ~. >
~m~z~-mzm
Z.~omw
¢.1- ~ O Z ~ l -
..m
>e..looo<~>
0 >.
zzz~¢¢>>¢
< <,az~::zz
tam~atnto~ z~[-,
~m~wwwmc~..~
,.l~,.~,ooouu,.~
.ww~_.m
.Zzz
. :< ,a 0 u) . ¢ ~ m ~
~ . ,.~ I-. , ( , < > ®
OP;'~,J
...~
m.a~mo
.m~.
.o.¢~wD>>.
O~Ozzzo0~
>. ;,. >.~. u . . < Z ~ <
Z Z O*-~.J.J 0 Z;)-
>.~- > . 0 0
~.~
~
.ZmZ
u~<ooo>Z;~
~>vmmm<<>
~mm~x~mm>
,a~oooooa.
Downloaded from www.microbiologyresearch.org by
IP: 78.47.19.138
On: Sun, 02 Oct 2016 20:14:21
~ _ ~ o~o-~
Completion of rinderpest virus sequence
similar functional assignment can be made for the
morbillivirus N proteins.
The trinucleotide at the start and end of all genes in
RPV is CTT, except for that at the junction of the H and
L genes. Analysis of the rinderpest L gene clones showed
that, in this position, the trinucleotide is CGT (MV also
has CGT, whilst CDV has CTA). The 5" UTR
(untranslated region) is 22 bases long and is followed by
a 2183 codon ORF encoding the L protein, a 72 base 3'
UTR and a 37 base extragenic domain. The L protein
predicted by translation of the ORF had a predicted Mr
of 248100, although the observed M r of the L protein
synthesized in infected cells is smaller (about 190000)
(data not shown). The end of the L gene (the polyadenylation site) and the start of the extra-genic region
was determined by using RT-PCR from poly(A) + RNA
as described in Methods. The length of each of these
regions is identical to the corresponding region of the
MV genome (Blumberg et al,, 1988; Crowley et al.,
1988); the CDV genome shows certain differences,
notably that the L protein is 22 amino acids shorter.
Overall, the sequences of the three morbillivirus L
proteins are very conserved; allowing for conservative
substitutions, only 16 % of residues differ between the L
protein of RPV and that of MV, 24 % between those of
RPV and CDV, or those of MV and CDV. Alignment of
these three L proteins with those of L proteins of other
paramyxoviruses, including human respiratory syncytial
virus (Fig. 2), shows that the L protein of RPV contains
all the major motifs identified in the polymerases of
negative-stranded RNA viruses (Poch et al., 1989, 1990;
Tordo et al., 1988), including the RNA binding region
(Motif A), the GDNQ-containing region proposed to be
the active site of the polymerase (Motif B) and the
proposed purine nucleotide binding site (Motif C) (Poch
et al., 1990). No major changes were seen in the RPV L
protein in any of the highly conserved domains found
distributed along the polymerase; the alanine residue at
alignment position 757 where all the other paramyxoviruses have threonine was confirmed in both RPV-R
and the virulent RPV-K parental strain by PCR on
genomic RNA. The CDV L protein, on the other hand,
differs from the other polymerases in two regions of
otherwise strong conservation, at alignment positions
1144-1155 and 1320-1349 (Fig. 2). In each case a
sequence closely matching the consensus can be found in
the other reading frames (B. Rima, personal communication). These differences are not commented on in the
original paper (Sidhu et al., 1993 b); since they appear to
arise by single base deletions and insertions, and the gene
sequenced is that of the attenuated Onderstepoort strain,
the changes may modify the activity of the polymerase in
such a way as to account for the lack of virulence.
In the Pararnyxoviridae, as in all the non-segmented,
599
negative-strand RNA viruses, the 3' terminal sequence of
the genome is believed to contain one or more recognition sites for the RNA polymerase, transcription
both of the antigenome and of all the mRNAs being
initiated at this point (Blumberg et al., 1991; Kingsbury,
1990). Similarly, the 3' end of the antigenome (corresponding to the 5' end of the genome) is the site for
initiation of transcription of the genome. The 5' end of
the antigenome has been shown, in MV, to contain an
encapsidation signal (Castaneda & Wong, 1990), and it
may be assumed that a similar signal exists in the 5' end
of the genome. The terminal sequences therefore play a
crucial role in the replication of paramyxoviruses, and
we were interested to see if there were any differences
between the ends of non-virulent (RPV-R) and virulent
(RPV-K, Kw) viruses. We therefore used 5' RACE to
determine the ends of the two virulent strains in addition
to the vaccine strain. Comparison of the sequences from
the three morbilliviruses with the same regions of MV
[strains Edmonston (Crowtey et al., 1988) and AIK-C
(Mori et al., 1993)] and CDV [Onderstpoort strain
(Sidhu et al., 1993 a)] is shown in Fig. 3. The 3' extragenic
region (5' leader of the antigenome) of RPV is 52 bases
long, exactly the same length as those of MV (Crowley et
al., 1988) and CDV (Sidhu et al., 1993 a) and is followed
by the consensus morbillivirus intergenic trinucleotide
CTT. The 5' extragenic region is 37 bases long, the same
as that of MV and one base shorter than that of CDV.
The RPV sequences show extensive homology with each
other and with the corresponding regions of MV and
CDV, as expected, given the similarities in all the
morbilliviruses (Barrett et al., 1991). It is clear that both
terminal regions are highly conserved, although different
positions seem to be variable at each end, e.g. the first 16
bases in the genome are conserved (Fig. 3 a), whereas the
antigenome has three variable positions in the first 16
(Fig. 3 b). In addition, the extragenic regions are much
more conserved in sequence than the normal non-coding
sequences in the genes: 58 59% of the terminal
sequences are completely conserved between the three
viruses, whereas the rest of the non-coding sequences
show only ~ 30 % sequence identity, little more than
that expected by chance.
There are only four variant residues in the 5' end of the
RPV genome outside the L gene, and three of those in the
poorly conserved region from 29-37. The only difference
between RPV-R and RPV-K is found in this region. The
5' end of the antigenome shows nine variant positions
between the three RPV sequences. At five of those (24,
28, 31, 36 and 49) RPV-R and RPV-K match, and at
two more (12 and 40) RPV-R matches RPV-Kw. Only
at positions 5 and 26 does the non-virulent strain differ
from both the virulent strains; of these, position 26 may
be the most significant, since here the four avirulent
Downloaded from www.microbiologyresearch.org by
IP: 78.47.19.138
On: Sun, 02 Oct 2016 20:14:21
600
M . D. Baron and T. Barrett
(a)
(b)
50
1
50
RPV-Kw
Rpv-K
Rpv-R
Mv
Mv-Aik
Cdv
~CCAGAC~GCTGG~g-~GA~--e~GCTCCTTTG.~-~e-~
RPV-Kw
~CC~Ca~~~c~Tc4~'tr~GTA
h C C A G A C A A A G C T G G G ~ A G A ~ A C T T ~ A C T TCTTTG. A A ~ T T T T ~ T~A
A C C A G A C A A A G C T G G ~ G A ~ A C T T ~ A C A T C TTT G. AA~TT T ~ V T ~
ACCAGACAAAGC T G G G ~ A G A ~ A C T T F G T A T T T T C A . A ~ G T T T ~ V T ~ A
ACCAGACAAAGC T G G G ~ A G A ~ A C TT~GTAT TTTCA. AA~TTTT~VT~A
hC CAGACAAAG C T G G G ~ . ~ G A T ~ T
TAATAAC C GTT~ T T T T~_~.~C
RPV-K
RPV-R
MV
NV-AIK
CDV
~C C ~ A C A A A G ~ G ~ A A G G A ~
~qA~G~
~C C~ACAAAG~ GG~AAG GA~C~qA~A~
~ C C A ~ A C A A A G ~ GG ~ A A G G A ~ C ~ A ~
qA~G~
~ C C ~ A C A A A G ~ GG ~ A A G G A ~ A ~ C ~ A ~ q A ~ G ~
~ C CA~AC AAAG~G~_~_~TA A G GA T ~ m q ~
T~_~
RPV-Kw
51
~TATTCC~CAGTTTTGTTGATCAGATT~--~A~GG~C
RPV-Kw
51
~
Rpv-K
Rpv-a
I00
G[fATA[fTAT TTC[r~%CAGTTTTATTGACCAGATCT~GG~FG~Gp~AGFp~G~C
Mv
Mv-Aik
Cdv
G~ATA~TATTT CF~CAGTTTTATTGAC CAGAT C A ~ G ~ F A ~ G ~ A G F ~ C
A~ATA~ T G C ~ T G C C T A A C C A C C
TAGG G C A ~ G ~ A ~ G ~ T T ~ F ~ A
A~AT A~ T G C A A A ~ A T GC C T AAC CAC CT AG G G CA~ G ~ F A ~ G~ T T ~ A
A G ~ _ ~ C TAAG T~CAATAGCAAT GAAT G GAAG G G ~ _ ~ . A ~ G C ~ _ ~ C
RPv-~w
~aTTGCTT~eXC~CCG~--~g'~~NrCN~Ck-'%~
i01
RPV-K
T
C ~ - ~ - - C ~ T C GACT G ~ G ~
T A ~ A ~ F ~ G CA
TG ~ A ~ V ~ G C A
CAlF T V ~ G T G
CA ~ T V ~ G TG
TA ~ T~9%~J2AAA
TT ~
I00
CA A A ~ T T
qACTTA GC!A~TC ~ G A T CCTAIlCGACT G ~ ] A G F A ~ T T ~ t G ~ T A T ~ p T T
RPV-R
MV
MV-AIK
CDV
~ A C T T A G ~ T ~ A ~ A T C C TA~ CGAC T G ~ A G F A ~ F T W ~ C A C A ~ p T T
~ACTTAG ~ T ~A~GAT C C TA~ TAT CAG~GA~A~G~G C ~ G ~ T T A G ~ A T
~CTTAG~T~ATC
CT~TATCAG~A~GC~TTAG~AT
A ~ C T T A G G ~ C A ~ G A T C CTA~C T T ~ C
T~GTTCA~ACC
aPv-Kw
CTTZ~TCTF-~CC~C~--~I~G~C~G~C~
150
I01
150
gpv-K
AGTTGCAGA~C~C~r~CCG~%AT~C~f~CAC%]GFA~tCC[~WCFTpA~C
I
RPV-K
CTTT2X~ATaGq2TC1]C2]CT~G~AG~qC~2gGFFCFGTTCAT~GGCCA
Rpv-R
AGT T G C A G A ~ e A ~
RPV-R
CTTT~ATGGCFT C~T~E~A~A~
Mv-Aik
Cdv
C C GP~AT~AC4fV C AC ~G~A~C C~g~rfT ~ CN T~ A~C[
G T T C A A C ~ [ T ~ A 2 @ C T T ~ T F D G ~ CAC~GVA~C C ~ N T ~ C F TDT~CI
TAAC C T G ~ T ~ A ~ T
T CT ~ _ ~ C ~ _ C ~ ~ ~ A T ~ T ~ T j G A ~
MV-AIK
CDV
~DGFFCFG TTCA~GGCCA
AT C C ~G~j~GGC~ACA~ ~ T T ~ G ~ A ~ D G F g T ~
TAC C ~ A G C ~ . ~ T
C~G~_G~ C~A~CV
GTT C ~ A A A C A
G T T C A A ~ GAC T C
Fig. 3. Terminal sequences of RPV. The terminal sequences of three RPV strains were determined as described in Methods. The 5' ends
of the genome (a) and the anti-genome (b) were aligned with the same regions of two MV strains and one CDV strain. Residues
conserved in all six sequences are boxed. For orientation, the trinucleotides at the end of the L gene (a) or the beginning of the N gene
(b) are marked in Imld, while the end of the L coding sequences (a) and the beginning of the N coding sequences (b) are shaded.
1
10
20
30
40
50
60
70
5 - ACCAGACAAAGCTGGGTAAGGATCGTTCTATCAATGATTGTGATTTAGCACACTTAGGATTCAAGATC
IIIIIIIIIIIIIIII
I
II
III
I
II
I I
I
I
I
I
I ~
RPV:
5
ACCAGACAAAGCTGGGGATAGAAACTTCACATCTTTGAAGTTTTCTTTAGTATATTATTTCTACAGTTT
80
n
:
~
.~:
-,
90
- .... _ ~
-
-
-,
-_ .
~2~1~
I00
110
TTCTTTAAAATG
II
I I
g ~ CAGTTGCAGAAT
5 - ACCAAACAAA~TTGGGTAAGGA~AGTTCAATCAATGATCATCTTCTAGTGCACTTAGGATTCAAGA~CCTATTATCAGG~AC~TATCCGAGATG
;'iV :
II;I IIllll IIII I II I Ill
I I
I fill
i I I I
II
I I [
I
I
5
AC CAGACAAAGCTGGGAATAGAAACT TCGTAT TTTCAAAGT TTTCTTTAATATAT TGCAAATAATGCCTAACCAC ......C T ~ T C C G G A G T T C A
5 - AC•AGACAAAGTTGGCTAAGGATAGTTAAATTATTGAATATTTTATTAAAAACTTAGGGTCAATGATCCTACCTTAAAGAACAA
~ ~ { ~
~'-[" TATG
5 - ACCAGACA~GCTGGGTATGATAA~TTATTAATAACCGTTGTTTTTTTTCGTATAACTAAGTT~AATAGCAATGAATGGAAGGG~GTCAG
Fig. 4. Repeated sequences at the ends of morbilliviruses. The first 110 bases of the anti-genome and genome are shown for rinderpest
virus (RPV), measles virus (MV) and canine distemper virus (CDV). Matching bases between the two strands are indicated (I), and
insertions made to optimize the MV alignment are shown by (-). The internal repeated sequences in RPV, MV and CDV are
highlighted.
viruses have the same base. It is unfortunate that the
most studied strains of MV and C D V are currently
vaccine strains that have been adapted for a long time to
tissue culture. It will be important to determine the
terminal sequences of wild-type isolates of these and other
morbilliviruses. The techniques we have used here can be
used to determine these sequences from R N A isolated
directly from infected tissue, without the need to passage
the viruses in cell culture, which m a y lead to significant
changes in the virus as it adapts to growth in cells which
are not its normal host. Such changes m a y be very subtle
and hidden a m o n g normal inter-strain variation: in the
example presented here, there are more differences
between the sequences of the two virulent strains of RPV
than there are between the vaccine and its virulent
parent.
It has previously been noted (Blumberg et al., 1991)
that, although there is only limited homology between
the 5' or 3' ends of different paramyxoviruses, the ends of
the genome and anti-genome of any individual virus are
very similar, especially over the first 18 bases. This region
presumably contains the promoter/landing site for the
viral polymerase, at least when transcribing full-length
anti-genomes or genomes. The mechanism of transcription of m R N A s in morbilliviruses is currently
unclear. Although free leader R N A s (i.e. transcripts
from the 3' extragenic region of the genome) have been
detected in VSV-, SeV- and Newcastle disease virusinfected cells (Cotonno & Bannerjee, 1977; Kurilla et al.,
1982, 1985; Leppert et al., 1979), intensive efforts by a
number of groups (Billeter et al., 1984; Castaneda &
Wong, 1989; Crowley et al., 1988) have failed to detect
such R N A s in MV-infected cells. It has therefore been
argued (Blumberg et al,, 1991; Castaneda & Wong,
1989) that there must be a second p r o m o t e r region in
morbilliviruses for direct initiation of transcription of the
N gene; as yet there are no data to indicate the location
of this promoter. B . M . Blumberg and co-workers
(Blumberg et al., 1991) have called attention to short
sequences about 90 bases from the 3' ends of the genome
and anti-genome of MV which are very similar (14/15
identical nucleotides, Fig. 4); a similarly repeated
Downloaded from www.microbiologyresearch.org by
IP: 78.47.19.138
On: Sun, 02 Oct 2016 20:14:21
Completion of rinderpest virus sequence
sequence at the same position relative to the ends of the
genome was identified in CDV (Sidhu et al., 1993 a) and
one can also be seen in RPV (Fig. 4). The sequences are
different in the different morbilliviruses and, interestingly, such strongly conserved sequences are not found in
other paramyxoviruses. In addition, the region 70-100
bases from each end of the genome to which these partial
repeats map is the least conserved between viruses (Fig.
3). These sequences are unlikely to be promoters for
internal transcription initiation, as there is no evidence
for such transcription from the anti-genome. Since the
presence or absence of the transcript from the extragenic
sequence appears to be the determining factor in whether
or not viral RNAs are encapsidated (Castaneda & Wong,
1990), these repeated elements, which lie in the UTRs
of the N and L genes, do not appear to be candidate
encapsidation signals. An alternative explanation, that
these regions are part of the polymerase landing site for
replicative transcription (Blumberg et al., 1991) is more
likely, since this is a function required at both ends of the
genome. Why these repeats should be found only in
morbilliviruses, however, and why the sequences involved are not as well conserved as those at the ends of
the genome, are questions that remain to be answered.
Based on work on copy-back defective interfering (DI)
forms of SeV, it has been suggested that efficient
replication of the genome requires that the number of
nucleotides be a multiple of six, and that this is due to a
nucleotide:N protein ratio of six. Interestingly, the
recorded length of the full SeV (15384 bases) is also a
multiple of six, as is the recorded length of one MV strain
(Mori et al., 1993) and one Pifl3 strain (Stokes et al.,
1992). However, the published lengths of MV
Edmonston strain [15892 (Crowley et al., 1988)], CDV
[15616 (Sidhu et al., 1993a)] or RPV (15881, this paper)
do not fit this rule. Interestingly, the two full-length MV
genome sequences in the database, for the Edmonston
strain [Billeter et al., 1984; Cattaneo et al., 1989
(accession no. K01711)] and the AIK-C strain [Mori et
al., 1993 (accession no. $58435)], both have lengths of
15894, a multiple of six. The two sequences, however,
have several insertions/deletions relative to one another
(as well as to other MV sequences in the database, and it
is not clear whether these differences are due to
differences in the strain or the difficulties of sequencing
nearly 16000 bases to an accuracy of plus or minus one
base. More reliable information as to the universality of
the rule of six among paramyxoviruses will probably be
obtained from discrete changes to natural genomes or
genome-like constructs.
We thank Lynnette Goatley for invaluable technical assistance, Dr P.
Thomas and Wendy Blakemore for oligonucleotide synthesis, and Drs
R. Cattaneo and M. Billiter for the gift of plasmid peMV(- )2ip. This
work was funded by the Wellcome Trust.
601
References
BARON, M.D., SHAILA, M.S. & BARRETT, T. (1993). Cloning and
sequence analysis of the phosphoprotein gene of rinderpest virus.
Journal of General Virology 74, 299-304.
BARON, M.O., GOATLEY, t. & BARRETT, T. (1994). Cloning and
sequence analysis of the matrix (M) protein gene of rinderpest virus
and evidence for another bovine morbillivirus. Virology 200,
121-129.
BARRETT,T., BELSHAM,G. J., SUBBARAO,S. M. & EVANS,S. A. (1989).
Immunization with a vaccinia recombinant expressing the F protein
protects rabbits from challenge with a lethal dose of rinderpest virus.
Virology 170, 11-18.
BARR~TY,T., SUBBARAO,S. M., BELSHAM,G. J. & MAHy, B. W. (1991).
The molecular biology of the morbilliviruses. In The Paramyxoviruses, pp. 83-102. Edited by D. W. Kingsbury. New York : Plenum.
BARTON,G. J. (1993). ALSCRIPT, a tool to format multiple sequence
alignments. Protein Engineering 6, 37-40.
BILLE~R, M. A., BACZI~O,K., SCHMm, A. & TER MEULEN,V. (1984).
Cloning of DNA corresponding to four different measles virus
genomic regions. Virology 132, 147-159.
BLUMBERG, B.M., CROWLEY, J.C., SILVERMAN,J.I., MENNONA, J.,
COOK, S.D. & DOWLING, P.C. (1988). Measles virus L protein
evidences elements of ancestral RNA polymerase. Virology 164,
487-497.
BLUMSERG, B.M., CIaAN, J. & UDEM, S. (1991). Function of
paramyxovirus 3' and 5' end sequences in theory and practice. In The
Paramyxoviruses, pp. 235-247. Edited by D. W. Kingsbury. New
York: Plenum Press.
BUCHHOLZ, C.J., SPEHNER, D., DRILLIEN, R., NEUBERT, W.J. &
HO~aANN, H. E. (1993). The conserved N-terminal region of Sendal
virus nucleocapsid protein NP is required for nucleocapsid assembly.
Journal of Virology 67, 5803 5812.
CASTANEDA,S. J. & WONt, T. C. (1989). Measles virus synthesizes both
leaderless and leader-containing polyadenylated RNAs in vivo.
Journal of Virology 63, 2977-2986.
CASTAtCEDA,S. J. & WONG, T. C. (1990). Leader sequence distinguishes
between translatable and encapsidated measles virus RNAa. Journal
of Virology 64, 22~230.
CATTANEO,R., SCHMID,A., SPIELHOFER,P., KAELIN,K., BACZKO,K.,
TER MEULEN,V., PARDOWITZ,J., FEANAGAN,S., RIMA,B. K-, UDEM,
S. A. & BILLETER,M. A. (1989). Mutated and hypermutated genes of
persistent measles viruses which caused lethal human brain disease.
Virology 173, 415-425.
CHAMBERLArN,R. W. (1992). Studies on the surface glycoprotein genes
from different strains of rinderpest virus. PhD thesis, University of
Reading, Reading, UK.
COLONNO, R. J. 8,~ BANNERJEE,m. K. (1977). Mapping and initiation
studies on the leader RNA of vesicular stomatitis virus. Virology 77,
260-268.
CROWLEY, J.C., DOWLING, P.C., MENONNA, J., SILVERMAN,J.I.,
SCn~OBACK,D., COOK, S. D. & BLUMBERG,B. M. (1988). Sequence
variability and function of measles virus 3' and 5' ends and
intercistronic regions. Virology 164, 498-506.
CURRAN,J., HOMANN,H., BUCHHOLZ,C., ROCHAT,S., NEUBERT,W. &
KOLAKOFSKY,D. (1993). The hypervariable C-terminal tail of Sendal
paramyxovirus nucleocapsid protein is required for template function but not for RNA eucapsidatiou. Journal of Virology 67,
4358-4364.
DIALLO, A., BARRETT, T., LEFEVRE, P.-C. & TAYLOR, W. P. (1987).
Comparison of proteins induced in cells infected with rinderpest and
peste-des-petits-ruminants. Journal of General Virology 68, 2033
2038.
DIALLO, A , BARRETT,T., SUBBARAO,S. M. & TAYLOR,W. P. (1989).
Differentiation of rinderpest and peste-des-petits-ruminauts viruses
using specific cDNA clones. Journal of Virological Methods 23,
127-137.
DIALLO, A., BARRETT,T., BARBRON,M., MEYER, G. & LEFEVRE,P. C.
(1994). Cloning of the nucleocapsid protein gene of peste-des-petitsruminants virus: relationship to other viruses. Journal of General
Virology 75, 233 237.
])ORFMAN, D.M., ZON, L.I. & ORKIN, S. I-]_. (1989). Rapid ampli-
Downloaded from www.microbiologyresearch.org by
IP: 78.47.19.138
On: Sun, 02 Oct 2016 20:14:21
602
M . D. Baron and T. Barrett
fication of 2gt 11 bacteriophage library inserts from plaques using the
polymerase chain reaction (PCR). BioTechniques 7, 568-570.
DOWLING, P.C., BLUMBERG, B.M., MENONNA, J., ADAMUS, J.E.,
COOK, P., CROWLEY, J. C., KOLAKOFSKY, D. & COOK, S. D. (1986).
Transcriptional map of the measles virus genome. Journalof General
Virology 67, 1987-1992.
EVANS, S.A., BARON, M. D., CHAMBERLAIN,R.W., GOATLEY,L. &
BARRETT, T. (1994). Nucleotide sequence comparisons of the fusion
protein gene from virulent and attenuated strains of rinderpest virus.
Journal of General Virology 75, 3611-3617.
FROHMAN, M.A., DUSH, M.K. & MARTIN, G . R . (1988). Rapid
production of full-length cDNAs from rare transcripts: amplification
using a single gene-specific oligonucleotide primer. Proceedingsof the
National Academy of Sciences, USA 85, 8998-9002.
GALINSKI, M.S., M1NK, M.A. & PONS, M.W. (1988). Molecular
cloning and sequence analysis of the human parainftuenza 3 virus
encoding the L protein. Virology 165, 499-510.
GENETICS COMPUTER GROUP (1991). Program manual for the GCG
package. Madison, Wisconsin, USA.
HOMANN, H.E., WILLENBR1NK, W., BUCHHOLZ, C.J. & NEUBERT,
W. J. (1991). Sendal virus protein-protein interactions studied by a
protein-blotting protein-overlay technique: mapping of domains on
NP protein required for binding to P protein. Journal of Virology 65,
1304-1309.
ISMAIL, T., AHMAD, S., D'SouzA-AULT, M., BASSIRI, M., SALIKI, J.,
MEBUS, C. & YILMA, T. (1994). Cloning and expression of the
nucleocapsid gene of virulent Kabete O strain of rinderpest virus in
Baculovirus: use in differential diagnosis between vaccinated and
infected animals. Virology 198, 138-147.
KAMATA,H., TSUKIYAMA,K.. SUGIYAMA,M., KAMATA,Y., YOSHIKAWA,
Y. & YAMANOUCHI,K. (1991). Nucleotide sequence of cDNA to the
rinderpest virus mRNA encoding the nucleocapsid protein. Virus
Genes 5, 5-15.
KAWANO, M., OKAMOTO, K., BAND, H , KONDO, K., TSURUDOME,M.,
KOMAOA, H., NIsmO, M. & Izo, Y. (1991). Characterization of the
human parainfluenza type 2 virus gene encoding the L protein and
the intergenic sequences. Nucleic Acids Research 19, 2739 2746.
KINGSBURY, D. W. (1990). Paramyxoviridae and their replication. In
Virology, pp. 945-962. Edited by B. N. Fields. New York: Raven
Press.
KURILLA, M. G., PIWNICA-WORMS, H. & KEENE, J. D. (1982). Rapid
and transient localization of the leader RNA of vesicular stomatitis
virus in the nuclei of infected cells. Proceedings of the National
Academy of Sciences, USA 79, 5240-5244.
KURILLA, M. G., STONE, H. O. & KEENE, J. D. (1985). RNA sequence
and transcriptional properties of the 3' end of the Newcastle disease
virus genome. Virology 145, 203-212.
LEPPERT, M., RITTENHOUSE, L., PERRAULT, J., SUMMERS, D.F. &
KOLAKOFSKY, D. (1979). Plus and minus strand leader RNAs in
negative strand virus-infected cells. Cell 16, 735-747.
LOH, E. Y., ELLIOTT, J. F., CW1RLA,S., LANIER, L. L. & DAVIES, M. M.
(1989). Polymerase chain reaction with single-sided specificity:
analysis of T-cell receptor 6 chain. Science 243, 217-220.
MIDDLETON, Y., TASHIRO, M., THAI, T., OH, J., SEYMOUR,J., PRITZER,
E., KLENK, H.D., ROTH, R. & SETO, J.T. (1990). Nucleotide
sequence analysis of the genes encoding the HN, M, NP, P and L
proteins of two host range mutants of Sendal virus. Virology 176,
656--657.
MORGAN, E. M. (1991). Evolutionary relationships of paramyxovirus
nucleocapsid-associated proteins. In The Paramyxoviruses, pp.
163-180. Edited by D. W. Kingsbury. New York: Plenum Press.
MORI, T., SASAKI,K., HASHIMOTO,H. & MAKINO, S. (1993). Molecular
cloning and complete nucleotide sequence of genomic RNA of the
AIK-C strain of attenuated measles virus. Virus Genes 7, 67-81.
PARKS, G. D., WARD, C. D. & LAMB, R. A. (1992). Molecular cloning
of the NP and L genes of simian virus 5: identification of highly
conserved domains in paramyxovirus NP and L proteins. Virus
Research 22, 259 279.
PLOWRIGHT, W. & FERRIS, R. D. (1962). Studies with Rinderpest virus
in tissue culture. The use of attenuated culture virus as a vaccine for
cattle. Research in Veterinary Science 3, 17~182.
POCH, O., SAUVAGET, I., DELARUE, M. & TORDO, N. (t989).
Identification of four conserved motifs among the RNA-dependent
polymerase encoding elements. EMBO Journal 8, 3867~3874.
POCH, O., BLUMBERG,B. M., BOUGUELERET, L. & TORDO, N. (1990).
Sequence comparison of five polymerases (L proteins) of unsegmented negative-strand RNA viruses: theoretical assignment of
functional domains. Journal of General Virology 71, 1153 1162.
RIMA, B. K., BACZKO, K., CLARKE, D. K., CURRAN, M. D., MARTIN,
S. J., BILLETER,M. A. & TER MEULEN, V. (1986). Characterisation of
clones for the sixth (L) gene and a transcriptional map for
morbilliviruses. Journal of General Virology 67, 1971 1978.
ROZENBLATT, S., EIZENBERG, O., BEN-LEvY, R., LAVIE, V. & BELLINI,
W. J. (1985). Sequence homology within morbilliviruses. Journal of
Virology 53, 684-690.
SHUSTER, D. M., BUCHMAN,G. W. & RASHTCHIAN,A. (1992). A simple
and efficient method for amplification of cDNA ends using 5' RACE.
Focus 14, 46-52.
SIDHU, M. S., HUSAR, W., COOK, S. D., DOWLING, P. C. & UDEM, S. A.
(1993a). Canine distemper terminal and intergenic non-protein
coding nucleotide sequences : completion of the entire CDV genome
sequence. Virology 193, 66-72.
SIDHU, M. S., MENONNA,J. P., COOK,S. D., DOWLING,P. C. & UDEM,
S.A. (1993b). Canine distemper virus L gene: sequence and
comparison with related viruses. Virology 193, 50-65.
STADEN, R. (1980). A new computer method for the storage and
manipulation of DNA gel reading data. Nucleic Acids Research 8,
3673 3694.
STADEN, R. (1982). Automation of the computer handling of gel
reading data produced by the shotgun method of DNA sequencing.
Nucleic Acids Research 10, 4731-4751.
STEC, D. S., HILL, M. G. & COLLINS, P. L. (I99I). Sequence analysis of
the polymerase L gene of human respiratory syncitiat virus and
predicted phylogeny of nonsegmented negative-strand viruses.
Virology 183, 273 287.
STOKES, A., TmRNXY, E. L., MURPHY, B. R. & HALL, S. L. (19921). The
complete nucleotide sequence of the JS strain of human parainfluenzavirus type 3: comparison with the Wash/47885/57 prototype strain. Virus' Research 25, 91-104.
TAYLOR, W. P. (1986). Epidemiology and control of rinderpest. Revue
Scientifique et Technique (Office International des Epizooties) 5,
407-4 10.
TORDO, N., POOH, O., ERMINE, A., I~ITH, G. & ROUGEON, F. (1988).
Completion of the rabies virus genome sequence determination:
highly conserved domains among the L (polymerase) proteins of
unsegmented negative-strand RNA viruses. Virology 165, 565-576.
WINDLE, B. E. (1988). A simple technique for preparing pure 2 DNA.
BioTechniques 6, 403-408.
(Received 13 July 1994: Accepted 28 October 1994)
Downloaded from www.microbiologyresearch.org by
IP: 78.47.19.138
On: Sun, 02 Oct 2016 20:14:21