Download Effects of turmeric (Curcuma longa) on the expression

Effects of turmeric (Curcuma longa) on the expression of hepatic genes
associated with biotransformation, antioxidant, and immune
systems in broiler chicks fed aflatoxin
L. P. Yarru,* R. S. Settivari,* N. K. S. Gowda,† E. Antoniou,*1 D. R. Ledoux,*2
and G. E. Rottinghaus‡
*Division of Animal Sciences, University of Missouri, Columbia 65211; †National Institute of Animal Nutrition
and Physiology, Bangalore 560030, India; and ‡Veterinary Medical Diagnostic Laboratory,
University of Missouri, Columbia 65211
ABSTRACT The objective of the present study was
to evaluate the efficacy of curcumin, an antioxidant
found in turmeric (Curcuma longa) powder (TMP), to
ameliorate changes in gene expression in the livers of
broiler chicks fed aflatoxin B1 (AFB1). Four pen replicates of 5 chicks each were assigned to each of 4 dietary
treatments, which included the following: A) basal diet
containing no AFB1 or TMP (control), B) basal diet
supplemented with TMP (0.5%) that supplied 74 mg/
kg of curcumin, C) basal diet supplemented with 1.0
mg of AFB1/kg of diet, and D) basal diet supplemented
with TMP that supplied 74 mg/kg of curcumin and 1.0
mg of AFB1/kg of diet. Aflatoxin reduced (P < 0.05)
feed intake and BW gain and increased (P < 0.05) relative liver weight. Addition of TMP to the AFB1 diet
ameliorated (P < 0.05) the negative effects of AFB1
on growth performance and liver weight. At the end
of the 3-wk treatment period, livers were collected (6
per treatment) to evaluate changes in the expression of
genes involved in antioxidant function [catalase (CAT),
superoxide dismutase (SOD), glutathione peroxidase
(GPx), glutathione S-transferase (GST)], biotransformation [epoxide hydrolase (EH), cytochrome P450 1A1
and 2H1 (CYP1A1 and CYP2H1)], and the immune
system [interleukins 6 and 2 (IL-6 and IL-2)]. Changes
in gene expression were determined using the quantitative real-time PCR technique. There was no statistical
difference in gene expression among the 4 treatment
groups for CAT and IL-2 genes. Decreased expression
of SOD, GST, and EH genes due to AFB1 was alleviated by inclusion of TMP in the diet. Increased expression of IL-6, CYP1A1 and CYP2H1 genes due to AFB1
was also alleviated by TMP. The current study demonstrates partial protective effects of TMP on changes in
expression of antioxidant, biotransformation, and immune system genes in livers of chicks fed AFB1. Practical application of the research is supplementation of
TMP in diets to prevent or reduce the effects of aflatoxin in chicks fed aflatoxin-contaminated diets.
Key words: aflatoxin B1, turmeric, gene expression, broiler, liver
2009 Poultry Science 88:2620–2627
doi:10.3382/ps.2009-00204
INTRODUCTION
Aflatoxins (AF) are contaminants of feed used in
poultry rations and are produced by the fungi Aspergillus parasiticus and Aspergillus flavus (Smith et al.,
1995). The most biologically active form of AF is aflatoxin B1 (AFB1) and it is responsible for decreased
performance, liver lesions, and immunosuppression in
poultry (Kubena et al., 1993; Ledoux et al., 1999).
©2009 Poultry Science Association Inc.
Received April 21, 2009.
Accepted July 29, 2009.
1
Current address: The Jackson Laboratory, 600 Main Street, Bar
Harbor, ME 04609.
2
Corresponding author: [email protected]
Aflatoxin B1 causes cell damage, free radical production, and lipid peroxidation (Surai, 2002). Increased
lipid peroxide levels and decreased antioxidant enzyme
levels have been observed in AFB1-treated rats (Rastogi et al., 2001). Protection against oxidative damage
is provided by a group of substances called antioxidants
that inhibit reactions of free radicals, such as reactive
oxygen species (ROS). Because lipid peroxidation
plays a major role in AF toxicity, a protective effect of
antioxidants against aflatoxicosis is possible (Galvano
et al., 2001). Supplementation of antioxidants (picroliv and silymarin) ameliorated the effects of AFB1 and
prevented an increase in antioxidant enzymes caused
by AFB1 (Rastogi et al., 2001). Plant compounds such
as coumarins, flavonoids, and curcuminoids have been
shown to inhibit the biotransformation of AF to their
2620
HEPATIC GENE EXPRESSION OF BROILERS FED AFLATOXIN AND TURMERIC
epoxide metabolites, which are more genotoxic than
the parent compound (Lee et al., 2001). Reports have
shown that the curcuminoid yellowish pigments present
in the powder of dried roots and rhizomes of turmeric
(Curcuma longa; TMP) have protective effects against
AFB1 (Soni et al., 1997). A recent approach to prevent
aflatoxicosis in poultry is the use of antioxidants in the
diet (Surai, 2002). Several studies have reported that
TMP is beneficial against aflatoxicosis at the level of
the animal, but to date, no study has been published
that reports on the beneficial effects of TMP on hepatic
gene expression of broiler chicks fed AF. Therefore, the
objective of the present study was to evaluate the effects of TMP, containing a known level of curcuminoids,
on the expression of hepatic genes involved in antioxidant function [catalase (CAT), superoxide dismutase
(SOD), glutathione peroxidase (GPx), glutathione Stransferase (GST)], biotransformation [epoxide hydrolase (EH), cytochrome P450 1A1 and 2H1 (CYP1A1
and CYP2H1)], and the immune system [interleukin
6 and 2 (IL-6 and IL-2)] in broiler chicks fed AF. The
present study is an extension of our earlier work evaluating the efficacy of TMP and a hydrated sodium calcium aluminosilicate to ameliorate the adverse effects
of AF in broiler chicks (Gowda et al., 2008).
MATERIALS AND METHODS
Experimental Design and Birds
Eighty 1-d-old (Cobb × Cobb) male broiler chicks
were purchased from a commercial hatchery (Hoover’s
Hatchery Inc., Rudd, IA), weighed, wing-banded, and
assigned to pens in stainless steel chick batteries for 21
d. Chicks were maintained on a 24-h continuous light
schedule and allowed ad libitum access to feed and water. The animal care and use protocol was reviewed and
approved by the University of Missouri-Columbia Animal Care and Use Committee. A completely randomized design was used with 4 pen replicates of 5 chicks
assigned to each of 4 dietary treatments. Mortality was
recorded and birds were inspected daily for any healthrelated problems.
Diets
The basal diet was a commercial-type corn-soybean
meal diet formulated to meet or exceed the nutritional
requirement of growing chicks as recommended by the
NRC (1994). Dietary treatments evaluated included
the following: A) basal diet containing neither TMP
nor AFB1 (control), B) basal diet supplemented with
0.5% food-grade TMP that supplied 74 mg of total curcuminoids/kg of diet, C) basal diet containing 1.0 mg
of AFB1/kg of diet, and D) basal diet containing 1.0 mg
of AFB1/kg of diet plus 0.5% TMP that supplied 74 mg
2621
of total curcuminoids/kg of diet. Aflatoxin B1 was supplied by Aspergillus parasiticus (NRRL 2999) culture
material containing 760 mg/kg of AFB1. Dietary AFB1
concentrations were confirmed by HPLC analysis, and
all diets were screened by the methods of Rottinghaus et
al. (1982, 1992) for the presence of AFB1, citrinin, T-2
toxin, vomitoxin, zearalenone, fumonisins, and ochratoxin A, before the start of the experiment. Total curcuminoid content, including curcumin, bisdemethoxycurcumin, and demethoxycurcumin, was determined by
the method described by Gowda et al. (2008).
Sample Collection
On d 21, all birds were weighed and feed consumption was recorded for each pen. Average feed intake and
BW gain were determined. Liver weight of each bird
was recorded, and liver tissue (6 per treatment) was
collected randomly, with at least 1 bird representing
each pen. Collected liver samples were snap-frozen in
liquid nitrogen and stored at −80°C for real-time PCR
analysis.
Statistical Analysis
Data were analyzed by the GLM procedures of SAS
(SAS Institute, 1996). The means for treatments showing significant differences in the ANOVA were compared using Fisher’s protected least significant difference procedure at a significance based on the 0.05 level
of probability.
RNA Extraction, Reverse Transcription,
and Quantitative Real-Time PCR
Ribonucleic acid was extracted from the liver samples
(6 samples per treatment) using an RNeasy Midi Kit
(Qiagen Inc., Valencia, CA; Settivari et al., 2006), purified using DNase-1 (Ambion Inc., Austin, TX) and
phenol:chloroform:isoamyl alcohol (25:24:1), and concentrated using Microcon YM30 filters (Millipore Corp.,
Bedford, MA) as described previously (Settivari et al.,
2006). The quality and integrity of the purified RNA
was checked through agarose gel electrophoresis and
the quantity was measured using an ND-1000 spectrophotometer (Nanodrop Technologies, Wilmington, DE;
Flanagan, 2005). The purified RNA samples were preserved at −80°C until used. Two-step quantitative realtime PCR (qRT-PCR) was used to measure expression patterns of genes involved in antioxidant function
(CAT, SOD, GPx, GST), biotransformation (EH, CYP1A1, CYP2H1), and the immune system (IL-6 and
IL-2). From each chick liver, 10 µg of total RNA was
reverse-transcribed using Stratascript RT (Stratagene,
La Jolla, CA) with oligo dT (5 µg/µL; IDT DNA, Coralville, IA) and random hexamers (5 µg/µL; IDT DNA).
2622
Yarru et al.
Table 1. Primer sequences (5′→3′) used in real-time PCR
Product size
(bp)
Name
Symbol
Forward primer
Reverse primer
Catalase
Carnitine palmitoyl transferase 1A
Cytochrome P450 1A1
Cytochrome P450 2H1
Epoxide hydrolase
Glutathione peroxidase
Superoxide dismutase
Glyceraldehyde-3 phosphate
dehydrogenase
Interleukin 2
Interleukin 6
Glutathione S-transferase-α
CAT
CPT 1A
CYP1A1
CYP2H1
EH
GPx
SOD
GAPDH
GGGGAGCTGTTTACTGCAAG
ATCCCAGCTGCAGTGAGTCT
CACTTTCTGCCTGCTCCTG
ATCCCCATCATTGGAAATGT
AAAGGGACAGAAGCCTGACA
TTGTAAACATCAGGGGCAAA
AGGGGGTCATCCACTTCC
CCTCTCTGGCAAAGTCCAAG
TTTCCATTGGCTATGGCATT
GAGCTTCTGCCATTTTTGGA
GGTCCTTCCTCAGCTCCAG
TCGTAGCCATACAGCACCAC
CCTCCAGTGGCTCAGTGAAT
TGGGCCAAGATCTTTCTGTAA
CCCATTTGTGTTGTCTCCAA
CAACATCAAATGGGCAGATG
139
116
125
137
128
140
122
128
IL2
IL6
GSTα
TGCAGTGTTACCTGGGAGAA
GACTCGTCCGGAGAGGTTG
GCCTGACTTCAGTCCTTGGT
CTTGCATTCACTTCCGGTGT
CGCACACGGTGAACTTCTT
CCACCGAATTGACTCCATCT
135
128
131
Then, 6.25 ng of cDNA was added to a 25-µL PCR
reaction to get a final concentration of 0.25 ng/µL of
cDNA in a SYBR green assay (Applied Biosystems,
Foster City, CA). Forward and reverse primer final concentrations were 100 nM in the SYBR green assay.
Primers were designed using the Primer3 program
(Rozen and Skaletsky, 2000) with an annealing temperature of 60°C and amplification size of less than 250
bp (Table 1). Glyceraldehyde phosphate dehydrogenase
(GAPDH) was used as the endogenous control gene in
the qRT-PCR experiments. Thermal cycling was carried out with an ABI Prism 7500 sequence detection
system (Applied Biosystems) using factory default conditions (50°C, 2 min; 95°C, 10 min; and 40 cycles at
95°C, 15 s; 60°C, 1 min). Each gene was measured in
triplicate and the formation of single PCR products
was confirmed using melting curves. Negative controls,
which consisted of all of the components of the qRTPCR mix except cDNA, were used for all primers. The
relative quantification of gene expression changes were
recorded after normalizing for GAPDH gene expression
-DDCT
method (user manual 2,
computed by using the 2
-DDCT
analysis, the
ABI Prism 7700 SDS). In the 2
threshold cycle (CT; cycle number at which the expression exceeds threshold level) from control birds was
used as a calibrator sample. Statistical analyses of the
data were performed by comparing birds fed AF with
control birds for each gene using a 2-tailed t-test with
unequal group variance.
RESULTS
Performance of Broiler Chicks
Data on average feed intake, weight gain, and relative liver weight are presented in Table 2. Chicks fed
TMP alone had similar feed intake and BW gain as
control chicks. Chicks fed 1 mg of AFB1/kg of diet had
significantly (P < 0.05) lower feed intake and BW gain
compared with controls. Addition of 0.5% TMP, containing 74 mg/kg of total curcuminoids, to the AFB1
diet numerically increased feed intake and significantly
(P < 0.05) improved BW gain of chicks. Relative liver
weight was increased (P < 0.05) in chicks fed the diet
containing AFB1 alone compared with control chicks.
Although the reduction in liver weights of chicks fed
the combination of TMP and AFB1 diet was not statistically significant (P > 0.05) from chicks fed AFB1
alone, it was comparable to that of controls.
Changes in Gene Expression
of Antioxidant, Biotransformation,
and Immune System Genes
The expression profiles of genes involved in antioxidant function (CAT, SOD, GPx, GST), biotransformation (EH, CYP1A1, CYP2H1), and the immune system
(IL-6 and IL-2) in all treatment groups were measured
using the qRT-PCR technique. There was no statis-
Table 2. Effects of aflatoxin B1 (AFB1; 1 mg/kg) and turmeric powder (0.5%; 74 mg/kg of total
curcuminoids) on chick performance and relative liver weight
Treatment
A (control)
B (AFB1)
C (AFB1 + TMP3)
D (TMP)
SEM
a–c
Feed intake1 (g/chick)
1,047a
858c
906bc
1,005ab
36
BW gain1 (g/chick)
Liver weight2 (% BW)
840a
662c
746b
791ab
26
Means within a column with no common superscripts differ significantly (P < 0.05).
Means represent 4 pens of 5 chicks each per treatment.
2
Means represent 4 pens of 3 chicks each per treatment.
3
TMP = turmeric powder.
1
2.75b
3.37a
3.09ab
2.96b
0.13
HEPATIC GENE EXPRESSION OF BROILERS FED AFLATOXIN AND TURMERIC
Figure 1. Log2 fold changes in expression of the superoxide dismutase (SOD) gene, relative to controls, due to the individual and
combined effects of aflatoxin B1 (1 mg/kg) and turmeric (0.5%; 74 mg/
kg of curcuminoids). Asterisk indicates significant difference between
treatment groups and control at P < 0.05. Values represent the mean
of 6 birds per treatment. Color version available in the online PDF.
tical difference (P > 0.05) in gene expression among
the 4 treatment groups for CAT and IL-2 genes (data
not shown). Turmeric alone in the diet increased (P
< 0.05) the expression of hepatic SOD, GPx, and EH
genes (P < 0.05) and decreased the expression of IL-6
and CYP1A1 genes (Figures 1, 2, 3, 4, 5). Decreased
expression of SOD, EH, and GST genes due to AFB1
was alleviated by the inclusion of TMP in the AFB1
diet (P < 0.05; Figures 1, 4, 6). Increased expression of
CYP1A1, IL-6, and CYP2H1 genes due to AFB1 was
prevented (P < 0.05) by the addition of TMP to the
AFB1 diet (Figures 3, 5, 7).
DISCUSSION
Performance of Broiler Chicks
2623
Figure 3. Log2 fold changes in gene expression of cytochrome P450
1A1 (CYP1A1) gene due to the individual and combined effects of
aflatoxin (1 mg/kg) and turmeric (0.5%; 74 mg/kg of curcuminoids).
Asterisk indicates significant difference between treatment groups and
control at P < 0.05. Values represent the mean of 6 birds per treatment. Color version available in the online PDF.
containing 74 mg/kg of curcuminoids to the AFB1
diet improved the performance of chicks in the current
study. Earlier reports suggest that TMP might have
protective actions on the liver of broiler chicks (Emadi
and Kermanshahi, 2007). Feeding TMP (that supplied
5 µg of curcumin per day) for 14 d to AFB1-intoxicated
ducklings reversed fatty changes, necrosis, and biliary
hyperplasia (Soni et al., 1992). In the current study,
although the reduction in liver weights of chicks fed
the combination of TMP and AFB1 diet was not statistically significant when compared with liver weight
of chicks fed AFB1 alone, it was comparable to that of
controls, which suggests that TMP gave partial hepatoprotection.
Effects of AF and Turmeric
on the Expression of Antioxidant Genes
Reduced feed intake, BW gain, and increased liver
weights observed in chicks fed AFB1 alone are consistent with previous reports on the negative effects of
AFB1 on performance (Kubena et al., 1990; Ledoux
et al., 1999; Yarru et al., 2009). The addition of TMP
Aflatoxin B1 causes lipid peroxidation in liver (Shen
et al., 1994), induces oxidative damage in the liver cells,
forms DNA adducts, and thus acts as a potent car-
Figure 2. Log2 fold changes in gene expression of glutathione peroxidase (GPx) gene due to the individual and combined effects of
aflatoxin (1 mg/kg) and turmeric (0.5%; 74 mg/kg of curcuminoids).
Asterisk indicates significant difference between treatment groups and
control at P < 0.05. Values represent the mean of 6 birds per treatment. Color version available in the online PDF.
Figure 4. Log2 fold changes in gene expression of epoxide hydrolase (EH) gene due to the individual and combined effects of aflatoxin
(1 mg/kg) and turmeric (0.5%; 74 mg/kg of curcuminoids). Asterisk
indicates significant difference between treatment groups and control
at P < 0.05. Values represent the mean of 6 birds per treatment. Color
version available in the online PDF.
2624
Yarru et al.
Figure 5. Log2 fold changes in gene expression of interleukin 6 (IL6) gene due to the individual and combined effects of aflatoxin (1 mg/
kg) and turmeric (0.5%; 74 mg/kg of curcuminoids). Asterisk indicates
significant difference between treatment groups and control at P <
0.05. Values represent the mean of 6 birds per treatment. Color version
available in the online PDF.
cinogen (Imlay and Linn, 1988). Supplementation of
root extracts of Picrorhiza kurroa and seeds of Silybum
marianum prevented the effects of AFB1 by improving
the performance of chicks, reducing the formation of
peroxides, and returning antioxidant enzymes to control levels (Rastogi et al., 2001). Rosmarinic acid, a
phenolic compound present in the Boraginaceae species of plants, reduced free radical production in human hepatoma cells induced by AFB1 (Renzulli et al.,
2004). Further, earlier reports suggested that curcumin inhibits superoxide anion generation (Iqbal et al.,
2003). Recently, Emadi and Kermanshahi (2007) fed
broiler chicks TMP (0.25, 0.5, 0.75%) from hatch to 49
d and stated that turmeric might have some positive effects on liver enzymes that directly or indirectly reflect
a healthier liver. The above findings demonstrate the
possible mode of action of TMP as an antioxidant.
SOD. Superoxide dismutase catalyzes the conversion of superoxide anions to hydrogen peroxide and is
one of the primary enzymatic defenses against ROS.
In the present study, hepatic gene expression of SOD
was downregulated in chicks fed a diet containing AFB1
versus the control diet (Figure 1). This downregulation
in SOD gene expression could result in accumulation
of superoxide anions within mitochondria, leading to
oxidative stress, and thereby impairing vital cellular
functions (Marczuk-Krynicka et al., 2003). Curcumin is
known to augment antioxidant status especially through
SOD (Cheng et al., 2005). This could probably be the
reason for the increased hepatic gene expression of SOD
in chicks fed TMP compared with controls. Birds fed
the combination of AFB1 and TMP had greater (P ≤
0.05) expression levels for SOD gene expression compared with those fed only AFB1 (Figure 1). These results suggest protective effects of curcuminoids in TMP
in improving SOD gene expression in liver of chicks fed
AFB1.
Figure 6. Log2 fold changes in gene expression of glutathione
S-transferase-α (GSTα) gene due to the individual and combined effects of aflatoxin (1 mg/kg) and turmeric (0.5%; 74 mg/kg of curcuminoids). Asterisk indicates significant difference between treatment
groups and control at P < 0.05. Values represent the mean of 6 birds
per treatment. Color version available in the online PDF.
CAT and GPx. Antioxidant enzymes, such as CAT
within the peroxisomes and cytosolic GPx, are involved
in the conversion of hydrogen peroxide, a powerful and
potentially harmful oxidizing agent, into water and
molecular oxygen (Liska, 1998). Hydrogen peroxide is
unstable and forms a hydroxyl free radical; its breakdown on the inner mitochondrial membrane and within
the mitochondrial matrix causes site-specific damage of
critical matrix targets. The decomposition of hydrogen
peroxide outside the mitochondria may cause damage
to the outer mitochondrial membrane itself, which suggests that the breakdown of hydrogen peroxide to the
hydroxyl radical is highly detrimental.
Compared with controls, the expression of the GPx
gene was not significantly decreased in birds fed AFB1
(Figure 2). However, compared with controls, expression of the GPx gene was increased in birds fed TMP
alone, and in those fed the combination of AFB1 and
TMP. This suggests that although AFB1 did not affect
GPx expression, the addition of TMP to the AFB1 diet
Figure 7. Log2 fold changes in gene expression of cytochrome P450
2H1 (CYP2H1) gene due to the individual and combined effects of
aflatoxin (1 mg/kg) and turmeric (0.5%; 74 mg/kg of curcuminoids).
Asterisk indicates significant difference between treatment groups and
control at P < 0.05. Values represent the mean of 6 birds per treatment. Color version available in the online PDF.
HEPATIC GENE EXPRESSION OF BROILERS FED AFLATOXIN AND TURMERIC
improved overall antioxidant protection in birds fed
AFB1 and could enhance the ability of the bird to convert highly reactive hydrogen peroxide to water. There
was no statistical difference in gene expression among
the 4 treatment groups for the CAT gene.
GSTα. Conjugation of reactive xenobiotic metabolites
with glutathione is an important step in detoxification
and is mediated by GSTα. An overload of xenobiotics
may deplete glutathione through conjugation activities, thereby contributing to oxidative stress (Percival,
1997). Decreased hepatic gene expression of GSTα, as
observed in birds fed AFB1 in this study, could limit
the ability of the hepatic tissue to conjugate reactive
metabolites. Decreased expression of the GSTα gene
due to AFB1 was alleviated by the inclusion of TMP
in the AFB1 diet (Figure 6). Results of the present
study are consistent with earlier reports with regards
to the protective effects of TMP in aflatoxicosis (Soni
et al., 1997; Osawa, 2007). The beneficial effects have
been explained by the induction of antioxidant enzymes
and thereby protection against oxidative stress (Osawa,
2007).
There are important interactions among the activities of several antioxidant enzymes and various ROS
and cellular reactions, all of which could be responsible
for some of the observations in the present study. Decreased expression of SOD and GST genes in chicks
fed AFB1 is additive with respect to oxidative damage.
Nonenzymatic decomposition of hydrogen peroxide involving transition metals, such as iron, in a Fenton-type
reaction can be more damaging to the cell than the
production of the hydroxyl radical species (Scandalios,
1997). Furthermore, increased levels of hydrogen peroxide within the cells reduce SOD activity (MarczukKrynicka et al., 2003), thereby increasing superoxide
levels within the cell.
Effects of AF and Turmeric
on the Expression
of Biotransformation Genes
Primary hepatic detoxification processes include xenobiotic biotransformation (phase I metabolism) and
the subsequent conjugation of the resulting metabolites
(phase II metabolism), making them more water-soluble and available for excretion from the body. The
microsomal cytochrome P450 (CYP)-dependent monooxygenase system in the liver plays an essential role
in phase I metabolism (Akahori et al., 2005). The CYP
enzymes are associated with several biological interactions involving hydroxylation, epoxidation, oxygenation, dehydrogenation, nitrogen dealkylation, and oxidative deamination (Hari Kumar and Kuttan, 2006).
Cytochrome P450-mediated reactions can also generate
ROS.
CYP. The major CYP enzymes involved in hepatic
metabolism of AF in poultry are the CYP1A1 (Klein
2625
et al., 2003) and CYP2H1 isoforms (Hamilton et al.,
1993). The gene CYP1A1 is known to activate certain promutagens to their carcinogenic forms (Haas
et al., 2006; Hari Kumar and Kuttan, 2006). In the
present study, an increase in the expression of hepatic
CYP1A1 and CYP2H1 genes was observed in chicks
fed AFB1 (Figures 3 and 7). Overexpression of these
CYP isoforms has been shown to induce chronic oxidative stress by generating more ROS, possibly leading to
hepatocellular injury and death (Hari Kumar and Kuttan, 2006). It is evident from the results of the present
study that transcriptional activation of CYP1A1 and
CYP2H1 isoforms, in response to AFB1, has the potential to increase oxidative stress. In addition, these CYP
isoforms are involved in biotransformation of AFB1 to
the highly genotoxic metabolite AF 8, 9-epoxide (Klein
et al., 2003). The CYP isoforms oxidize AFB1 into 2
metabolites: the reactive intermediate, AFB1 8, 9-epoxide (AFBO) and AFM1. Because of the importance
of AFBO and AFM1 in the toxicity of AFB1, Yip and
Coulombe (2006) concluded that CYP isoforms play
an important role in the well-known hypersensitivity of
turkeys to AFB1. Klein et al. (2003) conducted a study
to determine if the inclusion of butylated hydroxytoluene, an antioxidant in the diet, has any chemoprotective effects in birds fed AFB1. They observed decreased
activity of hepatic microsomal CYP1A1 as well as conversion of AFB1 to the putative genotoxic metabolite,
AFBO, compared with controls. In agreement with the
above findings, in the current study, curcuminoids decreased CYP1A1 (Figure 3) and CYP2H1 (Figure 7)
gene expression in chicks fed the AFB1 + TMP combination compared with chicks fed the control diet, suggesting chemoprotective effects.
EH. All aerobic cells contain a battery of defenses
to prevent cellular oxidative damage associated with
ROS or active metabolites generated by CYP, or both
(Tiedge et al., 1998). The toxic metabolite, AF 8, 9-epoxide, is detoxified by EH (Tiemersma et al., 2001) and
GST enzymes (Tiemersma et al., 2001; Klein et al.,
2003). Because genes coding for CYP isoforms were upregulated in birds fed AFB1 compared with controls
in the present study, there is a greater chance for formation of more toxic intermediate metabolites such as
AF 8, 9-epoxide. Furthermore, downregulation of the
detoxification genes (EH and GSTα) could reduce the
ability of the bird to detoxify AFBO and other reactive
substances resulting in accumulation of those active
metabolites inside the bird, which could lead to various toxicological and carcinogenic effects. Decreased
expression of EH (Figure 4) and GST genes and increased expression of CYP1A1 and CYP2H1 genes due
to AFB1 were alleviated by TMP inclusion in the AFB1
diet. Also, there was an increase in the expression of EH
gene in chicks fed TMP alone compared with controls,
which indicates that TMP improves the detoxification
ability in chicks fed AFB1.
2626
Yarru et al.
Effects of AF and Turmeric
on the Expression of Interleukins
Interleukins are a group of cytokines that are important components of the immune system. They play a
physiological role in inflammation and a pathological
role in systemic inflammatory states and are now well
recognized (Tayal and Kalra, 2007). Any imbalance in
cytokine production and dysregulation of a cytokine
process could result in various pathological disorders
(Tayal and Kalra, 2007). Aflatoxin exerts part of its
immunosuppressive effects through these cytokines.
Hinton et al. (2003) investigated the effects of AFB1 on
interleukin 1 (IL-1), IL-2, and IL-6 production in male
rats and found an increase in the production of IL-1
and IL-6. Dugyala and Sharma (1996) used male mice
to test the effects of AFB1 (0.7 mg of AFB1/kg) on the
gene expression of IL-1α and IL-2. They reported that
AFB1 significantly suppressed the levels of IL-1α protein and mRNA and protein levels of IL-2.
IL-6 and IL-2. Interleukin 6 is a proinflammatory
cytokine and IL-2 stimulates T-cell growth and cytotoxic and killer-cell activities. The effect of AFB1 on
IL-2 gene expression was measured by Han et al. (1999)
in murine thymocytes using real-time PCR. They observed a decrease in the transcriptional levels of IL-2 in
these cells.
In the present study, we observed no statistical difference in gene expression among the 4 treatment groups
for the IL-2 gene (data not shown). There was an increase in the expression of the IL-6 gene in chicks fed
AFB1 (Figure 5). Similarly, Hinton et al. (2003) observed
an increase in the production of IL-6 in rats fed AFB1.
Furthermore, Dugyala and Sharma (1996) observed
similar induction in mRNA levels of IL-6; however, they
noticed a reduction in the corresponding protein level
and they speculated that AFB1 treatment decouples
the correlation between transcription and translational
controls of IL-6. In the current study, TMP alone decreased the expression of the IL-6 gene possibly because
of its anti-inflammatory action (Thangapazham et al.,
2006). Moreover, the increased expression of the IL-6
gene caused by AFB1 was prevented by TMP inclusion
in the AFB1 diet.
Current findings suggest that AFB1 at 1.0 mg/kg of
the diet has detrimental effects on growth performance
and liver weight of chicks. This level of AF also decreased hepatic gene expression of SOD, GST, and EH
and increased the gene expression of IL-6, CYP1A1,
and CYP2H1. Turmeric alone had beneficial effects
on the expression of antioxidant (SOD and GPx), biotransformation (CYP1A1 and EH), and IL-6 genes.
Tumeric powder inclusion in the AFB1 diet improved
bird performance and prevented the negative effects
on the expression of genes associated with antioxidant
(SOD and GSTα), immune (IL-6), and detoxification
(CYP1A1, CYP2H1, and EH) mechanisms in livers of
chicks fed AFB1. However, no significant difference was
observed in the expression of CAT, an important anti-
oxidant gene, and the IL-2 gene among the 4 treatment
groups. The present study demonstrates that supplementation of TMP (0.5%), that supplied 74 mg/kg of
curcuminoids, to a diet containing AFB1 (1.0 mg/kg)
gave partial protection against the adverse effects of
AFB1, suggesting that higher levels of TMP may be
required for maximum efficacy.
ACKNOWLEDGMENTS
We thank Chada S. Reddy, Biomedical Sciences,
University of Missouri, Columbia, for his valuable suggestions. The Overseas Associateship granted by the
Department of Biotechnology, Ministry of Science and
Technology, Government of India, to N. K. S. Gowda
for conducting research on mycotoxin and antioxidant
status at the University of Missouri, Columbia, is gratefully acknowledged.
REFERENCES
Akahori, M., A. Takatori, S. Kawamura, S. Itagaki, and Y. Yoshikawa. 2005. No regional differences of cytochrome P450 expression
in the liver of cynomolgus monkeys (Macaca fascicularis). Exp.
Anim. 54:131–136.
Cheng, H., W. Liu, and X. Ai. 2005. Protective effect of curcumin
on myocardial ischemial reperfusion injury in rats. Zhong Yao
Cai 28:920–922.
Dugyala, R. R., and R. P. Sharma. 1996. The effect of aflatoxin B1
on cytokine mRNA and corresponding protein levels in peritoneal macrophages and splenic lymphocytes. Int. J. Immunopharmacol. 18:599–608.
Emadi, M., and H. Kermanshahi. 2007. Effect of turmeric rhizome
powder on the activity of some blood enzymes in broiler chickens.
Int. J. Poult. Sci. 6:48–51.
Flanagan, N. 2005. Advances in microgenomics: Less is more. Genet. Eng. News 25:1–3.
Galvano, F., A. Piva, A. Ritieni, and G. Galvano. 2001. Dietary
strategies to counteract the effects of mycotoxins: A review. J.
Food Prot. 64:120–131.
Gowda, N. K. S., D. R. Ledoux, G. E. Rottinghaus, A. J. Bermudez,
and Y. C. Chen. 2008. Efficacy of turmeric, containing a known
level of curcumin, and a hydrated sodium calcium aluminosilicate
to ameliorate the adverse effects of aflatoxin in broiler chicks.
Poult. Sci. 87:1125–1130.
Haas, S., C. Pierl, V. Harth, B. Pesch, S. Rabstein, T. Bruning, Y.
Ko, U. Hamann, C. Justenhoven, H. Brauch, and H. Fischer.
2006. Expression of xenobiotic and steroid hormone metabolizing
enzymes in human breast carcinomas. Int. J. Cancer 119:1785–
1791.
Hamilton, J. W., C. A. Louis, K. A. Doherty, S. R. Hunt, M. J.
Reed, and M. D. Treadwell. 1993. Preferential alteration of inducible gene expression in vivo by carcinogens that induce bulky
DNA lesions. Mol. Carcinog. 8:34–43.
Han, S. H., J. J. Young, S. S. Yea, and K. Yang. 1999. Suppression
of the interleukin-2 gene expression by aflatoxin B1 is mediated
through the down-regulation of the NF-AT and AP-1 transcription factors. Toxicol. Lett. 108:1–10.
Hari Kumar, K. B., and R. Kuttan. 2006. Inhibition of drug metabolizing enzymes (cytochrome P450) in vitro as well as in vivo
by Phyllanthus amarus Schum & Thonn. Biol. Pharm. Bull.
29:1310–1313.
Hinton, D. M., M. J. Myers, R. A. Raybourne, S. Francke-Carroll,
R. E. Sotomayor, J. Shaddock, A. Warbritton, and M. W. Chou.
2003. Immunotoxicity of aflatoxin B1 in rats: Effects on lymphocytes and the inflammatory response in a chronic intermittent
dosing study. Toxicol. Sci. 73:362–377.
Imlay, J. A., and S. Linn. 1988. DNA damage and oxygen radical
toxicity. Science 240:1302–1309.
HEPATIC GENE EXPRESSION OF BROILERS FED AFLATOXIN AND TURMERIC
Iqbal, M., S. D. Sharma, Y. Okazaki, M. Fujisawa, and S. Okada.
2003. Dietary supplementation of curcumin enhances antioxidant
and phase-I metabolizing enzymes in ddY male mice: Possible
role in protection against chemical carcinogenesis and toxicity.
Pharmacol. Toxicol. 92:33–38.
Klein, P. J., T. R. Van Vleet, J. O. Hall, and R. A. Coulumbe.
2003. Effects of dietary butylated hydroxytoluene on aflatoxin
B1-relevant metabolic enzymes in turkeys. Food Chem. Toxicol.
41:671–678.
Kubena, L. F., R. B. Harvey, W. E. Huff, D. E. Corrier, T. D. Phillips, and G. E. Rottinghaus. 1990. Efficacy of hydrated sodium
calcium aluminosilicate to reduce the toxicity of aflatoxin and
T-2 toxin. Poult. Sci. 69:1078–1086.
Kubena, L. F., R. B. Harvey, T. D. Phillips, and B. A. Clement.
1993. Effect of hydrated calcium aluminosilicates on aflatoxicosis
in broiler chicks. Poult. Sci. 72:651–657.
Ledoux, D. R., G. E. Rottinghaus, A. J. Bermudez, and M. AlonsoDebolt. 1999. Efficacy of hydrated sodium calcium aluminosilicate to ameliorate the toxic effects of aflatoxin in broiler chicks.
Poult. Sci. 78:204–210.
Lee, S. E., B. C. Campbell, R. J. Molyneux, S. Hasegawa, and H. S.
Lee. 2001. Inhibitory effects of naturally occurring compounds on
aflatoxin B1 biotransformation. J. Agric. Food Chem. 49:5171–
5177.
Liska, D. J. 1998. The detoxification enzyme system. Altern. Med.
Rev. 3:187–198.
Marczuk-Krynicka, D., T. Hryniewiecki, J. Piatek, and J. Paluszak.
2003. The effect of brief food withdrawal on the elevation of free
radicals and other parameters of oxidative status in the liver.
Med. Sci. Monit. 9:131–135.
NRC. 1994. Nutrient Requirements of Poultry. 9th rev. ed. Natl.
Acad. Sci., Washington, DC.
Osawa, T. 2007. Nephroprotective and hepatoprotective effects of
curcuminoids. Adv. Exp. Med. Biol. 595:407–423.
Percival, M. 1997. Phytonutrients and detoxification. Clin. Nutr.
Insights 5:1–4.
Rastogi, R., A. K. Srivastava, and A. K. Rastogi. 2001. Long term
effect of aflatoxin B1 on lipid peroxidation in rat liver and kidney:
Effect of Picroliv and Silymarin. Phytother. Res. 15:307–310.
Renzulli, C., F. Galvano, L. Pierdomenico, E. Speroni, and M. C.
Guerra. 2004. Effects of rosamarinic acid against aflatoxin B1 and
ochratoxin A induced cell damage in a human hepatoma cell line
(Hep G2). J. Appl. Toxicol. 24:289–296.
Rottinghaus, G. E., C. E. Coatney, and H. C. Minor. 1992. A rapid,
sensitive thin layer chromatography procedure for the detection
of fumonisin B1 and B2. J. Vet. Diagn. Invest. 4:326–329.
Rottinghaus, G. E., B. Olsen, and G. D. Osweiler. 1982. Rapid
screening method for aflatoxin B1, zearalenone, ochratoxin A, T-2
toxin, diacetoxyscirpenol and vomitoxin. Pages 477–484 in Proceedings of the 25th Annual American Association of Veterinary
Laboratory Diagnosticians, Nashville, TN. American Association
of Veterinary Laboratory Diagnosticians, Davis, CA.
2627
Rozen, S., and H. Skaletsky. 2000. Primer3 on the WWW for general
users and for biologist programmers. Pages 365–386 in Methods
in Molecular Biology. S. Kravetz and S. Misener, ed. Humana
Press, Totowa, NJ.
SAS Institute. 1996. SAS User’s Guide: Statistics. SAS Institute,
Cary, NC.
Scandalios, G. J. 1997. Pages 1–17 and 842–843 in Oxidative Stress
and the Molecular Biology of Antioxidant Defenses. Cold Spring
Harbor Laboratory Press, Woodbury, NY.
Settivari, R. S., S. Bhusari, T. E. Evans, P. A. Eichen, L. B. Hearne,
E. Antoniou, and D. E. Spiers. 2006. Genomic analysis of the
impact of fescue toxicosis on hepatic function. J. Anim. Sci.
84:1279–1294.
Shen, H. M., C. Y. Shi, H. P. Lee, and C. N. Ong. 1994. Aflatoxin
B1 induced lipid peroxidation in rat liver. Toxicol. Appl. Pharmacol. 127:145–150.
Smith, J. E., G. Solomons, C. Lewis, and J. G. Anderson. 1995. Role
of mycotoxins in human and animal nutrition and health. Nat.
Toxins 3:187–192.
Soni, K. B., M. Lahiri, P. Chackradeo, S. V. Bhide, and R. Kuttan. 1997. Protective effect of food additives on aflatoxin-induced
mutagenicity and hepatocarcinogenicity. Cancer Lett. 115:129–
133.
Soni, K. B., A. Rajna, and R. Kuttan. 1992. Reversal of aflatoxin
induced liver damage by turmeric and curcumin. Cancer Lett.
66:115–121.
Surai, P. F. 2002. Natural antioxidants and mycotoxins. Pages 455–
509 in Natural Antioxidants in Avian Nutrition and Reproduction. 1st ed. Nottingham University Press, Nottingham, UK.
Tayal, V., and B. S. Kalra. 2007. Cytokines and anti-cytokines as
therapeutics—An update. Eur. J. Pharmacol. 579:1–12.
Thangapazham, R. L., A. Sharma, and R. K. Maheshwari. 2006.
Multiple molecular targets in cancer chemoprevention by curcumin. AAPS J. 8:E443–E449.
Tiedge, M., S. Lortz, R. Munday, and S. Lenzen. 1998. Complementary action of antioxidant enzymes in the protection of bioengineered insulin-producing RINm5F cells against the toxicity of
reactive oxygen species. Diabetes 47:1578–1585.
Tiemersma, E. W., R. E. Omer, A. Bunschoten, P. van’t Veer, F. J.
Kok, M. O. Idris, A. M. Kadaru, S. S. Fedail, and E. Kampman.
2001. Role of genetic polymorphism of glutathione-S transferase
T1 and microsomal epoxide hydrolase in aflatoxin-associated
hepatocellular carcinoma. Cancer Epidemiol. Biomarkers Prev.
10:785–791.
Yarru, L. P., R. S. Sttivari, E. Antoniou, D. R. Ledoux, and G. E.
Rottinghaus. 2009. Toxicological and gene expression analysis of
the impact of aflatoxin B1 on hepatic function of male chicks.
Poult. Sci. 88:360–371.
Yip, S. S., and R. A. Coulombe. 2006. Molecular cloning and expression of a novel cytochrome P450 from turkey liver with aflatoxin
B1 oxidizing activity. Chem. Res. Toxicol. 19:30–37.