Download Phytic Acid and Inorganic Phosphate Composition in Soybean Lines

Page 1 of 35
The Plant Genome Accepted paper, posted 12/04/2014. doi:10.3835/plantgenome2014.10.0077
Phytic Acid and Inorganic Phosphate Composition in Soybean Lines with
Independent IPK1 Mutations
Jennifer A. Vincent, Minviluz Stacey, Gary Stacey, Kristin D. Bilyeu*
Jennifer A. Vincent, Minviluz Stacey, Gary Stacey, Kristin D. Bilyeu, Division of
Plant Sciences, University of Missouri, Columbia, Missouri 65211; Kristin D. Bilyeu,
USDA-ARS, Plant Genetics Research Unit, Columbia, Missouri 65211. Mention of a
trademark, vendor, or proprietary product does not constitute a guarantee or warranty of
the product by the USDA or the University of Missouri and does not imply its approval to
the exclusion of other products or vendors that may also be suitable. The US
Department of Agriculture, Agricultural Research Service, Midwest Area, is an equal
opportunity, affirmative action employer and all agency services are available without
discrimination.
Received ________. *Corresponding author ([email protected])
Abbreviations: FN, fast neutron; IP4, inositol (1,4,5,6) tetrakisphosphate; IP5,
inositol (1,3,4,5,6) pentakisphosphate; IPK1, inositol pentakisphosphate 2-kinase; LPA,
low phytic acid; m, mutant; P, phosphorus; PA, phytic acid; PA-P, phytic acid
phosphorus; PCR, polymerase chain reaction; Pi, inorganic phosphorus; SAS, statistical
analysis software; SNP, single nucleotide polymorphism; SPT, single plant thresh; W,
wild type
The Plant Genome Accepted paper, posted 12/04/2014. doi:10.3835/plantgenome2014.10.0077
Abstract
Soybean [Glycine max (L.) Merr] seeds contain a large amount of phosphorus
(P), which is stored as phytic acid (PA). PA is indigestible by nonruminant livestock and
considered an anti-nutritional factor in soybean meal. Several low PA soybean lines
have been discovered, but many of these lines have either minor reductions in PA or
inadequate germination and emergence. The reduced PA phenotype of soybean line
Gm-lpa-ZC-2 was previously shown to be the result of a mutation in a gene encoding an
inositol pentakisphosphate 2-kinase on chromosome 14 (14IPK1). While the 14IPK1
mutation was shown to have no impact on germination and emergence, the reduction in
PA was modest (up to 50%). Our objective was to determine the effect on seed P
partitioning for a novel mutation of an independent IPK1 gene on chromosome six
(06IPK1) on its own and in combination with mutant alleles of the 14IPK1. We
developed soybean populations and conducted genotype and phenotype association
analyses based on the genotype of the 06IPK1 and 14IPK1 genes and the seed P
partitioning profile. The lines with both mutant IPK1 genes had very low PA levels,
moderate accumulation of inorganic phosphate, and accumulation of high amounts of P
in lower inositols.
The developed lines did not have significant reductions in
germination or field emergence.
In addition, characterization of the lower inositols
produced in the mutant lines suggests that IPK1 is a polyphosphate kinase and
provides some insight into the PA biosynthesis pathway in soybean seeds.
Page 2 of 35
Page 3 of 35
The Plant Genome Accepted paper, posted 12/04/2014. doi:10.3835/plantgenome2014.10.0077
Introduction
Inositol hexakisphosphate, otherwise known as phytic acid (PA), is a major
component of mature soybean seeds, roughly 2%, and it is about 75% of the total
phosphorus (P) found in soybean seeds (Raboy et al., 1984). The rest of the P in
soybean seeds is in the form inorganic phosphate (Pi) and cellular components, such as
protein and nucleotides (Raboy et al., 2001). PA is an important component of seedling
germination because phytase hydrolyzes some of the PA-P (PA phosphorus) in order to
release Pi, which is utilized by soybean seedlings for energy and nutrients (Urbano et
al., 2000). The PA-P in mature soybean seeds, which are fed to livestock and humans,
is unavailable for use by nonruminant livestock because phytase enzymes are not
present in the digestive tract for breakdown of PA and release of Pi (reviewed in BrinchPedersen et al., 2002). Research to develop low phytic acid (lpa) and high Pi soybean
seeds is an ongoing objective that must deliver improved nutritional quality seed meal
without introducing any negative agronomic qualities to the seed such as reduced field
emergence.
Multiple independent sources of lpa soybean lines were discovered and
characterized (Sebastian et al., 2000; Wilcox et al., 2000, Yuan et al., 2007; Maroof and
Buss, 2011). Further investigation into the genetics of these lines identified mutations in
genes encoding enzymes in the PA biosynthesis pathway and PA transporter genes
(Gillman et al., 2013; Gillman et al., 2009; Hitz et al., 2002; Yuan, et al., 2012).
Unfortunately, many soybean lpa mutants have significantly reduced germination and
emergence (Anderson and Fehr, 2008; Maupin and Rainey, 2011; Maupin et al., 2011;
The Plant Genome Accepted paper, posted 12/04/2014. doi:10.3835/plantgenome2014.10.0077
Meis et al., 2003; Yuan et al., 2007). However, initial characterization of the soybean
mutant, Gm-lpa-ZC-2, with a novel lpa mutation, led to the discovery of no significant
emergence or germination issues (Frank et al., 2009b; Yuan et al., 2007; Yuan et al.,
2009). Gm-lpa-ZC-2 was determined to have a reduction of about 20-50% of PA as
well as a proportional increase of Pi and lower inositols (Frank et al., 2009a; Yuan et al.,
2007). Characterization of the metabolite profile of Gm-lpa-ZC-2 indicated that there
were no decreases in nutritional value (Frank et al., 2009b).
Eventually, it was
discovered that a mutation in an inositol (1,3,4,5,6)-pentakisphosphate 2-kinase, or
IPK1, gene was responsible for the lpa phenotype in Gm-lpa-ZC-2 (Yuan et al., 2012).
IPK1 (E.C. 2.7.1.158, inositol-pentakisphosphate 2-kinase) is the enzyme that
adds the last phosphate on the inositol ring to create PA (reviewed in York et al., 1999).
Based on in vitro experiments with maize and potato IPK1 recombinant enzymes and
work in Arabidopsis, the plant IPK1 gene appears to have the capacity to encode an
inositol polyphosphate kinase, with lower inositol phosphates also capable of being
substrates in addition to inositol-pentakisphosphate (Caddick et al., 2008; StevensonPaulik et al., 2005; Sun et al., 2007; Sweetman et al., 2006).
Soybean is derived from ancient genome duplication events, and the existence of
small gene families with members present on different chromosomes provides the
opportunity for expressed genes encoding proteins that can be functionally redundant
with each contributing to the total enzyme activity for a biochemical reaction step
(Schmutz et al., 2010). Alternatively, the independent homologous genes in a gene
family can diverge and subfunctionalize by expression or activity.
Page 4 of 35
Page 5 of 35
The Plant Genome Accepted paper, posted 12/04/2014. doi:10.3835/plantgenome2014.10.0077
There are three independent IPK1 genes in the soybean genome on
chromosomes 14, 6, and 4 [Glyma14g07880, Glyma06g03310, and Glyma04g03240 in
Glycine max v1.1 (Yuan et al., 2012)]. The IPK1 gene on chromosome 14 showed the
highest IPK1 gene expression in immature soybean seeds, while the other two genes
on chromosome 6 and 4 showed very low expression (Yuan et al., 2012). The soybean
line Gm-lpa-ZC-2 contains a splice-site mutation in the chromosome 14 IPK1 gene,
resulting in one nonfunctional IPK1 of the three IPK1 genes present (Yuan et al., 2012).
Even though the chromosome 14 IPK1 gene was the highest expressed of the three
genes in developing seeds, the null alleles of the chromosome 14 IPK1 gene in
soybean line Gm-lpa-ZC-2 only reduced the PA content by up to approximately 50%
compared to wild-type seeds; therefore, the two remaining IPK1 soybean genes on
chromosome 6 and 4 become candidate genes for reverse genetics experiments to
either independently reduce PA levels or work in combination with the chromosome 14
IPK1 mutation to create more dramatic reductions in seed PA.
In this work, we identified a fast neutron induced soybean line that has a partially
deleted IPK1 gene on chromosome 6 (Glyma06g03310). Our goal was to characterize
the effect of the chromosome 6 IPK1 mutation on its own and in combination with the
Gm-lpa-ZC-2 chromosome 14 IPK1 mutation in terms of P partitioning as well as
germination and emergence.
In addition, by characterizing the accumulated lower
inositol forms, we were able to provide more evidence that IPK1 is an inositol
polyphosphate 2-kinase and that soybean seed PA biosynthesis can proceed
independently of one proposed route of the lipid-dependent pathway (Stevenson-Paulik
et al., 2005).
The Plant Genome Accepted paper, posted 12/04/2014. doi:10.3835/plantgenome2014.10.0077
Materials and Methods
FN irradiation
In the fall of 2007, 70,000 Williams 82 seeds were treated with 30 Gy fast
neutrons at McClellan Nuclear Radiation Center (University of California Davis, Davis,
CA). Seeds were sent to grow in Costa Rica for one generation, and in May 2008,
approximately 9,000 single plant thresh (SPT) packets were returned to Columbia,
Missouri as M2 seeds. 4096 rows of M2 lines, each representing one M1 plant were
grown in the field in 2008. Visual evaluation of M2 plants in the field led to the discovery
of one line segregating for a multifoliate phenotype. Two multifoliate plants from the
same line were single plant threshed at maturity, and several M3 seeds of one of those
multifoliate M2 plants were utilized to characterize the soybean genome.
CGH
Comparative Genomic Hybridization (CGH) was performed on DNA from a single
plant designated FN38 as described by Bolon et al. (2011). NimbleGen soybean CGH
microarray, which consists of 696,139 unique oligonucleotide probes (50- to 70mers)
were designed from the reference sequence, Williams 82, and spaced at approximately
1.1 kilobase (kb) intervals (platform details can be found in Gene Expression Omnibus
accession number GPL11198 at www.ncbi.nlm.nih.gov/geo/). Mutant (Cy3 dye) and
reference (Cy5 dye) labeling reactions were performed with 1 µg each of genomic DNA
from FN38 (mutant) and Williams 82 (wild-type) leaf tissue samples. Mutant and wild-
Page 6 of 35
Page 7 of 35
The Plant Genome Accepted paper, posted 12/04/2014. doi:10.3835/plantgenome2014.10.0077
type DNA were labeled, quantified, and then hybridized for 72 hours at 42°C on the
CGH microarrays.
Plant material and segregating population development
FN38 characterization of Glyma06g03310 alleles
A segregating population was developed by crossing FN38 and ‘Jake’ (Shannon
et al., 2007). Jake was used as the female, and it is a mid-group V, registered plant line
that was received from Dr. Grover Shannon (Division of Plant Sciences, University of
Missouri Columbia-Delta Center). F1 seeds were produced at South Farm in Columbia,
Missouri during the summer of 2011. F1 plants were grown in a growth chamber with 14
hour days at 28°C and 10 hour nights at 22°C in the winter of 2011-2012. F2 seeds
were subsequently planted at South Farm in the summer of 2012. Individual F2 plants
were identified by number and observed for the FN38 multifoliate leaflet phenotype. F2:3
seeds were collected by single plant threshing 20 out of 27 plants; the other 7 plants
were not threshed due to death before maturity.
Generation and field experiments for the 2-kinase population
A segregating population, designated 2-kinase, was developed by crossing FN38
and
Gm-lpa-ZC-2,
which
are
homozygous
mutant
for
Glyma06g03310
and
Glyma14g07880, respectively. F1 seeds from the 2012 crosses were sent to our winter
nursery in Upala, Costa Rica and planted for advancement.
In the subsequent
generation, individual F2 plants were tagged and leaflets were sampled for DNA on
Whatman FTA (Whatman, Clifton, NJ) cards for genotyping assays conducted in our lab
at the University of Missouri, Columbia, MO. Punches of FTA leaf presses were used
The Plant Genome Accepted paper, posted 12/04/2014. doi:10.3835/plantgenome2014.10.0077
as templates to determine the IPK1 (chromosome 14 and chromosome 6) genotype.
Selected F2 lines for each genotypic class were harvested and single plant threshed
(SPT). There were 5 F2 plants for the double mutant class, and two plants each were
selected for the other genotypic classes. For the parental lines, five plants each were
grown out with the F2 generation, and after harvest, parental lines were SPT. For
phenotypic analysis of the Costa Rica seeds, 15 F2:3 seeds were lyophilized and ground
per line, including the parental lines. From each line, including the parental lines, 25 mg
and 10-15 mg were sampled from the ground samples for PA and Pi analysis,
respectively.
Seeds of the four selected classes were grown at South Farm in Columbia,
Missouri during the summer of 2013 using a complete randomized block design. There
were three replicates for the 13 different soybean lines of the various genotypic classes,
including parental lines. Each plot consisted of 10 seeds planted per line, and plots with
no emergence were replanted 16 days after the initial planting date. The population
was bulk harvested by plot, with every line and replication distinguished. Seed samples
were prepared for phenotypic analyses by lyophilizing and grinding a 15-seed F2:4
sample of each plot.
Two lines in all 3 reps, a 14W/06W and 14m/06m did not
germinate or did not live to maturity due to disease, so that the experiment size was
reduced by two lines.
Genotypic analysis of the sequence around the FN38 deletion
FN38 and Williams 82 single seeds were powdered in liquid nitrogen for DNA
isolation using the DNeasy Plant Mini Kit (Qiagen Sciences Inc., Germantown, MD).
Primers were designed to the region left of the deletion CGH start point and the right of
Page 8 of 35
Page 9 of 35
The Plant Genome Accepted paper, posted 12/04/2014. doi:10.3835/plantgenome2014.10.0077
the deletion CGH end point using Williams 82 as a reference at Phytozome
(www.phytozome.net), and the primers were manufactured through IDT (Coralville, IA).
Primers were carefully designed to target and amplify various size products on
chromosome 6 due to a highly similar region on chromosome 4 of soybean. Primers
are listed in Table 1 (pairs for L1, L2, L3, R1, R2, and R3) and were used at a final
concentration of 0.5 µM. Reactions were carried out in 20 µL final volume containing 550 ng DNA template, primers, buffer (40 mM Tricine-KOH (pH 8.0), 16 mM KCl, 3.5 mM
MgCl2, 3.75 µg mL‐1 BSA, 200 µM dNTPs), and 0.2X Titanium Taq polymerase (BD
Biosciences, Palo Alto, CA) with the following conditions: 95°C for 5 minutes followed by
40 cycles of 95°C for 20 seconds, 60°C for 20 seconds, and 72°C for 30 seconds. An
agarose gel, 1.2% concentration, was used to determine the presence of PCR product.
IPK1 (Glyma14g07880) molecular marker assay
Primer sequences and causative SNP location obtained by Yuan et al. (2012) for
the splice site mutation in the IPK1 (Glyma14g07880) gene were utilized in developing a
SimpleProbe assay for genotypic discrimination between wild-type, heterozygous, and
mutant alleles. The SimpleProbe (Flourescentric, Inc. ,Park City, UT) was designed
using Roche Applied Science LightCycler Probe Design software 2.0 (version 1.0,
February 2004) to match the wild-type sequence in the 14IPK1 gene. Primers were
mixed
in
a
5:2
asymmetric
CTCAGCTTCACCCCTTTC-3’
ratio
and
(final
final
concentration
concentration
0.5
0.2
µM
µM
IPK1f:
5’-
IPK1r:
5’-
CTAACTCAGATTTAATGCC-3’), with the SimpleProbe at a final concentration of 0.2
µM (IPK1: Fluorescein-SPC-GTAGGATGTACCTCTCCTTGAAGCAATTTC-Phosphate).
Page 10 of 35
The Plant Genome Accepted paper, posted 12/04/2014. doi:10.3835/plantgenome2014.10.0077
Reactions were carried out in 20 µL final volume containing 5-50 ng DNA
template, primers, buffer (40 mM Tricine-KOH (pH 8.0), 16 mM KCl, 3.5 mM MgCl2,
3.75 µg mL‐1 BSA, 200 µM dNTPs), SimpleProbe, and 0.2X Titanium Taq polymerase.
The amplification and melt curve were carried out in a Roche480 Light Cycler according
to this reaction: 95°C for 3 minutes followed by 45 cycles of 95°C for 20 seconds, 51°C
for 20 seconds, and 72°C for 30 seconds. A melt curve was performed by reading
every 0.2°C for 1 second from 50°C to 75°C in order to visualize the properties of the
products. Lines containing wild-type 14IPK1 alleles have a peak present at 65°C, while
mutant (Gm-lpa-ZC-2 derived splice site) 14IPK lines have a peak present at 59°C;
thus, heterozygous lines have two peaks at 59°C and 65°C.
IPK1 (Glyma06g03310)-linked molecular assay
We sought to identify a SNP tightly linked to the IPK1 (Glyma06g03310) deletion,
since a deletion PCR assay could not distinguish plants hemizygous for the deletion
from those that were homozygous wild-type for the chromosome 6 region. Based on
whole genome resequencing data in various soybean genomes by Lam et al. (2010),
we identified a SNP between FN38 and Gm-lpa-ZC-2 positioned in the third exon of
Glyma06g03310 at 2,341,942. The SNP causes a V150L missense change in a nonconserved amino acid position in the Gm-lpa-ZC-2 06IPK1. The linked SNP was used
to develop a SimpleProbe molecular marker assay.
Primers were mixed in a 2:5 asymmetric ratio (final concentration 0.2 µM IP52Kf:
5’-GCATGAGAGGTAAGAG
-3’
and
final
concentration
0.5
µM
IP52Kr:
5’-
GCCAAGGGAATTTCTCG -3’), with the SimpleProbe at a final concentration of 0.1 µM
(IP52K:
Fluorescein-SPC-GGCATTTCAATACCATGAGTGAAGACTGA-Phosphate).
Page 11 of 35
The Plant Genome Accepted paper, posted 12/04/2014. doi:10.3835/plantgenome2014.10.0077
Reaction conditions were as above with thermocycling parameters: 95°C for 3 minutes
followed by 45 cycles of 95°C for 20 seconds, 56°C for 20 seconds, and 72°C for 20
seconds. A melt curve was performed by reading every 0.2°C for 1 second from 52°C
to 77° The wild-type (FN38) peak was present at 65°C, while the alternate (Gm-lpa-ZC2) peak was at 60°C; thus, the heterozygous peaks were at 60°C and 65°C.
Germination and emergence
The germination experiment was performed using a version of the rag doll test
(http://edis.ifas.ufl.edu/ag182). Three sheets of germination paper were wet with double
de-ionized water. Excess water was allowed to drip off before laying two sheets flat and
placing 25 F2:4 seeds from each replication grown in Columbia, Missouri on the sheets.
The other sheet of germination paper was placed on top of the seeds, and the sheets
were then rolled into a tube and placed onto a tray. The tray was placed into an
incubator at 28°C and kept moist. The seeds were examined after 3 days, and those
seeds with a hypocotyl were identified as germinated seedlings.
The emergence experiment was conducted at South Farm in Columbia, Missouri
in 2014. Fifty F2:4 seeds from each replication grown in Columbia, Missouri were hand
planted into a 48 inch row into prepared seed beds utilizing a complete randomized
block design. Emergence was scored seven days after planting.
Pi quantification by colorimetric assay
Seed inorganic phosphate was quantified as described by Gillman, et al (2009).
PA, IP5, and IP4 quantification by HPLC
The Plant Genome Accepted paper, posted 12/04/2014. doi:10.3835/plantgenome2014.10.0077
Page 12 of 35
An HPLC method was used to quantify seed PA-P (Chen and Li, 2003). A 25 mg
lyophilized ground seed sample was combined with 0.5 mL extraction buffer (500 mM
HCl) shaken for 1 hour at room temperature, and centrifuged at 20,000 g for 15
minutes. The supernatant was filtered through a 0.22-micron filter, and 75 µL of filtrate
was analyzed by ion chromatography using a Dionex CarboPac PA-100 guard column
and a CarboPac PA-100 analytical column on a Dionex ICS-5000 chromatography
system with post column derivitization (Thermo Scientific Dionex, Waltham, MA). The
linear elution gradient was effected by two eluents: deionized water and 0.5 M HCl; time
0 min, 8% 0.5 M HCl; time 30, 100% 0.5 M HCl; time 35, 100% 0.5 M HCl; time 35.1,
100% 0.5 M HCl; time 40, 8% 0.5 M HCl. A post-column derivitization was achieved
with a solution of 1 g L-1 Fe(NO3)3 in 0.33 M HClO4 using a 750-mL knitted coil and was
followed by detection at 295 nm. Flow rates of eluent and post-column solution were
1.0 and 0.4 mL minute-1, respectively. PA standard (PA dipotassium salt; Sigma), at 1
mM concentration, eluted at 29.8 minutes, and a standard curve was calculated from
serial dilutions of 4 mM PA standard. Results were converted to µg PA-P mg seed-1.
I(1,3,4,5,6)P5 (inositol pentaphosphate ammonium salt; Cayman Chemical, Ann
Arbor, Michigan) and I(1,4,5,6)P4 (inositol tetraphosphate sodium salt; Cayman
Chemical) standards, at 1 mM concentration, eluted at 22.5 and 15.2 minutes,
respectively,
and a standard curve was calculated from serial dilutions of 1 mM.
Results were converted to µg IP5-P mg seed-1 and µg IP4-P mg seed-1. Elution times for
I(1,3,4,5)P4 and I(1,3,4,6)P4 (A.G. Scientific, San Diego, CA) were 11.6 and 10.7
minutes, respectively. I(3,4,5,6)P4 (A.G. Scientific) eluted with the same retention time
as I(1,4,5,6)P4.
Page 13 of 35
The Plant Genome Accepted paper, posted 12/04/2014. doi:10.3835/plantgenome2014.10.0077
Statistical analysis
All statistical analyses were carried out using the SAS 9.3 software (SAS Institute
Inc., Cary, NC). All lines were grouped into 6 categories based on their genotype with
the parents separate. For Costa Rica produced seed, it was a completely randomized
design, while Missouri was replicated three times in randomized complete block design.
Basic statistic parameters for each data set were obtained using the MIXED procedure
using either a single- or double-factor ANOVA. For Costa Rica, categories and lines
were the classes used, with lines randomized and least square means determined for
categories.
For, Missouri, another class was used, designated block, due to the
replication. For IP5 and IP4, categories with a value of 0 were deleted before analysis;
however using the F value, the other categories were able to be identified as statistically
different than 0.
Page 14 of 35
The Plant Genome Accepted paper, posted 12/04/2014. doi:10.3835/plantgenome2014.10.0077
Results
Characterization of deleted IPK1, and other genes, in FN irradiated line
A mutant population of fast neutron-treated Williams 82 plants was developed for
use in reverse genetics research, but one line was selected for further genomic
characterization based on its multifoliate phenotype (data not shown).
Several M3
seeds of a multifoliate plant (named FN38) were used as source DNA in Comparative
Genomic Hybridization (CGH) for analysis of deletions in the genome. For line FN38,
one region on chromosome 6 showed evidence of an almost 90,000 bp deletion
(2,252,581 to 2,339,716 Glycine max v1.1).
This deletion encompassed eleven genes
including at least the 3’ portion of the IPK1 homolog on chromosome 6,
Glyma06g03310.9 (Table 2).
In the Williams 82 Glycine max v1.1 sequence, the IPK1 gene on chromosome 6
(Glyma06g03310.9) is present as seven exons in the antisense orientation on the
chromosome spanning positions 2,338,844 – 2,342,668. Based on detection of PCR
amplification products around the putative deletion, we expected that roughly the first
three exons of the IPK1 gene (Glyma06g03310.9) were still present in the genome of
line FN38. However, the deleted region appeared to abolish the final (seventh) IPK1
exon with the fourth, fifth, and sixth exons in a region of uncertainty (Figure 1).
To analyze the effect on P partitioning in seeds for soybeans containing a
deletion encompassing part of the chromosome 6 IPK1 gene (Glyma06g03310;
Page 15 of 35
The Plant Genome Accepted paper, posted 12/04/2014. doi:10.3835/plantgenome2014.10.0077
hereafter abbreviated 06IPK1) we analyzed the seed P phenotype and the chromosome
6 deletion genotype in a segregating population developed by crossing FN38
(homozygous for deleted 06IPK1) and Jake (homozygous for presumably functional,
wild-type 06IPK1). For field grown FN38, Jake, and the 20 plants in the population,
there were no statistically significant differences for PA-P or Pi-P among any of the lines
compared to each other or compared to the reference cultivar Williams 82 (data not
shown).
Combinations of two independent mutant IPK1 alleles
A splice-site mutation in the chromosome 14 IPK1 (Glyma14g07880) resulted in
altered P partitioning in seeds of the soybean line Gm-lpa-ZC-2 (Yuan et al., 2012).
Even though the FN38 deletion of 06IPK1 did not appear to alter P partitioning on its
own, we hypothesized that further decreased PA and increased Pi could be obtained for
lines containing both the 06IPK1 and chromosome 14 IPK1 (14IPK1) mutations. Thus,
a segregating population, designated 2-kinase, was developed by crossing FN38 and
Gm-lpa-ZC-2. Soybean lines FN38 and Gm-lpa-ZC-2 each contain homozygous mutant
alleles for one IPK1 homolog, 06IPK1/Glyma06g03310 or 14IPK1/Glyma14g07880,
respectively. Genotyping assays were developed to accurately score the allele status
for Glyma14g07880 and Glyma06g03310 (see Materials and Methods).
This second population was developed and assessed in both Columbia, Missouri
and Upala, Costa Rica. In Costa Rica, F2 plants were genotyped for the allele status of
both of the two IPK1 genes, and genotypic selections were made based on
homozygosity at both IPK1 loci to identify at least two plants in the population containing
one of the four possible homozygous genotypes for 14IPK1 and 06IPK1. In Columbia,
The Plant Genome Accepted paper, posted 12/04/2014. doi:10.3835/plantgenome2014.10.0077
Page 16 of 35
Missouri, replicated plots of F2:3 plants were grown, and bulked F2:4 seeds were
analyzed for the different genotypic classes.
The four selected genotypic classes based on the Glyma14g07880 and
Glyma06g03310 allele status were: wild-type/wild-type (14W/06W), wild-type/mutant
(14W/06m), mutant/wild-type (14m/06W), and the double mutant (mutant/mutant;
14m/06m).
The Gm-lpa-ZC-2 (14m/16W) and FN38 (14W/06m) parents of the
population were grown along with the populations.
Phosphorus partitioning in seeds of the 2-kinase population produced in two
locations
For the Costa Rica and Missouri environments, we analyzed Pi as well as PA
and lower inositols (IP5 and IP4) for the soybean seeds in the four genotypic classes
based on the chromosome 14 and chromosome 6 IPK1 alleles. There were major,
biologically significant differences in the accumulation of each P-component for the
different genotypic classes in either Missouri or Costa Rica (Table 3). Pi-P is typically
low in soybean seeds, and it had been shown to be increased in chromosome 14 IPK1
mutant line Gm-lpa-ZC-2 (Yuan et al., 2012). Our results confirmed the heritability of
significantly increased Pi-P in 14m/06W lines compared to lines inheriting all wild-type
alleles of IPK1, 14W/06W (approximately a three-fold increase); in addition, we
confirmed our results from the first population that showed the chromosome 6 IPK1
mutants have no effect on Pi-P on their own. However, the double mutant genotypic
class (14m/06m) showed the highest Pi-P levels, representing approximately a seven to
eight-fold increase in Pi-P for the double mutant lines compared to lines inheriting all
wild-type alleles of IPK1.
Page 17 of 35
The Plant Genome Accepted paper, posted 12/04/2014. doi:10.3835/plantgenome2014.10.0077
The PA-P results showed a dramatic reduction in PA-P for the double mutant
14m/06m class (Table 3). All of the other genotypic classes were either not statistically
different from one another (Costa Rica) or showed a slight but significant reduction in
PA-P for the 14m/06W lines (Missouri). The double mutant 14m/06m class contained
approximately 22% and 15% of the PA-P as the average of the other genotypic classes
in Costa Rica and Missouri, respectively. There were no significant differences for Pi-P
or PA-P for the different genotypic classes between the Costa Rica and Missouri
environments (data not shown).
Since inositol (1,3,4,5,6) pentakisphosphate (IP5) is the substrate for IPK1, we
wanted to investigate the accumulation of lower inositols in the different genotypic
classes (Table 3). Lower inositols (IP5 and IP4) accumulated in genotypic classes that
contained the chromosome 14 IPK1 mutant alleles (14m/16W and 14m/06m). There
were significant environment effects for the lower inositols (data not shown). For IP5,
the double mutants (14m/06m) accumulated the highest levels of IP5-P in both
locations. Lines in the 14m/16W genotypic class produced lower but detectable levels
of IP5-P.
For inositol-tetrakisphosphate (IP4), the double mutant class 14m/06m
accumulated the highest levels of IP4-P in Costa Rica.
In Missouri, the 14m/06m class
had a high accumulation of IP4-P, but it was not significantly different than the two
14m/16W classes for IP4-P.
Overall, the soybean seeds from the double mutant class 14m/06m produced a
characteristic P partitioning profile compared to wild-type and other lpa soybean lines
(Figure 2). The main features of P partitioning in 14m/06m lines compared to other
soybean lpa lines were very low PA-P levels, moderate accumulation of Pi-P, and the
Page 18 of 35
The Plant Genome Accepted paper, posted 12/04/2014. doi:10.3835/plantgenome2014.10.0077
accumulation of high amounts of P in the lower inositols IP4 and IP5.
The severe
reduction in PA-P sets the double mutant 14m/06m class apart from the 14m/06W
class. The striking accumulation of P in lower inositols rather than Pi-P distinguishes
the double mutant 14m/06m class from the soybean lpa1-lpa2 transporter mutant
combinations (Gillman et al., 2013; Yuan et al., 2007).
Identification of the accumulated IP4
Lines containing the Glyma14g07880 IPK1 mutant alleles had an increase in
lower inositols, while lines wild-type for this gene, such as FN38, had no detectable
levels of lower inositols.
synthesizing
PA
is
Previous research has confirmed that the last step to
phosphorylating
the
2-position
on
inositol
(1,3,4,5,6)
pentakisphosphate by the enzyme inositol-pentakisphosphate 2-kinase, IPK1 (reviewed
in Brearley and Hanke, 1996). It is currently unclear whether seed PA is synthesized
through a lipid-dependent or lipid-independent pathway (Raboy, 2003; StevensonPaulik et al., 2005). The inositol-tetrakisphosphate intermediate in the lipid-independent
pathway is I(3,4,5,6)P4, but for the lipid-dependent pathway the intermediate is
I(1,4,5,6)P4
with
I(1,3,4,5)P4
and
I(1,3,4,6)P4
as
possible
lipid-dependent
interconversion products (Stevenson-Paulik et al., 2005).
Since
inositol-tetrakisphosphate,
along
with
inositol
(1,3,4,5,6)
pentakisphosphate, were the dominant lower inositols, 1 mM standards of four inositol
tetrakisphosphates [I(1,3,4,6)P4, I(1,3,4,5)P4, I(3,4,5,6)P4, and I(1,4,5,6)P4] were
analyzed by high performance liquid chromatography (Figure 3).
Based on the
retention time of the peak in Gm-lpa-ZC-2 (14m/06W) and the lines with a mutated
Page 19 of 35
The Plant Genome Accepted paper, posted 12/04/2014. doi:10.3835/plantgenome2014.10.0077
Glyma14g07880 IPK1 (14m/06W and 14m/06m), it was determined that the
accumulated inositol-tetrakisphosphate was I(1,4,5,6)P4 or I(3,4,5,6)P4 (Figure 3).
Germination and field emergence
For soybeans, alterations in seed PA accumulation have been correlated with
reduced germination and emergence. The F2:4 seeds produced in Missouri from the 2kinase population were analyzed for germination and field emergence. The scores for
all of the genotypes were above 80% for standard germination, and none of the
genotypic classes were statistically different than one another (data not shown). There
was significant variation in field emergence per line, but the double mutant class as a
whole was not significantly lower emerging than either of the single mutant classes
(data not shown).
The Plant Genome Accepted paper, posted 12/04/2014. doi:10.3835/plantgenome2014.10.0077
Page 20 of 35
Discussion
Initial characterization indicated that soybean line FN38 contained a genomic
deletion encompassing at least part of a homologous IPK1 (Glyma06g03310), so P
partitioning was analyzed to determine if the null allele of the chromosome 6 IPK1 could
reduce PA like it’s counterpart mutant IPK1 on chromosome 14 in soybean line Gm-lpaZC-2. The partial deletion of the IPK1 gene in FN38 did not increase seed Pi-P or
decrease PA-P compared to the seeds of a registered cultivar line. These results are
consistent with expression data reported by Yuan et al. (2012), in which
Glyma14g07880 had higher expression in soybean seeds compared to the other two
homologous genes (Glyma06g03310 and Glyma04g03240). However, combining the
two mutant IPK1 genes produced an enhanced lpa phenotype with a unique P
partitioning profile. Our double mutant lines (14m/06m) produced seeds with very low
PA and up to 3.2 µg P mg-1 seed in the lower inositols IP5 and IP4. The environment
had an effect on the accumulation of lower inositols but not on PA-P or Pi-P, so
understanding the variation in the lower inositols in additional environments will be
important to further characterizing the lpa trait in these new IPK1 double mutants. In
addition, the effect of such high accumulation of IP5 and IP4 will need to be evaluated for
nutritional value in soybean meal. Interestingly, a series of studies identified IP5 as a
potential anti-cancer compound because it can block the activation of a critical human
enzyme which plays a key role in cell survival and proliferation (reviewed in Falasca,
2009).
Even though the RNA expression of the 06IPK1 gene was shown to be low in
developing seeds (Yuan et al., 2012), this work demonstrated clearly that the encoded
Page 21 of 35
The Plant Genome Accepted paper, posted 12/04/2014. doi:10.3835/plantgenome2014.10.0077
06IPK enzyme is contributing (along with 14IPK1) to the total IPK1 enzyme activity in
developing seeds. Functional redundancy due to ancient genome duplication resulting
in two- to four- member homologous gene families has been fairly well documented in
soybean, particularly in seed composition research. The subtle contributions of
additional gene family members have been previously revealed by re-mutagenesis of
lines originally found to contain a desirable phenotype (Reinprecht et al., 2009).
The
genetic redundancy identified here is in contrast to the soybean seed lpa phenotype
controlled almost entirely by the MIPS1 gene, despite the fact that three additional
closely related MIPS genes are present in the soybean genome (Chappell et al., 2006;
Hitz et al., 2002; Yuan et al., 2007). In the present case, the mutation of the 14IPK1
gene alone has a desirable phenotypic effect, while mutation of the 06IPK1 gene only
reveals a phenotypic effect when combined with the 14IPK1 mutation. However, the
double mutant lines produced an improved P partitioning profile with significantly less
PA and more available P than the 14IPK mutation alone.
The germination and emergence of the 14m/06m seeds produced in our
temperate environment did not reveal any obvious defects. We attempted to assess the
emergence capacity of seeds produced in the Costa Rica environment, but uneven
destruction of germinated seedlings by pests prevented the analysis. Further research
will be necessary to identify and more fully characterize any negative effects of the
altered P partitioning profile in the IPK1 double mutants on field emergence.
Besides soybean, IPK1 mutations have been characterized in maize and
Arabidopsis.
In Arabidopsis, multiple putative IPK1 genes were identified in the
genome, but only one (atipk1; At5g42810) appeared to contribute to seed IPK1 enzyme
Page 22 of 35
The Plant Genome Accepted paper, posted 12/04/2014. doi:10.3835/plantgenome2014.10.0077
activity (Kim and Tai, 2011; Stevenson-Paulik et al., 2005).
However, mutation of
At5g42810 only reduced seed PA levels by about 50%; when the atipk1 mutation was
combined with an I(1,3,4)P3 6-/3-/5- kinase (AtIPK2-β; At5g61760) mutation, seed PA
was reduced to near undetectable levels (Stevenson-Paulik et al., 2005). Along with a
large accumulation of I(1,3,4,5,6)P5, the atipk1-1 mutant accumulated a mixture of IP4s,
including I(3,4,5,6)P4, I(1,3,4,6)P4, and I(1,4,5,6)P4 in seeds.
In maize, a reverse
genetics method was used to target mutation in the maize IPK1 gene, one of two genes
in the maize genome sharing 98% sequence identity in the coding regions (Shukla et
al., 2009; Sun et al., 2007).
Maize IPK1 mutants demonstrated a distribution of lpa
phenotypes consistent with at least a partial reduction of the total IPK1 enzyme activity
in developing seeds (Shukla et al., 2009). Characterization of the lower inositols in the
IPK1 mutant maize seeds was not presented (Shukla et al., 2009).
The biochemical pathway resulting in the production of PA in plant seeds still has
many steps that have eluded characterization. However, both in vitro characterization
of recombinant IPK1 enzymes and the analysis of an increasing collection of IPK1
mutants suggest that plant IPK1 genes encode a polyphosphate kinase that can utilize
potentially different IP3 and IP4 species as well as I(1,3,4,5,6)P5 (Caddick et al., 2008;
Stevenson-Paulik et al., 2005; Sun et al., 2007; Sweetman et al., 2006).
Since
I(1,3,4,5,6)P5 and IP4 species accumulated in the soybean IPK1 mutants, our results are
consistent with soybean IPK1s acting as polyphosphate kinases. Two lipid-dependent
routes and a lipid-independent route for PA synthesis in seeds have been proposed
(Stevenson-Paulik et al., 2005). Our results narrow down the possible pathways to one
lipid-dependent [through I(1,4,5,6)P4] and one lipid-independent [through I(3,4,5,6)P4],
Page 23 of 35
The Plant Genome Accepted paper, posted 12/04/2014. doi:10.3835/plantgenome2014.10.0077
while ruling out the second lipid-dependent pathway [through I(1,3,4,5)P4 or
I(1,3,4,6)P4]. The identification of new lpa crops may lead to a better understanding of
both the importance of PA to seeds and provide crops with enhanced nutritional
qualities for foods and feeds.
Acknowledgements
We would like to thank the Paul Little and Christi Cole for their superb technical
assistance. This research was supported by the United Soybean Board. We would
also like to thank Pengyin Chen (University of Arkansas) for his generous sharing of
Gm-lpa-ZC-2 seed.
Page 24 of 35
The Plant Genome Accepted paper, posted 12/04/2014. doi:10.3835/plantgenome2014.10.0077
References
Anderson B.P., and W.R. Fehr. 2008. Seed source affects field emergence of lowphytate soybean lines. Crop Sci 48:929-932
Bolon Y.T., W.J. Haun, W.W. Xu, D. Grant, M.G. Stacey, R.T. Nelson, D.J. Gerhardt,
J.A. Jeddeloh, G. Stacey, G.J. Muehlbauer, J.H. Orf, S.L. Naeve, R.M. Stupar,
and C.P. Vance. 2011. Phenotypic and genomic analyses of a fast neutron
mutant population resource in soybean. Plant Physiol 156:240-253
Brearley C. A. and D. E. Hanke. 1996. Metabolic evidence for the order of addition of
individual phosphate esters in the myo-inositol moiety of inositol
hexakisphosphate in the duckweed Spirodela polyrhiza L. Biochem. J. 314: 227233
Brinch-Pedersen H., L.D. Sørensen, and P.B. Holm. 2002. Engineering crop plants:
getting a handle on phosphate. Trends in Plant Science 7(3):118-125
Caddick S.E.K., C.J. Harrison, I. Stavridou, J.L. Mitchell, A.M. Hemmings, and C.A.
Brearley. 2008. A solanum tuberosum inositol phosphate kinase (stIPK1)
displaying inositol phosphate–inositol phosphate and inositol phosphate–ADP
phosphotransferase activities. FEBS Letters 582:1731-1737
Chappell A.S., A.M. Scaboo, X. Wu, H. Nguyen, V.R. Pantalone, and K.D. Bilyeu. 2006.
Characterization of the MIPS gene family in Glycine max. Plant Breed 125:493500
Chen Q.C., and B.W. Li. 2003. Separation of phytic acid and other related inositol
phosphates by high-performance ion chromatography and its applications. J
Chromatogr 1018:41-52
Falasca M. 2009. Anti-cancer activity of the bioactive
pentakisphosphate. Phytochemistry Reviews 8:369-374
compound
inositol
Frank T., R. Habernegg, F.J. Yuan, Q.Y. Shu, and K.H. Engel. 2009a. Assessment of
the contents of phytic acid and divalent cations in low phytic acid (lpa) mutants of
rice and soybean. J Food Comp Anal 22:278-284
Page 25 of 35
The Plant Genome Accepted paper, posted 12/04/2014. doi:10.3835/plantgenome2014.10.0077
Frank T., S. Norenberg, and K.H. Engel. 2009b. Metabolite profiling of two novel low
phytic acid (lpa) soybean mutants. J Agric Food Chem 57:6408-6416
Gillman J.D., I. Baxter, and K. Bilyeu. 2013. Phosphorus partitioning of soybean lines
containing different mutant alleles of two soybean seed-specific adenosine
triphosphate-binding cassette phytic acid transporter paralogs. The Plant
Genome 6:0
Gillman J.D., V.R. Pantalone, and K. Bilyeu. 2009. The low phytic acid phenotype in
soybean line CX1834 is due to mutations in two homologs of the maize low
phytic acid gene. Plant Genome J 2:179-190
Hitz W.D., T.J. Carlson, P.S. Kerr, and S.A. Sebastian. 2002. Biochemical and
molecular characterization of a mutation that confers a decreased
raffinosaccharide and phytic acid phenotype on soybean seeds. Plant Physiol
128:650-660
Kim S.I., and T. Tai. 2011. Identification of genes necessary for wild-type levels of seed
phytic acid in Arabidopsis thaliana using a reverse genetics approach. Molecular
Genetics and Genomics 286:119-133
Lam H.M., X. Xu, X. Liu, W. Chen, G. Yang, F.L. Wong, M.W. Li, W. He, N. Qin, B.
Wang, J. Li, M. Jian, J. Wang, G. Shao, S.S. Sun, and G. Zhang. 2010.
Resequencing of 31 wild and cultivated soybean genomes identifies patterns of
genetic diversity and selection. Nat Genet 42:1053-1059
Maroof, M.A.S. and G.R. Buss. 2011. Low phytic acid, low stachyose, high sucrose
soybean lines. USPTO. US Patent 8,003,856
Maupin L.M., and K.M. Rainey. 2011. Improving emergence of modified phosphorus
composition soybeans: Genotypes, germplasm, environments, and selection.
Crop Sci 51:1946-1955
Maupin L.M., M.L. Rosso, and K.M. Rainey. 2011. Environmental effects on soybean
with modified phosphorus and sugar composition. Crop Sci 51:642-650
Meis S.J., W.R. Fehr, and S.R. Schnebly. 2003. Seed source effect on field emergence
of soybean lines with reduced phytate and raffinose saccharides. Crop Sci
43:1336-1339
Raboy V. 2003. Myo-inositol-1,2,3,4,5,6-hexakisphosphate. Phytochemistry 64:10331043
Raboy V., D.B. Dickinson, and F.E. Below. 1984. Variation in seed total phosphorus,
phytic acid, zinc, calcium, magnesium, and protein among lines of Glycine max
and G. soja. Crop Sci 24:431-434
The Plant Genome Accepted paper, posted 12/04/2014. doi:10.3835/plantgenome2014.10.0077
Page 26 of 35
Raboy V., K.A. Young, J.A. Dorsch, and A. Cook. 2001. Genetics and breeding of seed
phosphorus and phytic acid. J Plant Physiol 158:489-497
Reinprecht Y., S.Y. Luk-Labey, J. Larsen, V.W. Poysa, K. Yu, I. Rajcan, G.R. Ablett,
and K.P. Pauls. 2009. Molecular basis of the low linolenic acid trait in soybean
EMS mutant line RG10. Plant Breeding 128:253-258
Schmutz J., S.B. Cannon, J. Schlueter, J. Ma, T. Mitros, W. Nelson, D.L. Hyten, Q.
Song, J.J. Thelen, J. Cheng, D. Xu, U. Hellsten, G.D. May, Y. Yu, T. Sakurai, T.
Umezawa, M.K. Bhattacharyya, D. Sandhu, B. Valliyodan, E. Lindquist, M. Peto,
D. Grant, S. Shu, D. Goodstein, K. Barry, M. Futrell-Griggs, B. Abernathy, J. Du,
Z. Tian, L. Zhu, N. Gill, T. Joshi, M. Libault, A. Sethuraman, X.C. Zhang, K.
Shinozaki, H.T. Nguyen, R.A. Wing, P. Cregan, J. Specht, J. Grimwood, D.
Rokhsar, G. Stacey, R.C. Shoemaker, and S.A. Jackson. 2010. Genome
sequence of the palaeopolyploid soybean. Nature 463:178-183
Sebastian S., P.S. Kerr, R. Pearlstein, and W. Hitz. 2000. Soybean germplasm with
novel genes for improved digestibility. In: Drackley J (Ed.). Soy in animal
nutrition. Federation of Animal Science Societies, Savoy, IL. pp. 56-74
Shannon J.G., J.A. Wrather, D.A. Sleper, R.T. Robbins, H.T. Nguyen, and S.C. Anand.
2007. Registration of ‘jake’ soybean. Journal of Plant Registrations 1:29
Shukla V.K., Y. Doyon, J.C. Miller, R.C. DeKelver, E.A. Moehle, S.E. Worden, J.C.
Mitchell, N.L. Arnold, S. Gopalan, X. Meng, V.M. Choi, J.M. Rock, Y.Y. Wu, G.E.
Katibah, G. Zhifang, D. McCaskill, M.A. Simpson, B. Blakeslee, S.A. Greenwalt,
H.J. Butler, S.J. Hinkley, L. Zhang, E.J. Rebar, P.D. Gregory, and F.D. Urnov.
2009. Precise genome modification in the crop species Zea mays using zincfinger nucleases. Nature 459:437-441
Stevenson-Paulik J., R.J. Bastidas, S.T. Chiou, R.A. Frye, and J.D. York. 2005.
Generation of phytate-free seeds in Arabidopsis through disruption of inositol
polyphosphate kinases. Proc Natl Acad Sci U S A 102:12612-12617
Sun Y., M. Thompson, G. Lin, H. Butler, Z. Gao, S. Thornburgh, K. Yau, D.A. Smith,
and V.K. Shukla. 2007. Inositol 1,3,4,5,6-pentakisphosphate 2-kinase from
maize: Molecular and biochemical characterization. Plant Physiol 144:1278-1291
Sweetman D., S. Johnson, S.E. Caddick, D.E. Hanke, and C.A. Brearley. 2006.
Characterization of an Arabidopsis inositol 1,3,4,5,6-pentakisphosphate 2-kinase
(AtIPK1). Biochem J 394:95-103
Urbano G., M. López-Jurado, P. Aranda, C. Vidal-Valverde, E. Tenorio, and J. Porres.
2000. The role of phytic acid in legumes: Antinutrient or beneficial function? J
Physiol Biochem 53:283-294
Page 27 of 35
The Plant Genome Accepted paper, posted 12/04/2014. doi:10.3835/plantgenome2014.10.0077
Wilcox J.R., G.S. Premachandra, K.A. Young, and V. Raboy. 2000. Isolation of high
seed inorganic P, low-phytate soybean mutants. Crop Sci 40:1601-1605
York J.D., A.R. Odom, R. Murphy, E.B. Ives, and S.R. Wente. 1999. A phospholipase cdependent inositol polyphosphate kinase pathway required for efficient
messenger RNA export. Science 285:96-100
Yuan F.J., H.J. Zhao, X.L. Ren, S.L. Zhu, X.J. Fu, and Q.Y. Shu. 2007. Generation and
characterization of two novel low phytate mutations in soybean (Glycine max L.
Merr.). Theor Appl Genet 115:945-957
Yuan F.J., D.H. Zhu, B. Deng, X.J. Fu, D.K. Dong, S.L. Zhu, B. Q. Li, and Q.Y. Shu.
2009. Effects of two low phytic acid mutations on seed quality and nutritional
traits in soybean (Glycine max L. Merr). J Agric Food Chem 57:3632-3638
Yuan F.J., D.H. Zhu, Y.Y. Tan, D.K. Dong, X.J. Fu, S.L. Zhu, B.Q. Li, and Q.Y. Shu.
2012. Identification and characterization of the soybean IPK1 ortholog of a low
phytic acid mutant reveals an exon-excluding splice-site mutation. Theor Appl
Genet 125:1413-1423
The Plant Genome Accepted paper, posted 12/04/2014. doi:10.3835/plantgenome2014.10.0077
Page 28 of 35
Figure 1. Schematic representation for the deletion region and IPK1 gene on FN38 chromosome 6. A. A
portion of chromosome 6 present in soybean line FN38 is represented by the solid black horizontal line
interrupted by gray lines representing deleted regions. CGH detected probes were deleted from position
2,252,581 to 2,339,716, represented here as solid gray ovals on solid gray chromosome lines
(condensed relative distance with hash marks). Connecting the known present chromosome region to
the deleted are solid and dashed gray lines representing deletion of the chromosome confirmed by PCR,
and uncertain chromosome regions, respectively. L1, L2, L3, R1, R2, and R3 represent the approximate
positions of the PCR amplicons, with black font representing amplicons positive for PCR and gray font
representing no PCR amplification for FN38 DNA. A scale is given under the right side of the deletion
indicating chromosome positions from 2,339,000 to 2,342,000, which also is the approximate position of
IPK1 (Glyma06g03310) in the antisense orientation on the chromosome. B. Representation of the sense
orientation of the IPK1 (Glyma06g03310) gene on chromosome 6. Exons are represented as boxes
connected by lines representing introns.
Black lines indicate the presence of the region on the
chromosome, dashed gray lines represent uncertain chromosome regions, and solid gray lines indicate
deletion of the chromosome confirmed by PCR. The chromosome position of the start codon and stop
codon are indicated above the gene structure.
The approximate position of the R1, R2, and R3
amplicons is indicated below the gene structure, with black font representing amplicons positive for PCR
and gray font representing no PCR amplification for FN38 DNA. The positive sign above the third exon
represents the position of the SNP used for linkage of the deletion between FN38 and Gm-lpa-ZC-2.
Figure 2. Comparison of relative seed phosphorus partitioning in a selection of low phytic acid soybean
lines. Each stack totaling 100% of the measured P component data (Pi-P, PA-P, IP5-P, and IP4-P) is from
different genotypic classes from this work (from the Missouri environment) as well as three lpa1/lpa2
combinations from Gillman et al., also from a Missouri environment (Gillman et al., 2013). 14W/06W is
equivalent to typical wild-type soybean lines. 14m/06W is the genotypic class representing the mutation
in Gm-lpa-ZC-2. lpa1a2a indicates lines with null alleles of lpa1 and missense alleles of lpa2; lpa1b2b
indicates lines with mis-splicing alleles of lpa1 and null alleles of lpa2; and lpa1a2b indicates lines with
null alleles of both lpa1 and lpa2 (Gillman et al., 2013).
Page 29 of 35
The Plant Genome Accepted paper, posted 12/04/2014. doi:10.3835/plantgenome2014.10.0077
Figure 3. Separation of inositol phosphates and identification of I(1,4,5,6) or I(3,4,5,6) tetrakisphosphate
in soybean seeds with mutations in the chromosome 14 IPK1 (Glyma14g07880). Peaks are identified by
retention time as PA, I(1,2,3,4,5,6)P6; IP5, I(1,3,4,5,6,)P5; and several IP4s. A. The output from an ion
chromatography run with an injection of 1 mM I(1,3,4,5)P4. B. The output from an ion chromatography
run with an injection of 1 mM I(1,3,4,6)P4. C. The output from an ion chromatography run with an
injection of 1 mM I(1,4,5,6)P4. I(3,4,5,6)P4 had the same retention time as I(1,4,5,6)P4 (15.2 minutes) and
the IP4 present in seed samples. D. The output from an ion chromatography run of Missouri-produced
Gm-lpa-ZC-2 (14m/06W) seed. E. The output from an ion chromatography run of Missouri-produced
double mutant (14m/06m) seed.
Page 30 of 35
The Plant Genome Accepted paper, posted 12/04/2014. doi:10.3835/plantgenome2014.10.0077
Table 1. Primers used to characterize FN38 deletion.
Primer
Set
L1
L2
L3
R1
R2
R3
Forward (5’-3’)
CATGATGAGCTTACCCTACTCC
AACCTAACTCCACTGTATATCGGAA
GGTCGGATTTTTCATCTTGA
CAACTACATATGGTGCCGGTT
GGAAGGTATAAGAGTGAGAAGC
GTAACTGTAACAAATCCTGCTAAAAC
Primers are from 5' to 3'.
5’ Position
2250527
2251670
2253292
2341585
2339740
2338825
Reverse (5’-3’)
CAAGTCATTCTGGTCTCAGTGTT
ATGTTACGTATTCTCGAATAGCAA
TCAGTATGCTTGCTGGTTGC
ATTATGAATCTCTTACCTCTCATG
GTTCAGCTTCTGCTGGTAGG
TGCTCTGGAATGAGTGGACA
5’ Position
2250707
2252012
2253547
2341796
2340141
2339173
Product
Size
181
343
256
212
402
349
Page 31 of 35
The Plant Genome Accepted paper, posted 12/04/2014. doi:10.3835/plantgenome2014.10.0077
Table 2. Gene identification located within the FN38 deletion identified by comparative genomic hybridization.
CGH
ID
FN38
FN38
FN38
FN38
FN38
FN38
FN38
FN38
FN38
FN38
FN38
Chromosome
Glyma06
Glyma06
Glyma06
Glyma06
Glyma06
Glyma06
Glyma06
Glyma06
Glyma06
Glyma06
Glyma06
Start
Codon
2252754
2259294
2262571
2270034
2274777
2286289
2301058
2305620
2316535
2330907
2342668
Gene
Orientation
+
+
+
+
+
+
+
-
Glyma ID
Glyma06g03200
Glyma06g03210
Glyma06g03220
Glyma06g03230
Glyma06g03240
Glyma06g03250
Glyma06g03270
Glyma06g03280
Glyma06g03290
Glyma06g03300
Glyma06g03310
Best Arabidopsis TAIR10 hit define
BEL1-like homeodomain 3
BEL1-like homeodomain 11
UDP-Glycosyltransferase superfamily protein
regulatory particle triple-A ATPase 4A
RING/U-box superfamily protein
basic leucine-zipper 44
mitogen-activated protein kinase 1
Clathrin adaptor complexes medium subunit family protein
HXXXD-type acyl-transferase family protein
Sec14p-like phosphatidylinositol transfer family protein
Inositol-pentakisphosphate 2-kinase family protein
Page 32 of 35
The Plant Genome Accepted paper, posted 12/04/2014. doi:10.3835/plantgenome2014.10.0077
Table 3. Phosphorus partitioning means and statistical letter groupings for populations grown in Costa Rica and Columbia, MO.
Location
Costa Rica
Columbia, MO
Genotype
(Glyma14g07880/Glyma06g03310)
PA-P
FN38 (14W/06m)
Gm-lpa-ZC-2 (14m/06W)
14W/06W
14W/06m
14m/06W
14m/06m
FN38 (14W/06m)
Gm-lpa-ZC-2 (14m/06W)
14W/06W
14W/06m
14m/06W
14m/06m
4.91b*
3.50b
4.84b
5.28b
3.93b
1.00a
5.05b,c
2.67b
5.55c
6.02c
3.22b
0.66a
Pi-P
IP5-P
-1
µg P mg seed
0.15c
0b
0.74a,b
0.27a,b
0.13c
0b
0.09c
0b
0.41b,c
0.16b
1.04a
0.95a
0.10c
0c
0.71b
0.56b
0.15c
0c
0.15c
0c
0.49b
0.39b
1.02a
1.70a
IP4-P
0c
1.15b
0c
0c
0.98b
1.96a
0b
1.51a
0b
0b
1.22a
1.50a
*Means were calculated using LSMeans in SAS based on each genotype including lines and replicates, if applicable. Means with the same letter
are not statistically different using the MIXED procedure with a Bonferroni Adjustment. PA-P, Pi-P, IP5-P, and IP4-P are abbreviations for phytic
acid-P, inorganic phosphate-P, I(1,3,4,5,6)P5-P and I(1,4,5,6)P4-P/I(3,4,5,6)P4-P, respectively.
Page 33 of 35
The Plant Genome Accepted paper, posted 12/04/2014. doi:10.3835/plantgenome2014.10.0077
A.
L1
L2
R3 R2
L3
339K
B.
+
IPK1 gene (Glyma06g03310.9)
R1
R2 R3
340K
R1
341K
342K
Page 34 of 35
The Plant Genome Accepted paper, posted 12/04/2014. doi:10.3835/plantgenome2014.10.0077
100%
90%
IP4-P
80%
70%
60%
IP4-P
IP5-P
50%
IP5-P
PA-P
40%
Pi-P
30%
PA-P
20%
Pi-P
10%
0%
14W/06W
14m/06W
14m/06m
lpa1a2a
lpa1b2b
lpa1a2b
Page 35 of 35
A
B
C
D
E
The Plant Genome Accepted paper, posted 12/04/2014. doi:10.3835/plantgenome2014.10.0077