Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Journal of General Virology (1994), 75, 3041-3046. Printed in Great Britain 3041 Internal ribosome entry in the coding region of murine hepatitis virus mRNA 5 Volker Thiel* and Stuart G. Siddell Institute o f Virology, University o f Wiirzburg, Versbacher Strasse 7, 97078 Wiirzburg, Germany The unique region of murine hepatitis virus (MHV) mRNA 5 has two open reading frames, ORF 5a and ORF 5b, that encode small proteins of unknown function. In the experiments described here, we have used the in vitro translation of synthetic mRNAs to examine the expression of these ORFs. Our results show that a synthetic mRNA containing both ORFs is functionally bicistronic. More importantly, the expres- Introduction Mouse hepatitis virus (MHV), a member of the Coronaviridae, has a positive-strand RNA genome of about 31300 nucleotides (Pachuk et al., 1989; Lee et al., 1991 ; Bonilla et al., 1994). In the infected cell, the expression of viral proteins is mediated by the genomic-length RNA, also known as mRNA 1, together with seven subgenomic mRNAs. These mRNAs form a Y-co-terminal nested set and they contain a common leader sequence of about 70 nucleotides at their 5' end (Lai et al., 1983). Only the 5' unique region of each mRNA, i.e. the region that is absent from the next smallest mRNA, is translationally active (Leibowitz et al., 1982; Siddell, 1983). Most MHV mRNAs contain only a single open reading frame (ORF) in their 5' unique region. These mRNAs appear to be functionally monocistronic. However, mRNA 1 and the subgenomic mRNA 5 are exceptions (Skinner et al., 1984; Budzilowicz & Weiss, 1987; Pachuk et al., 1989). The unique region of MHV mRNA 1 contains two large ORFs that constitute the coronavirus RNA polymerase locus. Expression of viral proteins from this locus involves both ribosomal frameshifting and autoproteolytic processing (Baker et al., 1989; Bredenbeek et al., 1990; Denison et al., 1991, 1992). MHV mRNA 5 also contains two ORFs in its unique region, designated ORF 5a and ORF 5b. In vitro translation studies suggest that this mRNA is functionally bicistronic and the ORF 5b gene product has been detected in MHV (strain A59)-infected cells Leibowitz et al., 1988). On the basis of sequence 0001-2691 © 1994SGM sion of ORF 5b, but not ORF 5a, is maintained in a tricistronic mRNA containing an additional Y-proximal ORF. Thus, in the context of the MHV mRNA 5 unique region, the initiation of protein synthesis on ORF 5b can occur independently of ribosomes that enter from the 5' end of the mRNA. We conclude that the translation of ORF 5b is mediated by the internal entry of ribosomes. similarities, it is likely that the MHV ORF 5b gene product is equivalent to the small membrane (sM) proteins of infectious bronchitis virus (IBV) and transmissible gastroenteritis virus particles (Liu & Inglis, 1991; Godet et al., 1992). Two mechanisms can be proposed for the translation of the MHV ORF 5b. The leaky scanning model, as proposed by Kozak (1989), is one possibility. In this case, the initiation of ORF 5b translation would be mediated by ribosomes that fail to recognize the ORF 5a initiation codon and scan to the next available AUG triplet, which is the ORF 5b initiation codon. An alternative model is a cap-independent mechanism involving ribosome entry at an internal position on the MHV mRNA 5. An analogous mechanism has been described for a variety of picornavirus RNAs and hepatitis C virus RNA (Jackson et aI., 1990; Brown et al., 1992). If this model is correct, the initiation of MHV ORF 5b translation should occur independently of ribosomes that bind to the 5' cap structure of the mRNA. In the experiments reported here, we have analysed the in vitro translation of synthetic mRNAs that contain the unique region of MHV mRNA 5 (minus the leader RNA and some 5' non-translated sequences) preceded by an ORF derived from the fl-galactosidase gene of Escherichia coli. The results show that the fl-galactosidase ORF is an effective barrier to the movement of ribosomes from the 5' end of the mRNA but, nevertheless, ORF 5b is efficiently translated. Our conclusion is that translation ofORF 5b is mediated by the internal entry of ribosomes. Downloaded from www.microbiologyresearch.org by IP: 88.99.165.207 On: Sat, 17 Jun 2017 05:05:46 3042 V. T h i e l a n d S. G. S i d d e l l p5ab/BstElI p5ab/BamHI 5a (107) 5a (107) 5b (88) T70RF5a ORF5b BamHI BstEIl T70RF5b p5b/BamHl 5b (88) BamHI pZ5ab/BamHI Z (376) T7 ORFZ ORF5a ORFSb 5a (107) - - ~ 5b (88) BamHI T7 pZ/BamHI ORFZ Z (376) BamHI ORF5b ~ p5bN/HindIII 5bTM(337) T7 p5abN/HindIII 5a ( 1 0 7 ) + - - - ' ~ J ~ ~ 5bTM( 3 3 7 ) I II pZ5abN/HindIII Z (376) 5a (107) 5bTM(337) p5bl°/BamHI 5b I° (99) HCVN T7 ORF5b t° p5abl°lBamHI 5a (107) 5bj° (99) pZ5abl°/BamHI Z (376) 5a (107) 5b I° (99) C,C]'YAGCAAGAATGCTT(ATG) 7ACATTA~.~CrA~'TCC t BamHI Fig. 1. Structure of the transcription plasmids. The plasmids used in this study are illustrated. The position of the T7 promoter is shown (D) and ORFs are indicated as boxes; ORF Z, (IS]); ORF 5a, (D); ORF 5b, (m); HCV-N, ([]). The positions of relevant restriction enzyme recognition sites are shown, and the size, in amino acids, of potential translation products encoded in mRNAs derived from the plasmids are given in parentheses. The broken line represents sequences upstream of ORF 5b in the plasmids p5b N, p5ab N, pZ5ab ~, p5b TM, p5ab TM and pZ5ab TM. Methods Construction of recombinant plasmids and in vitro RNA synthesis. To construct recombinant plasmids corresponding to the unique region of MHV mRNA 5, the cDNA insert of pJMS 1010 (Ebner et al., 1988) was isolated by excision with PstI, digested with Ddel and, after treatment with T4 DNA polymerase, a 630 bp fragment was cloned into Smallinearized pGEM1. In the resulting construct, p5ab, the initiation codon of ORF 5a lies 37 bp downstream of the cloning site. For the construction of a plasmid corresponding to ORF 5b alone, pJMS1010 DNA was digested with PstI and the isolated cDNA insert was further digested with TaqI and RsaI. The fragment containing the coding region of ORF 5b was treated with T4 DNA polymerase and cloned into SmaI-linearized pGEM1 to produce the construct p5b. In order to place an ORF upstream of ORF 5a, PCR was carried out with oligonucleotides OLV 25 (5' CACAGGAGCTCACCAATGGCCATGATTACGAATT 3') OLV 26 (5' GGGATCCGAGCTCTTAGTTAGTTAATCCTGCACCATCGTCTG 3') and SmaI-linearized pROS DNA (Ellinger et al., 1989). The PCR product contains a SacI restriction site upstream of the Kozak consensus sequence ACCATGG, which is in frame with a fragment of the fl-galactosidase gene from nucleotides 6 to 1125, a stop codon that terminates this ORF and a second SacI restriction site. After digestion with SacI this fragment was cloned into Sacl-linearized pGEM 1 and p5ab. The resulting constructs were designated pZ and pZ5ab, respectively. To enlarge ORF 5b, a cDNA fragment of pHCV-N (J. Ziebuhr, unpublished results), which contains the N gene of the human coronavirus (HCV) strain 229E, was cloned into the ORF 5b coding region. The 718 bp EcoRl fragment of pHCV-N was treated with the Klenow fragment of DNA polymerase I and ligated to BamHI linkers. The BamHI restriction sites ofp5b, p5ab and pZ5ab were eliminated by linearization, treatment with the Klenow fragment and religation. The plasmids were then linearized with BstEII, treated with Klenow fragment and alkaline phosphatase and ligated to BamHI linkers. The plasmids and the cDNA fragment were then digested with BamHI and ligated together to produce the constructs p5b N, p5ab N and pZ5ab N. The enlarged ORF 5b, designated ORF 5b z~, contains 27 codons from the 5' end of ORF 5b, 241 codons from the HCV N protein gene, 63 codons from the 3' end of the ORF 5b and a total of six artefactual codons. To increase the methionine content of the ORF 5b product, eight A U G codons were inserted into the ORF 5b coding region. First, in vivo recombination-PCR mutagenesis (Yao et al., 1992) was used to generate a Bpu 1102I restrition site 10 nucleotides upstream of the ORF 5b termination codon in p5b, p5ab and pZ5ab. Oligonucleotides OLV 9 (5' CAGCAATAAACCAGCCAGAAG 3'), OLV 10 (5' CGGCTGGCTGGTTTATTGCTG 3'), OLV 28 (5' TATAGGCTTAGCATTATGAGTAGTACCACTCAGGGA 3') and OLV 29 (5' ATAATGCTAAGCTTATATTATCATCCACCTCTAACG 3') were used for this purpose. The constructs p5b TM, p5ab 1° and pZ5ab I° were then generated by exchanging the Bpul 1021-BamHI fragment of the derived plasmids with a synthetic double-stranded DNA fragment comprised of the annealed oligonucleotides OLV 30 (5' TTAGCAAGAATGCTT(ATG)TACATTATGACTAGTGGG 3') and OLV 31 (5' GATCCCCACTAGTCATAAAGT(CAT)vAAGCATTCTTGC 3'). The nucleotide sequences of all the plasmids described above were confirmed by dideoxynucleotide chain-termination sequencing. Fig. 1 summarizes the structure of these plasmids and indicates the size of potential translation products encoded in mRNAs derived from them. For in vitro transcription, plasmid DNAs were linearized with restriction enzymes as shown in Fig. 1 and RNA was synthesized with T7 RNA polymerase in the presence of the synthetic cap structure m7G(5')ppp(5')G (Pharmacia) as described previously (Contreras et al., 1982; Melton et al., 1984). Preparation of L cell ribosomal wash factors. L929S cells (1 x 109; European Collection of Animal Cell Cultures) were used to prepare ribosomal wash factors as described by Schreier & Staehelin (1973). The crude initiation factors (IF) fraction, adjusted to 300 A260/ml, was used without further purification. Preparation of an L cell lysate and in vitro translation. The L cell lysate was prepared from L929S cells as previously described (Siddell, 1983). Prior to translation, the lysate was treated with micrococcal nuclease. A 340 lal incubation mixture containing 20 mM-Hepes pH 7.0, 85 mM-KCI, 1.2 mM-MgClz, 2 mM-dithiothreitol, 1 mM-ATP, 0.2 mMGTP, 50 mM-spermine, 250 mM-spermidine, 12 mM-creatine phosphate, 0.1 mg creatine kinase, 0.2 mM of each amino acid except methionine, 1 mM-CaCI~, 5.5 units of micrococcal nuclease (11000 units/mg), 20 ~tl of L cell ribosomal wash factors and 200 p.1 of the L cell lysate was incubated at 20 °C for 10 min. After adding EGTA pH 7.0 to a final concentration of 2 mM, the mixture was incubated on ice for 5 min. Translation reactions consisted of 20 111of the nuclease-treated L cell lysate supplemented with 3 gl of [35S]methionine (15 mCi/ml), 1 gl calf liver tRNA (10mg/ml) and either 1 gl of water, 1 gl of water Downloaded from www.microbiologyresearch.org by IP: 88.99.165.207 On: Sat, 17 Jun 2017 05:05:46 M H V m R N A 5 translation f (a) ,o, .,,¢# + # J (c) (b) 200K97K69K .......... 46K Z : , ! ~i~i~~i~~ 30K ~ 3043 v. . . . . . . . . . . . -Z • 5bN -X ,,o i 21.5K14K~ 12.5K 6.5K m i • - - - - " _ 3a ~ i~ ~'*° _ _ . . ...... D -5a ! __ ~_ "-5a Z5b 10 Mll 2 3 4 5 6 7 M2 MI l 2 3 4 5 6 7 M2 M1 1 2 3 4 5 6 7 M2 Fig. 2. In vitro translation of mRNAs derived from transcription plasmids. The translation products of cell-free protein synthesis were electrophoresed in 17 % SDS polyacrylamide gels and detected by autoradiography. The Mr markers (Amersham) were; aprotinin, 6.5K; cytochrome C, 12.5K; lysozyme, 14-3K; trypsin inhibitor, 21.5K; carbonic anhydrase, 30K; ovalbumin, 46K; BSA, 69K; phosphorylase b, 97.4K and myosin, 200K. These are contained in lanes M 1 (low Mr markers) and lanes M2 (high Mr markers). Lanes 2 contain poly(A)-RNA from MHV-infected cells. Other lanes contain the synthetic mRNAs indicated• containing 2.5 pmol (0.4 to 1.8 ~g) of synthetic mRNA or 1 gl of water containing 0-5 gg of polyadenylated RNA from MHV-infected cells. Incubations were carried out at 34 °C for 2 h and 15 lal aliquots of the translation reaction were electrophoresed on discontinuous, 17% SDS-polyacrylamide gels as described by Laemmli (1970). The radioactivityincorporated into the translation products was determined using a PhosphorImager (model 400E; Molecular Dynamics). Cytoplasmic, poly(A) RNA from MHV-infected cells was prepared as previously described (Siddell, 1983). Results Identification o f M H V m R N A 5 translation products In order to identify the translation products of the M H V O R F s 5a and 5b, m R N A s were synthesized from BstEIIlinearized p5ab ( m R N A 5a) and BamHI-linearized p5b ( m R N A 5b). In vitro translation of m R N A 5a directed the synthesis of a polypeptide with an apparent M r of 12000 (Fig. 2a, b and c, lane 3). The predicted Mr of the O R F 5a product (107 amino acids) is 12 500. The in vitro translation of m R N A 5b directed the synthesis of a polypeptide with an apparent M r of 14000 (Fig. 2a, lane 4). The predicted M r of the O R F 5b product (88 amino acids) is 10200. The discrepancy between the expected and observed electrophoretic mobility of the O R F 5b product was surprising. We therefore performed two further experiments to confirm it's identity. The in vitro translation of m R N A derived from BamHI-linearized p5b TM ( m R N A 5b TM) directed the synthesis of a polypeptide with an apparent M r of 11000 (Fig. 2 b, lane 4). The predicted M r of the O R F 5b 1° product (99 amino acids) is 11 500. Thus, despite the incorporation of 11 additional amino acids in the O R F 5b translation product, its electrophoretic mobility had increased. In the translation products directed by m R N A 5b 1°, we also observed a protein of 33 000 apparent M r (indicated as X in Fig. 2b, lane 4). We assume that this is an aggregated form of the O R F 5b a° product. Secondly, the identity of the O R F 5b product was also confirmed by the translation of m R N A derived from the HindIII-linearized plasmid p5b N. The in vitro translation of m R N A 5b z~ (Fig. 2 c, lane 4) directed the synthesis of a polypeptide with an apparent Mr of 36000. The predicted M r of the O R F 5b N product (337 amino acids) is 37200. In vitro translation of the bicistronic m R N A 5ab The in vitro translation of m R N A derived from BamHIlinearized p5ab ( m R N A 5ab) directed the synthesis of both the O R F 5a and O R F 5b products (Fig. 2a, lane 5). This result is consistent with the idea that the M H V m R N A 5 is functionally bicistronic (Skinner et al., 1984; Budzilowicz & Weiss, 1987; Leibowitz et al., 1988). In the experiment shown, the ratio of O R F 5a to O R F 5b products translated from m R N A 5ab was about 8:1, showing that, at least in this system, O R F 5a is more efficiently translated than O R F 5b. To strengthen the conclusion that the m R N A 5ab is functionally bicistronic we carried out two further experiments. Firstly, we translated m R N A derived from BamHI-linearized p5ab TM ( m R N A 5abl°). In this case, the detection of the O R F 5b 1° product shouid be Downloaded from www.microbiologyresearch.org by IP: 88.99.165.207 On: Sat, 17 Jun 2017 05:05:46 3044 V. Thiel and S. G. Siddell enhanced by the incorporation of additional radioactivity and, indeed, this result can be clearly seen in Fig. 2(b), lane 5. Secondly, we translated mRNA derived from HindIII-linearized p5ab N, (mRNA 5abN). In this experiment, the ORF 5b ~ product with an apparent M r of 36000 was also clearly detected (Fig. 2c, lane 5). In vitro translation o f O R F 5b but not O R F 5a f r o m a tricistronic m R N A containing an additional upstream ORF To test whether ORF 5b can be expressed independently of ribosomes that enter from the 5' end of the mRNA, we translated mRNA derived from BamHI-linearized pZ5ab (the tricistronic mRNA Z5ab). The result is shown in Fig. 2 (a), lane 6. As expected the upstream ORF Z was expressed, resulting in the synthesis of a polypeptide with an apparent Mr of 51000. The predicted M,. of the ORF Z product (376 amino acids) is 41 500. Importantly, no ORF 5a product was detected in the translation reaction. This indicates that very few, if any, ribosomes scan through the upstream ORF Z and initiate the synthesis of an ORF 5a polypeptide. In contrast, the ORF 5b product was readily detected. The amount of ORF 5b product synthesized from the tricistronic mRNA Z5ab was similar to the amount of ORF 5b product expressed from an equimolar concentration of the bicistronic mRNA 5ab (compare Fig. 2a lanes 5 and 6). To rule out the possibility that a polypeptide of 14000 apparent Mr can be synthesized by the aberrant translation of ORF Z (for example, premature termination or internal initiation), we translated mRNA derived from BamHI-linearized pZ (mRNA Z). As expected this mRNA directed the synthesis of the ORF Z gene product and no polypeptide with an apparent M r of 14000 was detected (Fig. 2a, b and c, lane 7). To strengthen the conclusion that ORF 5b, but not ORF 5a, is translated from a tricistronic mRNA containing an additional upstream ORF, we carried out two further experiments. Firstly, we translated mRNA derived from BamHI-linearized pZ5ab TM (mRNA Z5abl°). The result is shown in Fig. 2(b), lane 6. In this translation reaction, the ORF Z product and the ORF 5b TM product were easily identified. Again, using equimolar concentrations of mRNA, approximately equal amounts of ORF 5b TM products were expressed from the bicistronic and tricistronic mRNAs, mRNA 5ab TM and mRNA Z5ab TM (compare Fig. 2b lanes 5 and 6). The ORF 5a product was not expressed from the tricistronic mRNA Z5ab 1°. Secondly, we translated mRNA derived from HindIII-linearized pZ5ab ~ (mRNA Z5ab-~). The result is shown in Fig. 2(c), lane 6. Again, the ORF Z product and the ORF 5b ~ product were easily identified but a translation product for ORF 5a was not detected. Discussion The results presented in this paper lead us to the conclusion that, in the context of the MHV mRNA 5 unique region, the initiation of protein synthesis on ORF 5b can occur independently of ribosomes that enter from the 5' end of the mRNA. This has been shown by the translation of the tricistronic mRNAs, Z5ab, Z5ab 1° and Z5ab N, where the 5'-proximal and 5'-distal ORFs, ORF Z and ORF 5b/bl°/b N, are translated, whilst the internal ORF, ORF 5a, is translationally inactive. Clearly, the upstream ORF Z, provides an effective barrier to scanning ribosomes but does not prevent the initiation of ORF 5b translation. Our conclusions are based upon the translation of synthetic mRNAs in vitro. As always, it can be argued that the results are due to peculiarities of the in vitro system or, for example, the degradation of mRNA during the translation reaction. However, we have taken care to use a translation system derived from a murine cell line and, at least in the case of the tricistronic mRNAs Z5ab, Z5ab TM and Z5ab N, the mRNA degradation interpretation would require a ribonuclease activity that specifically renders the ORF 5b initiation codon accessible to scanning ribosomes. Furthermore, our results are not the first evidence for the internal entry of ribosomes on a coronavirus mRNA. Liu & Inglis (1992), using an approach very similar to that described here, have concluded that the tricistronic mRNA 3 of IBV encodes three proteins, 3a, 3b and 3c, and that the translation of the most distal ORF 3c is mediated by a cap-independent mechanism involving internal initiation. Taken together, these data strongly suggest that the translation of the coronavirus sM proteins, i.e. the ORF 3c product of IBV and the ORF 5b product of MHV (Cavanagh et al., 1994), involves the internal entry of ribosomes on a polycistronic mRNA. Clearly, in vivo studies using reporter gene constructs and the naturally occurring mRNAs will be required to strengthen this conclusion. The initiation of protein synthesis by internal ribosome entry has been most extensively studied by picornavirus RNAs (for a recent review see Meerovitch & Sonenberg, 1993). In this case, ribosome entry is mediated by a region in the 5' untranslated region of the genomic RNA, the so-called 'internal ribosome entry site' (IRES) or 'ribosome landing pad' (RLP). The function of the IRES/RLP is dependent upon conserved primary sequence, for example a polypyrimidine tract (Pestova et al., 1991), as well as base-pairing interactions that give rise to extensive RNA structures able to bind transacting factors and, directly or indirectly, components of the translational machinery (Jang & Wimmer, 1990; Meerovitch et al., 1993). Downloaded from www.microbiologyresearch.org by IP: 88.99.165.207 On: Sat, 17 Jun 2017 05:05:46 M H V m R N A 5 translation Recently, Le et al. (1992, 1993) have proposed a general model of conserved tertiary structural elements in picornavirus IRES/RLPs. This model includes RNA stem-loops that can be modelled into compact superstructures involving pseudoknots together with possible base-pairing interactions between the picornavirus IRES/ RLP and 18S rRNA. Most interestingly, they have recognized similar structural elements in the unique region of the IBV mRNA 3 (Le et al., 1994) and suggest that these features may be the hallmark of elements that mediate the internal initiation of cap-independent translation. An obvious question is whether or not the same features can be identified in the unique regions of the MHV mRNA 5. This question can be approached theoretically with software capable of predicting tertiary RNA structures and experimentally using chemical and enzymatic probing in combination with covariant nucleotide mutation analysis. We are currently using both approaches. Furthermore, it will be of interest to examine interactions between the putative MHV mRNA 5 IRES/RLP element and cellular proteins. The in vitro translation system we have used is prepared from a murine cell line and it may be possible to search for proteins that specifically interact with the MHV mRNA 5 unique region directly in this system. In the long term, we are interested in the biological relevance of internal ribosome entry on the MHV mRNA 5. The MHV ORF 5b product is believed to be an essential structural protein of the virus, but its functional role(s) in the replication cycle is still unknown. Why, in contrast to all other MHV subgenomic mRNAs, does the unique region o f m R N A 5 encode two proteins? And why is the initiation of ORF 5b translation mediated by a complex mechanism such as internal ribosome entry? Also, if the putative IRES/RLP element of mRNA 5 encompasses ORF 5a, it is difficult to envisage translation of both proteins from the same mRNA, at least at the same time. If there are two forms of the MHV mRNA 5 in the infected cell, then how are they distinguished? The answers to these and other questions must await further experiments. 3045 expression of the second open reading frame of the polymerase gene of the coronavirus MHV-A59; a highly conserved polymerase is expressed by an efficient ribosomal frameshifting mechanism. Nucleic Acids Research 18, 1825-1832. BROWN, E. A., ZHANG, H., PING, L. & LEMON, S. M. (1992). Secondary structure of the 5' nontranslated regions of hepatitis C virus and pestivirus genomic RNAs. Nucleic Acids Research 20, 5041 5045. BUDZILOWICZ, C. J. & WEISS, S. R. (1987). In vitro synthesis of two polypeptides from a nonstructural gene of coronavirus mouse hepatitis virus strain A59. Virology 157, 509 515. CAVANAGH, D.0 BRIAN, D. A., BR1NTON, M., ENJUANES, L., HOLMES, K. V., HORZINEK, M.C., LAI, M. M. C., LAUDE, H., PLAGEMANN, P. G., SIDDELL, S., SPAAN, W. J. M., TAGUCHI, F. & TALBOT, P. J. (1994). Revision of the taxonomy of the Coronavirus, Torovirus and Arterivirus genera. Archives of Virology 135, 227-236. CONTRERAS, R., CHEROUTRE, H., DEGRAVE, W. & FIERS, W. (1982). Simple efficient in vitro synthesis of capped RNA useful for direct expression of cloned DNA. Nucleic Acids Research 10, 6353 6362. DENISON, M. R., ZOLTICK, P. W., LEIBOWlTZ, J. L., PACHUK, C. J. & WEISS, J. R. (1991). Identification of polypeptides encoded in open reading frame lb of the putative polymerase gene of murine coronavirus mouse hepatitis virus A59. Journal of Virology 65, 3076-3082. DENISON, M.R., ZOLTICK, P.W., HUGHES, S.A., GIANGRECO, B., OLSON, A. L., PERLMAN, S., LEIBOWITZ,J. L. & WEISS, S. R. (1992). lntracellular processing of the N-terminal ORF la proteins of the coronavirus MHV A59 requires multiple proteotytic events. Virology 189, 274-284. EBNER, D., RAABE, T. & SIDDELL, S. G. (1988). Identification of the coronavirus MHV-JHM mRNA 4 product. Journal of General Virology 69, 1041-1050. ELrlNGER, S., GLOCKSHUBER, R., JAHN, G. & PL/2CKTHtrS, A. (1989). Cleavage of procaryotically expressed human immunodeficiency virus fusion proteins by factor Xa and application in Western blot (immunoblot) assays. Journal of Clinical Microbiology 27, 971 976. GODET, M., L'HARIDON, R., VAUTHEROT, J. F. & LAUDE, H. (I992). TGEV corona virus ORF4 encodes a membrane protein that is incorporated into virions. Virology 188, 666-675. JACKSON, R.J., HOWELL, M.T. & KAMINSKY, A. (1990). The novel mechanism of initiation of picornavirus RNA translation. Trends in Biochemical Science 15, 477-483. JANG, S.K. & WIMMER, E. (1990). Cap-independent translation of encephalomyocarditis virus RNA: structural elements of the internal ribosomal entry site and involvement of a cellular 57-kD RNAbinding protein. Genes and Development 4, 1560-1572. KOZAK, M. (1989). The scanning model for translation: an update. Journal of Cell Biology 108, 229-241. LAEMMLI, U.K. (1970). Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature, London 227, 68(~685. LAE, M. M. C., PATTON, C. D., BARIC, R. S. & STOHLMAN,S. A. (1983). Presence of leader sequences in the mRNA of mouse hepatitis virus. Journal of Virology 46, 1027-1033. LE, S.-Y., CHEN, J.-H., SONENBERG, N. & MAIZEL, J. V., JR (1992). Conserved tertiary structure elements in the 5' untranslated region of human enteroviruses and rhinoviruses. Virology 191, 858 866. LE, S.-Y., CHEN, J.-H., SONENBERG, N. & MAIZEL, J. V., JR (1993). This work was supported by the Deutsche Forschungsgemeinschaft Conserved tertiary structural elements in the 5' nontranslated region (SFB 165/B1). of cardiovirus, apthovirus and hepatitis A virus RNAs. Nucleic Acids Research 21, 24455451. LE, S.-Y., SONENBERG,N. & MAIZEL,J. V., JR (1994). Distinct structural elements and internal entry of ribosomes in mRNA 3 encoded by References infectious bronchitis virus. Virology 198, 405-411. BAKER,S. C., SHIEH,C. K., SOL, L. H., CHANG,M. F., VANNIER,D. M. LEE, H. J., SHIEH, C. K., GORBALENYA,A. E., KOONIN, E. V., LA, M. & LAt, M. M. C. (1989). Identification of a domain required for N., TULER, J., BAGDZHADZHYAN,A. & LAI, M. M. C. (1991). The autoproteolytic cleavage of murine coronavirus gene A polyprotein. complete sequence (22 kilobases) of murine coronavirus gene 1 Journal of Virology 63, 3693-3699. encoding the putative proteases and RNA polymerase. Virology 180, BONILLA, P.J., GORBALENYA, A.E. & WEISS, S.R. (1994). Mouse 567 582. hepatitis virus strain A59 polymerase gene ORF la: heterogeneity LEIBOWITZ, J. L., WEISS, S. R., PAAVOLA, E. & BOND, C.W. (1982). among MHV strains. Virology 198, 736-740. Cell-free translation of murine coronavirus RNA. Journal of Virology BREDENBEEK,P. J., PACHUK, C. J., NOTEN, A. F., CHARITE,J., LUYTJES, 43, 905 913. W., WEISS, S. R. & SPAAN, W. J. (1990). The primary structure and LEIBOWITZ, J.L., PERLMAN, S., WEINSTOCK, G., DEVRIES, J.R., Downloaded from www.microbiologyresearch.org by IP: 88.99.165.207 On: Sat, 17 Jun 2017 05:05:46 3046 V. Thiel and S. G. Siddell BUDZILOWICZ, C., WEISSEMANN, J.M. & WEISS, S.R. (1988). Detection of a murine coronavirus nonstructural protein encoded in a downstream open reading frame. Virology 164, 156-164. LIU, D.X. & INGLIS, S.C. (1991). Association of the infectious bronchitis virus 3c protein with the virion envelope. Virology 185, 911 917. LIu, D. X. & INGLIS, S. C. (1992). Internal entry of ribosomes on a tricistronic mRNA encoded by infectious bronchitis virus. Journal of Virology 66, 6143 6154. MEEROVITCH, K. 8¢ SONENBERG, N. (1993). Internal initiation of picornavirus RNA translation. Seminars in Virology 4, 217 227. MEEROVITCH, K., SVITKIN, Y. V., LEE, H. S., LEJBKOWICZ,F., KENAN, D. J., CHAN, E. K. L., AGOL, V. I., KEENE, J. D. & SONENBERG, N. (1993). La autoantigen enhances and corrects aberrant translation of poliovirus RNA in reticulocyte lysate. Journal of Virology 67, 3798-3807. MELTON, D. A., KRIEG, P. A., RABAGHIATI,M. R., MANIATIS,T., ZINN, K. & GREEN, M. D. (1984). Efficient in vitro synthesis of biologically active RNA and RNA hybridisation probes from plasmids containing a bacteriophage SP6 promoter. Nucleic Acids Research 12, 7035 7056. PACHUK, C. J., BREDENBEEK,P. J., ZOLTIK,P. W., SPAAN,W. J. M. & WEISS, S.R. (1989). Molecular cloning of the gene encoding the putative polymerase of mouse hepatitis coronavirus A59. Virology 171, 141-148. PESTOVA, T. V., HELLEN, C. U. T. & WIMMER, E. (1991). Translation of poliovirus RNA: role of an essential cis-acting oligopyrimidine element within the 5' nontranslated region and involvement of a cellular 57-kilodalton protein. Journal of Virology 65, 6194-6204. SCHREIER, M. H. • STAEHELIN, T. (1973). Initiation of mammalian protein synthesis: the importance of ribosome and initiation factor quality for the efficiency of in vitro systems. Journal of Molecular Biology 73, 329-349. SIDDELL,S. (1983). Coronavirus JHM : coding assignments of subgenomic mRNAs. Journal of General Virology 64, 113-125. SKINNER, M.A., EBNER, D. & SIDDELL, S.G. (1985). Coronavirus MHV-JHM mRNA 5 has a sequence arrangement which potentially allows translation of a second, downstream open reading frame. Journal of General Virology 66, 581-592. YAO, Z., JONES, D. H. & GROSE, C. (1992). Site-directed mutagenesis of herpesvirus glycoprotein phosphorylation sites by recombination polymerase chain reaction. PCR Methods and Applications 1, 205-207. (Received 2 June 1994; Accepted 1 August 1994) Downloaded from www.microbiologyresearch.org by IP: 88.99.165.207 On: Sat, 17 Jun 2017 05:05:46