Download Transcriptional Attenuation

16
i5: 2494-2498.
hermodynamic analysis of RNA tr
.
anscnpt
,Ii. Biochemistry 30: 1097-1118.
mediated by lambdoid phage Q proteins"
I
York.
.
mtiterminator proteins of Escherich'
za coli
'olymerase at a p-dependent terminator
.-5305.
and
;. 1989. Specificity and mechanism of
ges A and 82.1. Mol. Bioi. 210: 453-460.
. Roberts. 1987. Transcription antitermina_
~gment spanning the RNA start site. Genes
Transcriptional Attenuation
Robert Landick
Department of Biology
Washington University
51. Louis, Missouri 63130
Charles L. Turnbough, Jr .
Department of Microbiology
University of Alabama at Birmingham
Birmingham, Alabama 35294
sequence signalling transcription termina_
. A cad. Sci. 84: 6417-6421.
OVERVIEW
Transcriptional attenuation is a mechanism for gene regulation in which
transcriptional termination at a specific site within an operon, called an
attenuator, is controlled by a particular metabolic signal. In bacteria,
there are many examples of attenuation that differ in the way that
termination is made conditional. We have divided them into four classes
based on their common features. A single, well-studied example of each
class is described in detail, and other examples are mentioned to illustrate
unique points. Possible cases of attenuation in eukaryotes are described.
We also discuss the potential advantages and possible evolution of attenuation, as well as future prospects for studies in this field.
INTRODUCTION
In bacteria, transcriptional regulation can be accomplished by altering either initiation or termination of transcription. The control of gene e x p r e s - j
sion by changes in the extent of termination at a site preceding one or
more structural genes of an operon is called transcriptional attenuation.
The interesting history of how attenuation was discovered dates to the
original concept of repressors and operators, but is well documented in
recent reviews (Artz and Holzschu 1983; Landick and Yanofsky 1987a)
and, except for a brief account of the discovery of attenuation control of
pyrimidine gene expression, is not recounted here. What has proven most
fascinating about attenuation is that diverse mechanisms have evolved to
control the level of many different genes by coupling transcript elongaTranscriplional Regulalion.
Copyright 1992 Cold Spring Harbor Laboratory Press 0-87969-410-6/92 $3 + 00
407
408
R. Landick and C.L. Turnbough, Jr.
tion to a wide variety of metabolic signals. We aim here to classify these
mechanisms, to describe in detail the best-understood examples frorn
each of these classes, and to offer speculations on what remains to be discovered. The possibility of attenuation in eukaryotes is discussed.
w
th
01
ar
w
Transcriptional Attenuation Involves Regulation of
Specific Termination Signals
Transcriptional attenuation might, in the broadest sense, include any
phenomenon that reduces the extent or rate of transcription. In studies of
bacterial gene regulation, however, it has acquired a more restricted
definition and is used to describe a mechanism in which the level of transcriptional termination at a single, specific site within an operon, called
an attenuator, is regulated in response to a physiologically relevant signal
(Bauer et al. 1983). Thus, transcriptional attenuation can be distinguished
from antitermination, which describes mechanisms that modify the transcription complex and diminish its response to most termination signals
that it encounters after the modification (e.g., f.. N-dependent and Qdependent antitermination; see Greenblatt; Roberts; both this volume).
Occasionally, transcriptional attenuation is confused with translational
attenuation. Translational attenuation regulates the ability of ribosomes
to initiate translation of certain genes, notably the antibiotic resistance
genes cat and ermC in gram-positive bacteria, by changes in RNA folding that affect accessibility of the ribosome-binding site (Weisblum
1983; Lovett 1990). Although alternative RNA folding also is a feature
of many transcriptional attenuation mechanisms, translational attenuation
differs fundamentally and is not addressed here.
d(
a
nj
g(
al
e.
w
(f
ty
f(
e
g
~
Classes of Attenuation Mechanisms
Transcriptional attenuation was discovered about 15 years ago during the
study of Escherichia coli trp and Salmonella typhimurium his operon expression. Within only a few years, the mechanisms of trp and his attenuation were found to be similar in their key features, and analogous mechanisms were found for several other amino acid biosynthetic operons in
enteric bacteria. During the past 10 years, however, numerous examples
of attenuation employing fundamentally different mechanisms for controlling transcriptional termination have been uncovered in a variety of
bacterial operons. Previous reviews have listed many of these (Bauer et
al. 1983; Landick and Yanofsky 1987a). It now seems to us an appropriate time to attempt to classify these mechanisms by their common
features. Four principal classes are evident to us: (1) mechanisms in
Transcriptional Attenuation
lals. We aim here to classify these
~ best-understood examples f
rom
.
ilatlOns
on what remains to be d'IS.
m eukaryotes is discussed.
Julation of
the broadest sense, include any
rate of transcription. In studies of
t has acquired a more restricted
:hanism in which the level of trancific site within an operon, called
o a physiologically relevant signal
al attenuation can be distinguished
mechanisms that modify the tranponse to most termination signals
ion (e.g., A N-dependent and Q_
)latt; Roberts; both this volume).
on is confused with translational
regulates the ability of ribosomes
, notably the antibiotic resistance
)acteria, by changes in RNA foldibosome-binding site (Weisblum
ive RNA folding also is a feature
~hanisms, translational attenuation
sed here.
~red about 15 years ago during the
mella typhimurium his operon exnechanisms of trp and his attenua:ey features, and analogous mechnino acid biosynthetic operons in
ars, however, numerous examples
ly different mechanisms for con'e been uncovered in a variety of
ve listed many of these (Bauer et
7a). It now seems to us an ap:!se mechanisms by their common
vident to us: (1) mechanisms in
409
which the position of a translating ribosome dictates the formation of either an RNA secondary structure that causes transcriptional termination
or an alternative secondary structure that precludes termination (e.g.,
amino acid biosynthetic operons in enteric bacteria), (2) mechanisms in
which the extent of coupling between transcription and translation
determines whether or not a ribosome can directly block the formation of
a termination RNA hairpin (e.g., the E. coli pyrB! operon), (3) mechanisms in which a trans-acting factor binds to the nascent transcript to
govern formation of a terminator structure either directly or through
alternative folding of RNA (regulatory-factor-dependent attenuation;
e.g., the E. coli ~-glucoside utilization operon), and (4) mechanisms in
which p-dependent termination is modulated to control gene expression
(p-dependent attenuation; e.g., the E. coli tryptophanase operon). Other
types of attenuation mechanisms are easily imaginable and may well be
found in other prokaryotic operons or in eukaryotes.
ATTENUATION CONTROL IN THE AMINO ACID BIOSYNTHETIC
OPERONS OF ENTERIC BACTERIA: RIBOSOME POSITIONING
CONTROLS FORMATION OF ALTERNATIVE
RNA SECON9ARY STRUCTURES THAT
GOVERN TRANSCRIPTIONAL TERMINATION
Very similar attenuation control mechanisms have been described for the
trp, his, leu, thr, ilvGMEDA, ilvBN, and pheST operons from various enteric bacteria. All these operons except pheST encode amino acid
biosynthetic enzymes; pheST encodes phenylalanyl-tRNA synthetase. In
each case, a leader region between the promoter(s) and first structural
gene contains a p-independent transcriptional terminator, the attenuator,
which specifies a G+C-rich RNA hairpin immediately preceding a long
(typically 7-9), continuous run of uri dine residues. Both the RNA hairpin structure and the run of uridines are required for termination (Yager
and von Hippel 1987). Each leader transcript can form two mutually exclusive secondary structures. One of these structures includes the
attenuator-encoded RNA hairpin required for termination (termination
conformation; Fig. 1). The other secondary structure precludes formation
of the terminator hairpin, thereby allowing transcription to continue
beyond the attenuator and into the structural genes of the operons (readthrough conformation; Fig. 1). The relative proportion of these two
leader RNA conformations, and hence the degree of transcriptional attenuation, depends on the position of a ribosome engaged in translation
of a leader peptide coding region. Within the leader peptide coding
region for each of these operons are from 2 (trp) to 15 (ilvGMEDA)
410
R. Landick and C.L. Turnbough, Jr.
2:3
Readthrough
Conformation
materi
operor
tures (
be sub
•••••• • UGA
A Refil
Pause RNA Hairpin
Alternative RNA
Secondary Structures of
the Leader Transcript
The E
versio
regior
Terminator
Hairpin
UG
1:2
3:4
14-re~
Termination
Conformation
Leader Peptide •
Coding Region •
RNA
UUUUUUU
i
(Fig.
tween
transl
achie'
Transcription
DNA
I
Promoter
Transcription
Start
First
r
2
_3_ _4_
Gene
ATG • • • • • • • • • TGA
;:0-
Leader Peptide
Coding Region
Structural
~ ~
Pause Site
/
c=
Attenuator
A
AAGUU
Figure 1 Basic features of an attenuator control region. The example given is for
an amino acid biosynthetic operon that is controlled by attenuation. However,
with occasional modification, the same terms can be used to describe features of
other types of attenuator control regions. Note that the first secondary structure
shown for the termination conformation (pause RNA hairpin) is not present
when a ribosome is stalled on the attenuation control codons.
"control codons" that specify an amino acid end product (or substrate for
pheST) of the enzymes encoded by the operon. When a ribosome stalls at
one of these control codons due to an inadequate supply of the cognate
aminoacyl-tRNA, the leader RNA forms the readthrough conformation.
When the supplies of aminoacyl-tRNAs allow efficient translation, the
ribosome quickly reaches the leader peptide stop codon, where it blocks
formation of the readthrough conformation, allowing the nascent transcript to form the terminator hairpin and prevent transcription beyond the
attenuator. Thus, readthrough occurs when the supply of the controlling
amino acid is low, and termination occurs when the supply is adequate.
The experimental support for this model is overwhelming and has
been reviewed in detail elsewhere, together with complete descriptions of
each example (Kolter and Yanofsky 1982; Artz and Holzschu 1983;
Bauer et a1. 1983; Landick and Yanofsky 1987a). Rather than restate this
B
FigL
Ten
Transcriptional Attenuation
2:3
Readthrough
Conformation
411
material, we present here a refined model for attenuation in the trp
operon, as an archetypical example, and the data that support key features of this model, emphasizing aspects of attenuation that continue to
.
be subjects of active investigation.
JGA
A Refined Model for Attenuation in the
\ Hairpin
Terminator
Hairpin
3:4
Termination
Conformation
uuuuuuu
trp Operon
The E. coli trp operon encodes five polypeptides that catalyze the conversion of chorismate to tryptophan. The 172-nucleotide trp leader
region specifies two alternative RNA secondary structures and encodes a
14-residue leader peptide that includes two adjacent tryptophan residues
(Fig. 2). The attenuation mechanism requires very tight coupling between RNA polymerase synthesizing the leader transcript and a ribosome
translating the leader peptide coding region. This synchronization is
achieved by strong transcriptional pausing at a site immediately after the
ranscription
_2_ _3_ _4_
,.. ..............
Pause Site
,/"
First
Structural
Gene
r-=
A
A AA
Stop 70 G
Attenuator
rol region. The example given is for
ontrolled by attenuation. However
i can be used to describe features of
,te that the first secondary structure
lause RNA hairpin) is not present
control codons.
f
AAGUUCACG
10U
A
A
A
A
~
3:4
A AU
U
G
C
120 CEt
A~C
G
UA
G
G
UU
GEC
G
Trp GEC
CEG130
U
U=A
CEG
20 A
Trp GEC
CEG
U
Met Lys Ala lie Phe Val Leu Lys Gly G EC 90
GE C
CGACAAUGAAAGCAAUUUUCGUACUGAAAGGUU = A
AUCAGAUACCCA= UUUUUUUU
30
cid end product (or substrate for
Jeron. When a ribosome stalls at
ladequate supply of the cognate
; the readthrough conformation.
, allow efficient translation, the
tide stop codon, where it blocks
:ion, allowing the nascent tranprevent transcription beyond the
en the supply of the controlling
; when the supply is adequate.
lodel is overwhelming and has
er with complete descriptions of
)82; Artz and Holzschu 1983;
1987a). Rather than restate this
C
U
G
CEG
Ser CEG
U
C
U=A
Thr CEGM
A=U
CEG
40
50
U=A
110
140
/GEC
GCE ~'00
PAUSE
UAA
B
Figure 2 Alternative secondary structures of the trp leader transcript. (A)
Termination conformation. (B) Readthrough conformation.
412
R. Landick and C.L. Turnbough, Jr.
DNA segment that encodes the 1:2 RNA hairpin (Fig. 2). RNA
polymerase is released from the pause site when the ribosome
approaches on the nascent transcript.
Once RNA polymerase leaves the pause site, the rate at which th
ribosome synthesizes the remainder of the leader peptide and releases the
mRNA, relative to the rate at which polymerase transcribes the at~
tenuator, determines the extent of attenuation. One of five outcomes can
occur (Fig. 3). First, if the ribosome stalls at the tryptophan Control
co dons, the transcript will form the 2:3 RNA structure, precluding forma_
tion of the 3:4 terminator structure and causing readthrough of the attenuator (outcome 1; readthrough, Fig. 3). If the ribosome moves rapidly
to the leader peptide stop codon, three additional outcomes are possible.
The ribosome may release very quickly, allowing 1:2 to reform prior to
synthesis of 3 and cause terminator hairpin formation (outcome 2; not
shown in Fig. 3). The ribosome may release after synthesis of segment 3,
allowing competition between 1:2 and 2:3 formation and readthrough of
the attenuator when the 2:3 RNA hairpin forms (outcome 3; basal level
readthrough, Fig. 3); or the ribosome may not release until after transcription of the attenuator, in which case its presence will preclude 2:3
formation and caw~e formation of the terminator (outcome 4; termination,
Fig. 3). Finally, if'no ribosome initiates translation of the leader peptide
coding region, RNA polymerase eventually will escape the pause site
and synthesize the remainder of the leader RNA in the 1 :2+3:4 termination conformation (outcome 5; superattenuation, Fig. 3).
When intracellular tryptophan is abundant, approximately 90% of the
transcripts terminate at the attenuator, producing the 141-nucleotide
leader transcript (Fig. 2). The 10% readthrough transcription accounts for
basal level trp expression. Under superattenuation conditions, where
leader peptide synthesis is prevented, readthrough at the trp attenuator is
reduced to 2-3%. The increase in basal level readthrough caused by
leader peptide synthesis can be explained by the extent of ribosome
release from the leader peptide stop codon before synthesis of RNA segment 4 (outcome 3; basal level readthrough, Fig. 3). Superattenuation
when translation is inefficient and variation of the rate of ribosome
release may allow attenuation control to respond to physiological
changes other than depletion of the cognate aminoacyl-tRNA for the
leader peptide control codons. Interestingly, the presence or absence of
tryptophan in the growth medium does not affect readthrough of the trp
attenuator in a prototrophic bacterium; tryptophan starvation sufficient to
increase readthrough occurs only when induced by mutations in the
biosynthetic pathway or by addition of inhibitors, or transiently when
bacteria grown in tryptophan-containing media are transferred to mini-
"franscril
pa~ses Aft
RIBOSO~
Rib<
Allo\
2:3 Hairpi
Prevenl
Formatia
of t~
"ferminatl
REJl
Fit
m;
no
m:
at"
cc
te
Transcriptional Attenuation
R~A hairpin (Fig. 2). RNA
~ site when the ribosome
INITIAL STAGES OF TRANSCRIPTION
DNA--~
ap_
lUse site, the rate at which the
~ leader peptide and releases the
polymerase transcribes the atttion. One of five outcomes can
taIls at the tryptophan Control
~A structure, precluding formacausing read through of the at. If the ribosome moves rapidly
Iditional outcomes are Possible.
allowing 1:2 to reform prior to
'Pin formation (outcome 2; not
lse after synthesis of segment 3,
3 formation and readthrough of
I forms (outcome 3; basal level
ay not release until after tran: its presence will preclude 2:3
dnator (outcome 4; termination,
ranslation of the leader peptide
illy will escape the pause site
r RNA in the 1:2+3:4 term inalation, Fig. 3).
iant, approximately 90% of the
producing the 141-nucleotide
ough transcription accounts for
·attenuation conditions, where
Ithrough at the trp attenuator is
level read through caused by
~d by the extent of ribosome
I before synthesis of RNA segugh, Fig. 3). Superattenuation
ttion of the rate of ribosome
to respond to physiological
nate aminoacyl-tRNA for the
ly, the presence or absence of
It affect read through of the trp
)tophan starvation sufficient to
induced by mutations in the
nhibitors, or transiently when
media are transferred to mini-
413
J...
y~
~
LEADER TRANSCRIPT
1:2
Transcription Complex.
Pauses After 1:2 SynthesIs
RNA POLYMERASE
Fails to Bind
TranscriPt)
ibosome Binds
to Transcript
1:2
RIBOSOME
£
0
...
~
C1C
A
~:2
3:4
Ribosome
Ribosome Disrupts
the 1:2 RNA Hairpin
and Releases the
~paused Tra:scriPtion Complex
PPP
SUPERATTENUATION
PP
TRP STARVATION
Ribosome Stalls on Trp C O d o n S ' A
Allowing Formation of 2:3 Hairpin
Ribosome Moves
to Stop Codon
2:3
Ribosome
Releas~~ /
at Stop COd~
1
2:3 Hairpin
Prevents
Formation
of the
Terminator
o
I
..J....:
3
2A
2:3
2:3 Forms;
Terminator (3:4)
~
READTHROUGH
Formation of 2:3
is Blocked;
Terminator Forms
BI,ok,d
BASAL LEVEL
READTHROUGH
.~
"w""""""
1:2 Forms;
Terminator (3:4)
TranscrlPQ
Released
~
TERMINATIO~
Figure 3 Model for attenuation in the trp operon. See text for description.
mal media (Yanofsky et al. 1984; c. Yanofsky, pers. comm.). Thus, the
normal contribution of attenuation control to regulation of the trp operon
may reflect predominantly changes in basal level readthrough and superattenuation rather than ribosome stalling on the tryptophan control
codons as ~onventionally presented. This may be an adaptation of the attenuation mechanism in an operon also regulated by repression. The at-
414
R. Landick and C.L. Turnbough, Jr.
tenuation response to extreme tryptophan starvation may allow r .
.
.
aval'1 a b'l'
I Ity, w h ereas repression Contapld
I
a d aptatIon
to c h ange d nutnent
.
.
d'
.
ro s
operon expression at mterme late concentrations of tryptoph
(Yanofsky et al. 1984). In some operons in which attenuation is the so~n
regulatory mechanism, for instance, ilvGMEDA and thr, changes in at~
tenuator readthrough clearly occur in the normal range of amino acid
concentrations.
The Leader Transcript Forms Alternative RNA
Secondary Structures
Evidence for the role of alternative RNA secondary structures in controlling atterruation is compelling and has been reviewed in detail previously
(Kolter and Yanofsky 1982; Artz and Rolzschu 1983; Bauer et al. 1983'
Landick and Yanofsky 1987a). Distinct, but analogous, structures occu;
in the termination and read through conformations of leader transcripts
from the various amino acid biosynthetic operons that are regulated by
attenuation (see Landick and Yanofsky 1987a). For instance, the
termination conformation of the his leader transcript contains three significant RNA hairpiI!s and the readthrough conformation contains two.
Studies of the his '(Johnston and Roth 1981) and trp (Kolter and
Yanofsky 1984) attenuation control mechanisms confirmed that many
base changes that alter the relative stability predicted for the termination
and readthrough conformations of the leader transcript increase or
decrease attenuation in a manner consistent with the model. Two results
from these studies are particularly important in showing that an alternative RNA secondary structure causes readthrough of the attenuator: (1)
The trpL75 mutation, which changes G75 to A (Fig. 2), destabilizes the
structure 2:3 without affecting 1:2 or 3:4 and prevents increased readthrough of the trp attenuator during tryptophan starvation (Kolter and
Yanofsky 1982 and references therein); and (2) the his09712 and
his09713 mutations, which individually cause increased termination at
the his attenuator because they change, respectively, the 5' and 3' base
of a key C:G base pair in the readthrough conformation of the his leader
transcript, restore wild-type expression when they are recombined to
create an A:U base pair in the structure (R. M. Johnston and J. R. Roth,
pers. comm.).
Three other key findings also strongly support the role of alternative
RNA secondary structures in attenuation: (1) Systematic deletions of
RNA segments 1, 2, and 3 in both the Serratia marcescens (Stroynowski
and Yanofsky 1982) and E. coli (Landick et al. 1990) trp leader transcripts yield alternately increased and decreased readthrough of the at-
ten uator , a
la ted trp h
tures of th
Yanofsky
oligonucle
readthro u !
of the rea(
The ke
well docu
at the attl
stem of t1
al. 1983;
more, usi
Iy by in
mutation
strand, a
present i
and Gan
least six
required
thymidil
terminal
Translal
Not the
The im
from th
Landic
histidir
readtht
Iy, inc
structu
mutati
(hisT)
synthe
tenuat
codon
upon
chang
codin
defec
Transcriptional Attenuation
starvation may all
ow rap'd
1, whereas repression c
I
.
ontrols
)ncentratlOns of try t
· h
P ophan
1 w h IC attenuation is th
,r
e sole
tlEDA and thr change .
,
s In atnormal range of amino .
1
aCId
A
econdary structures in control_
reviewed in detail previously
~schu 1983; Bauer et al. 1983'
ut analogous,
structures occu'r
.
rmatlOns of leader transcripts
operons that are regulated b
( 1987a). For instance, th~
r transcript contains three sig;h conformation contains two.
1981) and trp (Kolter and
lanisn:s confirmed that many
'i predicted for the termination
leader transcript increase or
It with the model. Two results
mt in Showing that an alternalthrough of the attenuator: (1)
to A (Fig. 2), destabilizes the
and prevents increased readtophan starvation (Kolter and
and (2) the his09712 and
:ause increased termination at
;pectively, the 5' and 3' base
conformation of the his leader
vhen they are recombined to
r. M. Johnston and J. R. Roth,
I
support the role of alternative
: (1) Systematic deletions of
atia marcescens (Stroynowski
k et a1. 1990) trp leader tran:reased readthrough of the at-
415
tenuator, as the model predicts; (2) the ribonuclease sensitivities of isolated trp leader RNAs are consistent with the proposed secondary structures of the leader transcript (Fig. 2) (Oxender et a1. 1979; Kuroda and
Yanofsky 1984); and (3) addition to in vitro transcription reactions of an
oligonucleotide complementary to trp RNA segment 1 causes attenuator
readthrough, apparently by shifting the base-pairing equilibrium in favor
of the readthrough conformation (Fisher and Yanofsky 1984).
The key role of the 3:4 terminator RNA structure has been especially
well documented. In the his, trp, leu, and thr leader regions, termination
at the attenuator is reduced by mutations that disrupt base pairs in the
stem of the terminator hairpin (see Kolter and Yanofsky 1982; Bauer et
al. 1983; Landick and Yanofsky 1987a and references therein). Furthermore, using the trp and thr leader regions, it has been shown convincingly by in vitro transcription of heteroduplex DNA templates that such
mutations affect attenuation only when they reside in the transcribed
strand, and thus appear in the RNA transcript, and not when they are
present in the non transcribed strand (Ryan and Chamberlin 1983; Yang
and Gardner 1989). Finally, Gardner and co-workers have shown that at
least six of the nine tandem thymidine residues in the thr attenuator are
required for efficient termination and that successive removal of more
thymidines linearly decreases termination, until, when only two remain,
termination is abolished (Lynn et a1. 1988).
Translation of the Leader Peptide Coding Region,
Not the Peptide Product, Controls Attenuation
The importance of translation in controlling attenuation was first evident
from the effects of mutations that affect tRNA structure or charging (see
Landick and Yanofsky 1987a). Mutations in the genes for the tryptophan,
histidine, leucine, and threonine aminoacyl-tRNA synthetases increase
readthrough of the trp, his, leu, and thr attenuators, respectively. Similarly, increased readthrough of attenuators is caused by mutations in the
structural genes for tRNATrp and tRNAHis and by the miaA and hisT
mutations, which affect isopentenylation (miaA) and pseudouridylation
(hisT) of certain tRNAs. The regulatory requirement for leader peptide
synthesis was established most clearly in genetic studies of his and trp attenuation. In both cases, mutations that alter the leader peptide initiation
codon reduce operon expression and eliminate increased readthrough
upon amino acid starvation; some of the his mutations and several
changes in the ribosome-binding site for S. marcescens trp leader peptide
coding region give intermediate phenotypes consistent with a partial
defect in translation.
~
r
....
416
R. Landick and C.L. Turnbough, Jr.
Synthesis of the leader peptide has been demonstrated by expressi
of genes (such as lacZ) fused to the leader peptide coding region and ~n
direct detection of the unstable leader peptide both in vitro and in Vi/
0
(see Landick and Yanofsky 1987a). However, all tests for a trans-actin
function for the leader peptide have been negative: It is the act of transla~
tion, rather than its product, that controls attenuation. Once the
regulatory decision is made, after one round of leader peptide synthesis
the completed leader transcript blocks additional (and wasteful) transla~
tion by complementary base pairing between the leader peptide ShineDalgarno sequence and a distal segment of the transcript (see Landick
and Yanofsky 1987a).
Analysis of several mutations that result in new stop codons at his
leader peptide positions 4, 5, and 7 suggests that the ribosome must move
to within 16 bases of the bottom of the A:B RNA hairpin (equivalent to
the trp 1:2 hairpin) before it can block formation of this structure
(Johnston and Roth 1981; for review, see Landick and Yanofsky 1987a).
Suppressor and frameshift mutations that allow the ribosome to translate
past the normal stop codon in both the his (Johnston and Roth 1981) and
thr (Roghani et al. 1985) leader regions increase transcriptional readthrough, apparently because the translating ribosome directly blocks
formation of the terminator hairpin.
Experiments in which attenuation control codons have been replaced
by codons for other amino acids have verified the essential role of the
control codons for regulation of attenuation and confirmed that the leader
peptide lacks other functions. Interestingly, simple substitution of one set
of codons for another does not always result in equivalent control of attenuation by the level of the new cognate charged tRNA. Replacement of
the 8 threonine (7 ACC, 1 ACA) control codons in the thr leader region
with either 5 or 8 histidine (CAC or CAT) codons eliminates response to
threonine starvation and does cause increased readthrough in hisT (a
tRNAHis_modifying mutation) strains (Lynn et al. 1987). However, replacement with either 2 arginine (1 CGU, 1 CGA) or 2 phenylalanine
(UUC) codons of 2 leucine control codons (1 CUU, 1 CUA) in the E.
coli ilvGMEDA leader region does not produce increased readthrough in
response to starvation for arginine or phenylalanine (Chen et al. 1991).
Furthermore, replacement of the 4 leucine (3 CUA, 1 CUG) control
codons in the E. coli leu leader region with ACU threonine codons,
which eliminates regulation in response to leucine starvation, gives only
modest response to a defect in tRNAThr charging (Carter et al. 1985).
Reducing the number of the rare CUA leucine codons to 1 or 2 decreases
read through in response to leucine starvation, whereas incorporation of 6
or 7 CUA codons increases the sensitivity of response (Bartkus et al.
1991).
which
rnore e
attenm
isoacc1
rnent (
AGG
tenuat,
1990)
regula
attenu
tween
ing ril
Trans
Trans
One
scrip1
until
ling'
duce
for tl
of R
vide,
(Pau
ham
anal
ilvE
Barl
ther
unti
pol:
knc
cen
ing
reg
of
loc
cre
po
Transcriptional Attenuation
~en demonstrated by exp
.
.
resslon
~r ~eptlde codIng region and b
~PtJde both in vitro and' . y
In VIVO
ever, all tests for a trans
.
'.
-actIng
negatIve: It IS the act of tr ans Iamtrols attenuation. Once th
:md of leader peptide synth . e
' .
I
eSIS
Id ItIOna (and wasteful) tr I '
ans a.veen the leader peptide Sh'Ineof the transcript (see Landick
~
.
suit in new stop codons at his
itS that the ribosome must move
":B RNA ~airpin (equivalent to
:k formatIon of this structur
Landick and Yanofsky 1987a)~
allow the ribosome to translate
, ~Johnston and Roth 1981) and
; Increase transcriptional readting ribosome directly blocks
trol codons have been replaced
~rified the essential role of the
n and confirmed that the leader
I, simple substitution of one set
mIt in equivalent control of at;harged tRNA. Replacement of
codons in the thr leader region
I codons eliminates response to
reased readthrough in hisT (a
'nn et al. 1987). However, reT, 1 CGA) or 2 phenylalanine
1S (1 CUU, 1 CUA) in the E.
lduce increased read through in
nylalanine (Chen et al. 1991).
ne (3 CUA, 1 CUG) control
with ACU threonine codons
I leucine starvation, gives onl;
charging (Carter et al. 1985).
:ine codons to 1 or 2 decreases
Dn, whereas incorporation of 6
ty of response (Bartkus et al.
417
1991). A simple interpretation of these findings is that rare codons for
which the cognate tRNA isoacceptor is present at low concentration are
more effective at causing ribosome stalling, and thus readthrough of the
attenuator, than frequently used codons for which the cognate tRNA
isoacceptor is abundant. Two other results support this idea: (1) Replacement of the tryptophan control codons with a UGC cysteine and a rare
AGG arginine codon increases basal level readthrough of the trp attenuator and abolishes response to a tRNATrp defect (Landick et al.
1990) and (2) a single rare CUA leucine codon is sufficient to allow
regulation by charged tRNALeu levels of the S. marcescens ilvGMEDA
attenuator (Hsu et al. 1985). Another possibility is that interactions between charged tRNAs on adjacent codon pairs are important in determining ribosome step-time (Gutman and Hatfield 1989).
Transcriptional Pausing Couples Translation with
Transcription Early in the Leader Region
One problem confronting early models for attenuation was how transcription of the attenuator by every RNA polymerase could be delayed
until a ribosome reached the tryptophan control codons. Complete coupling was required by the finding that extreme tryptophan starvation produced 100% readthrough but seemed inconsistent with the time required
for translational initiation and with the stochastic nature of the movement
of RNA polymerase and ribosomes. An answer to this puzzle was provided by the discovery that RNA polymerase pauses at a discrete site
(Pause, Fig. 2) immediately after synthesis of the 1:2 RNA hairpin (Farnham and Platt 1981; Winkler and Yanofsky 1981). Similar pause sites at
analogous positions now have been documented in the thr, ilvGMEDA,
ilvBN, his, and leu operon leader regions (see Chan and Landick 1989;
Bartkus et al. 1991; and Landick and Yanofsky 1987a and references
therein). This suggests that pausing at these sites may halt transcription
until a ribosome initiates translation and approaches the paused RNA
polymerase.
From extensive studies on pausing in the trp leader region in vitro, we
know that pausing is increased by the NusA protein and by low concentrations of GTP (the next nucleotide added after the pause); that pausing can be decreased by translation of the trp leader peptide coding
region, by addition of an oligonucleotide complementary to the 5' side
of the pause RNA hairpin, and by base changes in the stem but not the
loop region of the 1:2 RNA hairpin; and that pausing can be either increased or decreased by amino acid substitutions in the Bsubunit of RNA
polymerase that similarly increase or decrease transcriptional termination
418
R. Landick and C.L. Turnbough, Jr.
(see Landick and Yanofsky 1987a and referenc.es therein; Landick et al.
1990). The trp pause RNA ha~ b~en detected 10 E. coli (Landick et al.
1987). Where tested, parallel fmdmgs have been made with other pau
.
I'Iste d ab ove.
se
sItes
Both the RNA hairpin structure and the DNA sequence downstrea
from the pause site are key determinants of pausing. Base changes from
3 to 12 nucleotides past the trp pause. site can reduce pausing by up to~
factor of 3 (Lee et al. 1990). InterestIngly, when placed after the pause
site, both A+ T- and G+C-rich sequences reduce pausing; apparently interactions between the wild-type downstream DNA sequence and RNA
polymerase decrease its propensity for elongation. However, the essential
role of the RNA hairpin is equally clear. Replacement of either the G or
C alone in G:C base pairs in the upper stem of the his pause RNA hairpin
reduces transcriptional pausing, but pausing is restored to wild-type
levels when two mutations are combined to produce a C:G base pair
(C.L. Chan and R. Landick, in prep.).
There are several possible mechanisms for the effect of RNA hairpin
formation on transcriptional elongation: (1) The hairpin could disrupt a
configuration of the transcript required for elongation, (2) it could interact allosterically with RNA polymerase to change its catalytic properties,
(3) it could interact with RNA polymerase and block enzyme movement
on the DNA template, or (4) it could obstruct the binding of nucleoside
triphosphates to the active site. Recent studies suggest that the eight
nucleotides of template-strand DNA immediately upstream of the active
site are paired to the 3' end of the nascent transcript in transcription
complexes paused at the trp and his leader pause sites and in complexes
halted at non-pause sites by nucleoside triphosphate deprivation (Lee and
Landick 1992). Furthermore, an analysis of the effects on pausing of
base substitutions throughout the his pause hairpin suggests that only the
upper 5 bp of the hairpin form in the paused transcription complex (C.L.
Chan and R. Landick, in prep.). This region corresponds to the upper 6
bp of the trp 1:2 hairpin (Fig. 2). These results suggest that pause hairpin
formation does not inhibit elongation by disrupting the normal configuration of the 3' proximal region of the transcript.
Several explanations also are possible for NusA-enhancement of
pausing: (1) NusA could interact with RNA polymerase to increase the
Km for nucleoside triphosphates, (2) it could contact and stabilize the
RNA hairpin, or (3) it could induce RNA polymerase to stabilize the
hairpin. RNase T1 digestion studies of isolated trp paused transcription
complexes revealed that NusA protects some sites in the hairpin against
nuclease cleavage (Lan dick and Yanofsky 1987b). Additionally, some
alterations to the pause hairpin reduce the effect of NusA on pausing
(1
w
et
or
VI
aT
aT
tr:
pi
ar
fc
is
D
th
al
Ie
Y
dl
hI
til
al
TI
LI
U
tr
P
tt
R
f(
b:
tl
tl
\\
\\
t(
n
l
o
c
Transcriptional Attenuation
~renc.es therei~; Landick et al,
:ted m E. colz (Lan dick et I
·
a.
: been rna de with other pause
: DNA. sequence downstrea m
f pausmg. Base changes from
:an reduce pausing by up to a
. when placed after the pause
educe pausing; apparently inam DNA sequence and RNA
gation. However, the essential
eplacement of either the G or
of the his pause RNA hairpin
ing is restored to wild-type
to produce a C:G base pair
for the effect of RNA hairpin
) The hairpin could disrupt a
elongation, (2) it could inter:hange its catalytic properties,
and block enzyme movement
'uct the binding of nucleoside
tudies suggest that the eight
diately upstream of the active
ent transcript in transcription
pause sites and in complexes
~osphate deprivation (Lee and
of the effects on pausing of
hairpin suggests that only the
d transcription complex (C.L.
m corresponds to the upper 6
llltS suggest that pause hairpin
;rupting the normal configuraript.
e for NusA-enhancement of
A polymerase to increase the
mId contact and stabilize the
\ polymerase to stabilize the
lated trp paused transcription
ne sites in the hairpin against
r 1987b). Additionally, some
~ effect of NusA on pausing
419
(Landick and Yanofsky 1984; c.L. Chan and R. Landick, in prep.),
whereas changes to the downstream DNA sequence have no effect (Lee
et al. 1990). Thus, NusA appears either to interact with the pause hairpin
or to stabilize an RNA polymerase/pause hairpin interaction.
In summary, there is much circumstantial evidence to support the
view that in vivo RNA polymerase becomes arrested at the trp pause site
and equivalent sites in the leader regions of other attenuation-controlled
amino acid biosynthetic operons until a ribosome approaches during
translation of the leader transcript and releases the enzyme, either by
physical contact or by dissociation of the 1:2 RNA hairpin. On evolutionary grounds, pausing must playa key role, since pause sites have been
found at the expected locations in every case examined and since pausing
is favored both by the upstream RNA hairpin and by the downstream
DNA sequence. Furthermore, leader region alterations that should stall
the ribosome before it can reach the paused RNA polymerase (Bartkus et
al. 1991; Chen et al. 1991) or that increase the distance between the
leader peptide start codon and the paused polymerase by 55 codons (C.
Yanofsky, pers. comm.) do not uncouple transcription and translation
during attenuation. These data all argue for the importance of pausing;
however, final proof that it is required for proper regulation of attenuation, by demonstrating an effect of loss of pausing in a way that does not
alter leader transcript folding, remains an un met experimental challenge.
The Extent of Ribosome Release Determines Basal
Level of Readthrough Transcription
Until recently, it has been unclear whether a ribosome that reaches the
trp leader peptide stop codon releases rapidly allowing the 1:2 RNA hairpin to reform and block formation of the read through conformation or if
the ribosome releases slowly and directly blocks formation of the 2:3
RNA secondary structure. Viable models for attenuation control can be
formulated using either scenario. Two lines of evidence suggest that the
latter explanation is correct and that the rate of release of the ribosome at
the stop codon may be responsible for the higher basal level of readthrough observed in cells growing in excess tryptophan, relative to cells
where leader peptide synthesis is blocked. First, Yanofsky and coworkers found that mutations in ribosome release factors 1 or 2 increase
termination at the trp attenuator only when the leader peptide stop codon
matches the release factor specificity (UAA and UAG for RF1; UAA and
UGA for RF2; Roesser and Yanofsky 1988; Roesser et al. 1989). Second, replacement of the second tryptophan control codon with a UGA
codon increases attenuator readthrough to approximately 90% even when
420
R. Landick and C.L. Turnbough, Jr.
cells are grown in excess tryptophan, apparently because the slowly
releasing ribosome at the new UGA codon simulates a ribosome stalled
at the tryptophan control codons in a wild-type bacterium (Landick et al.
1990). A similar result was found when an ilvGMEDA control codon was
replaced with a UGA codon (Chen et al. 1991). Careful analysis of the
effects of release factor mutants in strains with various altered trp leader
regions led Yanofsky and co-workers to conclude that approximately
24% of ribosomes release from the leader peptide stop codon while RNA
polymerase is still transcribing the leader region. Thus, the normal 15%
basal level readthrough in cells growing in excess tryptophan can be accounted for by an equal probability of forming either the termination or
read through conformation of the leader transcript once the ribosome has
released, coupled with the approximately 3% readthrough inherent in the
trp attenuator (measured in strains where leader peptide synthesis is
blocked). In other enteric bacteria, different relative stabilities of the 1:2
and 2:3 RNA secondary structures appear to determine a basal level of
attenuator readthrough most appropriate for the species (Yanofsky 1984).
Another Example
f
The ermK gene from Bacillus licheniformis encodes an erythromycininducible 23S rRNA methylase that confers resistance to the macrolide,
lincosamide, and streptogramin B antibiotics. Recent data indicate that
ermK expression is regulated by transcriptional attenuation analogous to
that described above, except that the position of the ribosome translating
the leader transcript, and thus the selection of leader transcript secondary
structure, is controlled by erythromycin-dependent stalling of translation
(Kwak et al. 1991).
ATTENUATION CONTROL OF PYRIMIDINE GENE EXPRESSION:
TIGHTLY COUPLED TRANSCRIPTION AND TRANSLATION
PERMIT A RIBOSOME TO DIRECTLY BLOCK THE
FORMATION OF A TERMINATOR RNA HAIRPIN
The discovery of similar attenuation control mechanisms regulating
several amino acid biosynthetic operons raised the possibility that this
type of regulation might be limited to genes involved in amino acid metabolism. The first clear indication to the contrary came from studies of
pyrimidine biosynthesis in E. coli and S. typhimurium. In these bacteria,
the de novo synthesis of UMP, the precursor of all pyrimidine
nucleotides, is catalyzed by six enzymes encoded by six unlinked genes
and small operons designated carAB, pyrBI, pyre, pyrD, pyrE, and pyrF
(Net
beg 2
that
tiati4
puta
dere
pyri
mec
Trar
The
(pyl
(Al
seV4
(Sc:
DN
p-ir
fan
Sch
of I
thi~
attf
lea
stn
dif
sec
Fir
bir
in
an
tel
trc
Ie;
pr
R
se
in
ce
Transcriptional Attenuation
lpparently because the I
.
s OWly
sImulates. a ribosome stalied
-type bactenum (Landick
.
et al
I livGMEDA control codo
.
n Was
1~91). ~areful analysis of the
wIth vanous altered trp leader
I conclude that approximat I
'd
ey
peptJ e stop codon while RNA
region. Thus, the normal 15%
n excess tryptophan can be ac'ming. either the termination 0 r
mscnpt once the ribosome has
3% readthrough inherent in the
re leader peptide synthesis is
nt relative stabilities of the 1:2
. to determine a basal level of
'r the species (Yanofsky 1984).
In
nis encodes an erythromycinrs resistance to the macrolide
tics. Recent data indicate tha~
jonal attenuation analogous to
ion of the ribosome translating
of leader transcript secondary
:pendent stalling of translation
EXPRESSION:
;LATION
ntrol mechanisms regulating
'aised the possibility that this
:s involved in amino acid me:ontrary came from studies of
'Phimurium. In these bacteria,
precursor of all pyrimidine
ncoded by six unlinked genes
r, pyre, pyrD, pyrE, and pyrF
421
(Neuhard and Nygaard 1987). Studies of the regulation of these genes
began in the 1960s and were dominated until the late 1970s by the idea
that one or perhaps two repressor proteins controlled transcriptional initiation of all the genes. However, attempts to isolate mutants lacking the
putative repressor(s) failed, and additional experiments showed that
derepression of pyrimidine gene expression under conditions of
pyrimidine limitation was noncoordinate, suggesting that independent
mechanisms might regulate each pyrimidine gene or operon.
Transcriptional Attenuation in the pyrBI Operon of E. coli
The pyrB! operon of E. coli encodes the catalytic (pyrB) and regulatory
(pyrl) subunits of the allosteric enzyme aspartate transcarbamylase
(ATCase). Expression of this operon is negatively regulated over a
several-hundredfold range by the intracellular concentration of UTP
(Schwartz and Neuhard 1975; Pierard et ai. 1976; Turnbough 1983). The
DNA sequence of the pyrB! promoter-leader region revealed a potential
p-independent transcriptional terminator (attenuator) located 23 bp before pyrB, the first gene in the operon (Roof et ai. 1982; Navre and
Schachman 1983; Turnbough et ai. 1983). Transcripts initiated at either
of two potential pyrB! promoters were efficiently (-98%) terminated at
this site in vitro, indicating that regulation of operon expression involved
attenuation (Turnbough et ai. 1983). However, the sequence of the pyrB!
leader transcript indicated that it could not adopt alternative stem-loop
structures, implying that attenuation control of pyrB! expression would
differ mechanistically from that of the amino acid biosynthetic operons.
Two additional putative regulatory elements were identified from the
sequence of the leader region and in vitro transcription experiments.
First, a 44-codon open reading frame, preceded by an apparent ribosomebinding site, extends through the leader region and ends six nucleotides
in front of the pyrB gene (Fig. 4). Because tight coupling of transcription
and translation can block transcriptional termination at a p-independent
terminator (Johnston et ai. 1980), this open reading frame suggested that
transcriptional termination at the pyrB! attenuator might be regulated by
modulating the relative rates of transcription and translation within the
leader region. Second, a strong transcriptional pause was observed approximatel y 20 bp before the pyrB! attenuator (Turnbough et ai. 1983).
RNA polymerase stalls in this region, which is within a long uridine-rich
sequence in the leader transcript, at low (e.g., 20 !lM) UTP concentrations
in vitro; strong pausing was not detected in the leader region at low concentrations of ATP, CTP, or GTP.
These findings suggested the following model for UTP-sensitive at-
422
R. Landick and C.L. Turnbough, Jr.
"Pause Hairpin"
Terminator
Hairpin
Ly,
A A
ACAAUU~
60
~
:
C
Leu U=A
lOG
C:=G
g
Lys
Asn A U
A
C 120
G;:::;G Arg
Leu U=A
U=A Asp
~GE
G
~
C.=G
IG
C=G
g:~GIY
Ala
Pro
Gin
G=:G
G::;:C7Q
~
!e~ C=:G ~tu
U
Mer Val Gin C s Val
HIs Phe Val
Pro Phe Phe PM Pro Leu lie
Thr HIS
5~/OG=C~:
Phe C s Pro GI
GUAUGGUUCAGU~UGUU~ACAUUUUGUCUUAC=GCCUGCCGUUUUUCUUCCCGUUGAUCACCCAUUCCCA=UUUUUUUUdCCCAG~C~~C~rL~rg SlOp
20
30
40
50
80
90
100
130
140
Mer
~AUAAAAG AUG
,~.
Figure 4 Nucleotide sequence of the pyrB! leader transcript. This transcript is
initiated at the more downstream of the two potential pyrB! promoters identified
by in vitro transcription; the vast majority of pyrB! transcripts are initiated at
this downstream promoter in vivo (Donahue and Turnbough 1990). Numbering
is from the 5' end. Transcriptional initiation can occur at either of the first two
A residues. Nucleotides 21-152 encode a 44-amino acid leader polypeptide, and
the sequence ends with the AUG initiation codon of the pyrB cistron. The
secondary structures shown are encoded by a region of dyad symmetry flanked
by UTP-sensitive transcriptional pause sites (pause hairpin) and the pyrB! attenuator (terminator hairpin). The Shine-Dalgarno sequences for the leader
polypeptide and pyrB are underlined.
tenuation control of pyrB! expression (Fig. 5) (Turnbough et al. 1983).
When the intra~ellular level of UTP is low due to pyrimidine limitation,
transcribing RNA polymerase stalls in the uridine-rich region of the
leader transcript. This pause provides sufficient time for a ribosome to
initiate translation of the 44-codon open reading frame and translate up
to the stalled RNA polymerase. When RNA polymerase eventualIy escapes the pause region and transcribes the attenuator, the terminator hairpin is precluded from forming or is disrupted by the adjacent translating
ribosome, permitting RNA polymerase to continue transcribing into the
pyrB! structural genes. In contrast, when the intracelIular level of UTP is
high, RNA polymerase transcribes the leader region without pausing. In
this case, the ribosome is unable to couple closely with RNA polymerase
and the terminator hairpin consequently forms, terminating transcription
before the structural genes.
Fi
Sf
(i
tt
tr
o
1
P
Pyrimidine-mediated Regulation of pyrBI Expression
Occurs Primarily by Attenuation
A major prediction of the attenuation control model is that transcriptional
termination at the pyrB! attenuator is sensitive to the intracelIular level of
UTP. This prediction was confirmed by measuring the levels of attenuated and readthrough pyrB! transcripts under conditions of
pyrimidine excess or limitation, which were achieved by growing a
pyrimidine auxotroph in minimal media supplemented with either uracil
1=
s
)
Terminator
Hairpin
I
Transcriptional Attenuation
1
Promoter-Regulatory Region
Transcriptional
Pause Sites
pyrBI Promoter
Asn AU
A
e120
G::G Afg
Leu U=A
[
423
'"
~
B88l
Attenuator
Structural Genes
~
G;:::::G
C=GGly
Pro G:;:G
T leader transcript. This transcript is
, potential pyrBI promoters identified
of pyrBI transcripts are initiated at
.e and Turnbough 1990). Numbering
III can occur at either of the first two
4-amino acid leader polypeptide, and
::m codon of the pyrB cistron. The
, a region of dyad symmetry flanked
:s (pause hairpin) and the pyrBI atDalgarno sequences for the leader
:Fig. 5) (Turnbough et al. 1983).
low due to pyrimidine limitation,
11 the uridine-rich region of the
sufficient time for a ribosome to
n reading frame and translate up
RNA polymerase eventually eshe attenuator, the terminator hairrupted by the adjacent translating
to continue transcribing into the
11 the intracellular level of UTP is
leader region without pausing. In
)le closely with RNA polymerase
1 forms, terminating transcription
Expression
mtrol model is that transcriptional
I1sitive to the intracellular level of
by measuring the levels of atanscripts under conditions of
h were achieved by growing a
a supplemented with either uracil
Low UTP - Strong Transcriptional Pausing
Readthrough
Transcription
)
RNA Polymerase
Leader Peptide
Leader Transcript
~p----------------------------~
ppp-----------Figure 5 Model for attenuation control of pyrBI operon expression. The model
shows the relative positions of RNA polymerase and the translating ribosome
(i.e., tightly coupled or uncoupled) when UTP levels are either low or high. Note
that there is no requirement for ribosome binding or translation of the leader
transcript at high UTP.
or a poorly metabolized pyrimidine source, respectively (Levin et al.
1989). Approximately 99% of the transcripts initiated at the pyrBI
promoter(s) were terminated at the attenuator under conditions of
pyrimidine excess. In cells limited for pyrimidines, readthrough transcription past the attenuator increased in proportion to increases in
ATCase levels. To determine whether attenuation control was
responsible for all pyrimidine-mediated regulation of operon expression,
a mutant E. coli strain was constructed that carries a 9-bp chromosomal
deletion removing the run of thymidine residues at the end of the pyrBI
attenuator plus one additional base pair to maintain the reading frame of
the leader polypeptide (Uu and Turnbough 1989). All p-independent
424
R. Landick and C.L. Turnbough, Jr.
transcriptional termination is abrogated at this mutant attenuator. Under
conditions of pyrimidine excess, pyrB! expression was 51-fold higher in
the mutant strain than in an isogenic pyrB!+ strain. When the mutant Was
limited for pyrimidines, operon expression increased an additional 6.5fold. Growth of the pyrB!+ strain under the same pyrimidine-limiting
conditions resulted in a slightly greater than 300-fold increase in operon
expression. These results indicate that attenuation control is responsible
for most, but not all, of the pyrimidine-mediated regulation. Recent
studies indicate that the residual 6.5-fold pyrimidine-mediated regulation
in the mutant strain most likely reflects two additional control mechanisms that appear to act at the level of transcriptional initiation (c. Liu
and c.L. Turnbough, Jf., unpubl.).
Translation of the pyrBI Leader Transcript Is Required
for Attenuation Control
Convincing evidence for translation of the 44-codon open reading frame
in the pyrB! leader transcript was provided by fusion of the pyrB!
promoter region and leader open reading frame to lacZ and detection of
the predicted lea_der polypeptide/B-galactosidase fusion protein (Roland
et al. 1985). The'regulatory role of translation of this open reading frame
was tested with pyrB! leader mutations that alter the initiation codon and
strongly inhibit translational initiation or that introduce stop codons early
in the reading frame well before the attenuator (Clemmesen et al. 1985;
Roland et al. 1985, 1988). Each mutation reduced operon expression to
s6% of the wild-type level under conditions of pyrimidine limitation and
to s30% of the wild-type level under conditions of pyrimidine excess;
the latter effect presumably reflects residual coupling of transcription and
translation within the wild-type leader region even in cells grown with
uracil. As with attenuation in the amino acid biosynthetic operons, it is
the act of translation of the pyrB! leader transcript and not the leader
polypeptide itself that functions in regulation. Thus, near-normal attenuation control was observed in a mutant bearing a (+) frameshift at codon 6
of the open reading frame, which still allows translation of the entire
leader region (Clemmesen et al. 1985).
Based on estimates of the size of the ribosome-binding site (Steitz and
Jakes 1975; Kang and Cantor 1985), translation would have to proceed to
within approximately 15 nucleotides of the pyrB! attenuator-encoded
terminator hairpin to interact directly with this sequence and interfere
with hairpin formation. This presumption was examined by measuring
attenuator function in mutants containing termination codons at various
sites in the leader open reading frame (Roland et al. 1988). The results
reve:
nuell
exprl
limit
code
bind
64%
crea:
cod(
OCCl
term
regu
pyrl
to CI
198'
I
stud
pyrl
tion
tern
ces~
sen~
psel
rate
seci
tive
res)
tiOl
scr
rib
tivi
Ro
lea
as
co
op
C.
pe
AI
Ie
si
Transcriptional Attenuation
this .mutant attenuator. Under
resslOn
was 51-fold higher'In
.
- straIn.
When
the mutant was
.
I Increased an additional 6.5~he same p~rimidine-Iimiting
n 300-fold
Increase in Opera n
.
!lUah?n control is responsible
-medIated regulation. Recent
rrimidine-mediated regulation
N'O additional control mecha_
nscriptional initiation (c. Liu
Required
44-codon open reading frame
ded by fusion of the pyrB/
'arne to lacZ and detection of
;idase fusion protein (Roland
on of this open reading frame
. alter the initiation codon and
at introduce stop co dons early
ator (Clemmesen et al. 1985;
reduced operon expression to
s of pyrimidine limitation and
ditions of pyrimidine excess;
coupling of transcription and
ion even in cells grown with
:id biosynthetic operons, it is
transcript and not the leader
In. Thus, near-normal attenuang a (+ ) frameshift at codon 6
ows translation of the entire
lsome-binding site (Steitz and
tion would have to proceed to
he pyrB! attenuator-encoded
I this sequence and interfere
was examined by measuring
ermination codons at various
land et al. 1988). The results
425
revealed that translational termination at or before codon 24, which is 16
Ducleotides upstream of the terminator hairpin (Fig. 4), reduces operon
expression to only approximately 5% of wild type under pyrimidinelimiting conditions. In contrast, when translational termination occurs at
codon 25, which should be the first termination codon at which ribosome
binding overlaps the sequence of the terminator hairpin, expression is
64% of the wild-type level. In general, the level of operon expression increases as the termination codon is moved further downstream from
codon 25, with the highest level of expression (i. e., 91% of wild type)
occurring with termination at codon 33, which is within the loop of the
terminator hairpin. Interestingly, in wild-type S. typhimurium, where
regulation of pyrE! expression appears to be the same as in E. coli, the
pyrE! leader transcript contains a stop codon at a position corresponding
to codon 34 of the E. coli 44-codon open reading frame (Michaels et al.
1987).
Further support for the regulatory role of translation comes from
studies on the effects of reduced rates of translational elongation on
pyrE! expression (Jensen 1988). According to the model, slower translation should reduce coupling to transcription and thereby increase
termination at the pyrE! attenuator under conditions of pyrimidine excess. These effetts were tested in E. coli strains that are streptomycin
sensitive (Sm S , rpsL +), streptomycin resistant (Sm R, rpsL999), or
pseudo-dependent on streptomycin (Sm P , rpsL); translational elongation
rates in these strains are approximately 15, 10, and 5 amino acids per
second per ribosome, respectively. In uracil-supplemented medium, relative operon expression in the Sm R and Sm P strains was 46% and 10%,
respectively, of wild type, as predicted by the model.
According to the attenuation control model, a single round of translation of the pyrE! leader transcript is sufficient to elicit readthrough transcription. Consistent with such a limited requirement for translation, the
ribosome-binding site preceding the leader open reading frame is relatively weak, only 7% as efficient as the pyrE ribosome-binding site (K.L.
Roland and c.L. Turnbough, Jr., unpub!'). Interestingly, mutations in the
leader ribosome-binding site that increase leader translation by as much
as tenfold cause less than a twofold increase in operon expression under
conditions of pyrimidine excess, and they have no significant effect on
operon expression under conditions of pyrimidine limitation (c. Liu and
c.L. Turnbough, Jr., unpub!'). Thus, leader translational initiation appears fine-tuned to produce strong regulation with minimal translation.
Additional control of leader translation is suggested by downstream
leader sequences that are complementary to the leader ribosome-binding
site (Navre and Schachman 1983; Roland et al. 1985). Formation of a
1
,.
\
I,
426
R. Landick and C.L. Turnbough, Jr.
secondary structure by these sequences could block multiple rounds of
translation of readthrough transcripts and perhaps all translation of attenuated transcripts.
Transcriptional Pausing in the pyrBI Leader Region Is
Required for Attenuation Control
Initial in vitro experiments suggested a single UTP-sensitive pause site in
the pyrE! leader region (Turnbough et al. 1983). However, recent work
employing a more refined assay at 20 !AM UTP reveals pausing at nearly
every uri dine residue in the leader transcript preceding the terminator
hairpin, with a few sites causing a slightly longer pause (J.P. Donahue
and c.L. Turnbough, Jr., in prep.). The initially identified strong pause
site is actually a cluster of pause sites at positions 81-88 (Fig. 4) between
the pause and terminator hairpins of the leader transcript. Pausing at all
sites decreases with increasing UTP concentrations and is no longer
detectable at 400 !AM. In vivo, UTP concentrations vary from approximately 50 !AM in pyrimidine-starved cells to 1 mM in cells grown under
conditions of pyri~idine excess (Turnbough 1983; Neuhard and Nygaard
1987).
Although initial work failed to detect pausing within the leader region
at low concentrations of ATP, CTP, or GTP (Turnbough et al. 1983),
recent experiments have identified a single, strong GTP-sensitive pause
prior to the addition of the guanine residue at position 55 in the leader
transcript (Fig. 4) (J. P. Donahue and C. L. Turnbough, Jr., in prep.). The
reason for pausing uniquely at this guanine residue is unclear. This pausing may account for the fourfold increase in ATCase levels observed in a
mutant strain of S. typhimurium defective in guanine nucleotide synthesis
(Jensen 1979).
Transversion (T to A) mutations that reduce the number of uridine
residues in the leader transcript and a mutation that swaps the eleventh
and twelfth codons of the leader polypeptide (which eliminates the dyad
symmetry encoding the pause hairpin) were constructed to determine the
role of UTP-sensitive transcriptional pausing in pyrB! attenuation control
(K. Mixter-Mayne and C. L. Turnbough, Jr., in prep.). Loss of a single
uridine residue at any of several positions preceding the terminator hairpin had little effect on operon expression. However, changing the 7
uridine residues between positions 81 and 88 reduces operon expression
to approximately 50% of the wild-type level under conditions of
pyrimidine excess and limitation. Moreover, changing all 13 uridine
residues between the pause and terminator hairpins reduces expression
under conditions of pyrimi'dine excess and limitation to 80% and 25% of
the w
range
co dOI
redu(
to 65
fivef,
tions
elimi
quire
essel
sig ni
mut,
the
then
(Nol
pam
the
lead
tion
tion
tent
typ)
pro
(4
I
tiv(
hig
SCI
th(
de
fa
p<
tc
v
p
Transcriptional Attenuation
,uld block multiple rounds of
perhaps all translation of at-
~egion
Is
.Ie UTP-sensitive pause site in
1983). However, recent work
JTP reveals pausing at nearl
.
d·
Y
npt prece mg the terminator
r longer pause (J.P. Donahue
itially identified strong pause
itions 81-88 (Fig. 4) between
ader transcript. Pausing at all
:entr~tions and is no longer
:ntratlOns vary from approxio 1 mM in cells grown under
1 1983; Neuhard and Nygaard
using within the leader region
TP (Turnbough et al. 1983),
, strong GTP-sensitive pause
e at position 55 in the leader
Turnbough, Jr., in prep.). The
residue is unclear. This pausI A TCase levels observed in a
I guanine nucleotide synthesis
educe the number of uridine
ation that swaps the eleventh
Ie (which eliminates the dyad
: constructed to determine the
g in pyrE! attenuation control
r., in prep.). Loss of a single
)receding the terminator hair1. However, changing the 7
~8 reduces operon expression
level under conditions of
rer, changing all 13 uri dine
. hairpins reduces expression
imitation to 80% and 25% of
427
the wild-type level, respectively, resulting in a threefold decrease in the
range of regulation. Approximately the same effect is observed with the
codon-swap pause hairpin mutation. Combining the last two mutations
reduces expression under conditions of pyrimidine excess and limitation
to 65% and 15% of the wild-type level, respectively, causing a four- to
fivefold decrease in the range of regulation. Examination of these mutations in vitro showed that replacing one or more uridine residues
eliminates UTP-sensitive pausing at the mutated site(s). The time required to complete the synthesis of the leader transcript at 20 I..lM UTP is
essentially unchanged by the single substitution mutations but decreases
significantly with the more extensive substitutions. The pause hairpin
mutation does not eliminate any UTP-sensitive pause sites, but it reduces
the half-lives of all pause complexes downstream from the mutation,
thereby reducing the time required to synthesize the leader transcript.
(Note that pausing does not occur immediately after the synthesis of the
pause hairpin, which is consistent with the current view on the nature of
the his and trp pause hairpins described above.) The time required for
leader transcript synthesis is further reduced by the combination mutation. Taken together, these results confirm that UTP-sensitive transcriptional pausing within the pyrE! leader region plays an essential role in attenuation control~
Additional support for this idea emerged from studies of a strain of S.
typhimurium carrying an altered RNA polymerase that exhibits an approximately sixfold higher Km for the binding of UTP (6 mM) and ATP
(4 mM) during transcriptional elongation. This mutant displays constitutive expression of the pyrE! operon and the pyrE gene (see below) at
high intracellular levels of UTP (Jensen et al. 1986), indicating that transcriptional pausing during the addition of uridine (or other) residues to
the pyrE! leader transcript, and not the UTP level per se, is the key
determinant in attenuation control. Finally, the transcriptional elongation
factor NusA enhances UTP-sensitive pausing by wild-type RNA
polymerase within the pyrE! and pyrE leader regions in vitro and appears
to be important in determining the level of expression of these genes in
vivo (Andersen et al. 1991; J.P. Donahue and c.L. Turnbough, Jr., in
prep.).
Expression of the pyrE Gene of E. coli Is Also
Subject to Attenuation Control
The DNA sequence of the region upstream of the E. coli pyrE gene contains putative regulatory elements similar to those present in the pyrE!
leader region. Indeed, pyrE expression is regulated over a 30-fold range
428
R. Landick and C.L. Turnbough, Jr.
almost entirely by an attenuation control mechanism that is analogous t
0
that described for the pyrB! operon (Bonekamp et al. 1984; Poulsen et a.1
1984; Poulsen and Jensen 1987; Jensen 1988). Interestingly, the "leader
open reading frame" upstream of the pyrE gene, initially designated orfE
is 238 codons long. Recently, this open reading frame was found to en~
code the tRNA processing exoribonuclease RNase PH, and the Open
reading frame was renamed rph (Ost and Deutscher 1991). Apparently
the pyrE gene is the second gene of a bicistronic operon, and the cell ha~
usurped translation of the first cistron for the purpose of attenuation control of pyrE expression. Also noteworthy is that the rph gene ends 8 bp
before the dyad symmetry of the pyrE attenuator. Due to the size of the
ribosome, translation to the end of the rph cistron still permits efficient
disruption of the pyrE attenuator-encoded terminator hairpin. In related
studies, it has been shown that pyrE expression in S. typhimurium is essentially identical to that in E. coli and also that regulation of carAB
pyrC, pyrD, and pyrF expression in these bacteria does not involve at~
tenuation control (Neuhard and Nygaard 1987).
RE(
In
tral
tral
tio]
latl
bill
is t
ree
fOI
re!
po
ph
wI
en
gIl
ill
Other Examples
f
In Bacillus subtilis, all pyrimidine biosynthetic genes appear to be included in a single operon (Quinn et al. 1991). The DNA immediately
preceding the pyrB gene, the first pyrimidine gene in the operon, appears
to contain regulatory elements analogous to those in the pyrB! and pyrE
leader regions of E. coli and S. typhimurium, suggesting similar UTPsensitive attenuation control (Quinn et al. 1991; R.L. Switzer, pers.
comm.). If such regulation were proven to occur, it would indicate that
this type of control is widespread among evolutionarily diverse bacteria.
Expression of the E. coli ampC gene, which encodes 13-lactamase, increases with increasing cellular growth rate. The proposed mechanism
for this regulation is similar to pyrB! and pyrE attenuation control and
relies on two key elements: (1) a p-independent attenuator in the ampC
leader region and (2) a regulatory ribosome-binding site just upstream of
the attenuator-encoded terminator hairpin (J aurin et al. 1981; Grundstrom and Normark 1985). The AUG initiation codon of this ribosomebinding site is followed immediately by an ochre codon. According to
the current model, formation of a translational initiation complex at the
ribosome-binding site, to an extent increasing with the growth rate, prevents the formation of the terminator hairpin, thereby permitting transcription of the ampC gene. The interesting difference in this regulatory
mechanism is that there is no requirement for translational elongation
within the leader region ..
pr
Iy
Transcriptional Attenuation
,I mechanism that is analog
ous to
1ekamp et al. 1984; Poulsen et I
a
I 1988). Interestingly, the "Ie d .
... I
a er
-E gene, ITIltIa Iy designated arfE
I reading frame was found t
o en-'
:Iease RNase PH , and the Open
nd. Deutscher
1991). Apparentl y,
.
clstromc operon, and the cell has
Ir the purpose of attenuation conly is that the rph gene ends 8 b
P
ittenuator.
Due to the size of th e
.
rph clstron still permits efficient
led terminator hairpin. In related
pression in S. typhimurium is esd also that regulation of carAB
~se bacteria does not involve at~
1987).
;ynthetic genes appear to be in. 1991). The DNA immediately
idine gene in the operon, appears
IS to those in the pyrB! and pyrE
!urium, suggesting similar UTPt al. 1991; R.L. Switzer, pers.
I to occur, it would indicate that
. evolutionarily diverse bacteria.
, which encodes ~-Iactamase, inrate. The proposed mechanism
nd pyrE attenuation control and
~pendent attenuator in the ampC
,me-binding site just upstream of
Jin (Jaurin et al. 1981; Grundlitiation codon of this ribosomey an ochre codon. According to
ational initiation complex at the
~asing with the growth rate, prelairpin, thereby permitting tranting difference in this regulatory
lent for translational elongation
429
REGULATORY-FACTOR-DEPENDENT ATTENUATION CONTROL
In the two classes of attenuation control described so far, regulation of
transcriptional attenuation is achieved by coupling transcription and
translation within a regulatory leader region. In a third type of attenuation control, called regulatory-factor-dependent attenuation, the regulatory role of translation is replaced by specialized, trans-acting RNAbinding factors. One of the best-studied examples of this type of control
is the regulation of bgl operon expression in E. coli.
The bgl operon of E. coli contains three genes (bgIG, bglF, and bglB)
required for the utilization of aromatic ~-glucosides as a carbon source
for growth (Schnetz et al. 1987). The bglG gene encodes a positive
regulatory protein (BglG); bglF encodes the ~-glucoside-specific transport protein enzyme nBg\ (BglF) of the phosphoenolpyruvate-dependent
phosphotransferase system, which phosphorylates ~-glucosidic sugars
while transporting them through the cytoplasmic membrane; and bglB
encodes phospho-~-glucosidase B, which hydrolyzes phosphorylated ~­
glucosides. The bgl operon is cryptic in wild-type cells, but various
mutations activate the operon by enhancing transcription from its
promoter. Once activated, expression of the operon is regulated positively by ~-glucosides and by cAMP (Lopilato and Wright 1990).
Transcription from the activated bgl promoter is constitutive, but in
the absence of a ~-glucoside inducer, most transcripts are terminated at a
p-independent attenuator located just upstream of bglG, the first gene in
the operon. A second p-independent attenuator resides between bglG and
the adjacent bglF gene (Mahadevan and Wright 1987; Schnetz et al.
1987). The positive regulator BglG is required to prevent transcriptional
termination at the two attenuators (Mahadevan and Wright 1987; Schnetz
and Rak 1988). Low levels of BgIG and BglF are synthesized in the absence of ~-glucosides, but under these conditions, BgIF inactivates BgIG
by phosphorylation. Apparently, BglG is active only as a dimer, and
phosphorylation disrupts or prevents dimerization. In the presence of ~­
glucosides, BglF dephosphorylates BglG, allowing it to dimerize and
function as an antitermination factor (Fig. 6) (Amster-Choder and Wright
1990 and pers. comm.). BglG dimers prevent transcriptional termination
within the operon by binding to sequences in the bgl mRNA that precede
and partially overlap the attenuator-encoded terminator hairpins. This
binding blocks the formation of the terminator hairpins, allowing expression of the operon. The BglG-binding site apparently forms an alternative secondary structure that is recognized by BglG (Houman et al.
1990).
Several additional examples of regulatory-factor-dependent attenuation control have emerged recently. The sacPA operon and the sacB gene
I
P
430
R. Landick and C.L. Turnbough, Jr.
bg/
Promoter
Attenuator
1
als
tro
Attenuator
2
SCT
fie
ar
at!
et
ne
8 P8 p
+
Phospho~-glucoside
Inactive
of
th
b~
RI
~-glucoside
p-glucoside present,
BglG dephosphorylated
by BgIF.
No p-glucoside,
BglG phosphorylated
by BgIF.
Figure 6 Model for attenuation control of bgl operon expression showing the
effects on transcfiption of BgIF-catalyzed phosphorylation or dephosphorylation
of BgIG in the absence or presence of ~-glucoside inducer, respectively. See text
for additional details.
of B. subtilis, which are involved in sucrose utilization, appear to be subject to regulation that is essentially the same as that of the E. coli bgl
operon, although in this case the positive regulatory genes are not linked
to the regulated loci. The bglG homo logs are sacT and sacY for the
sacPA operon and the sacB gene, respectively; each regulates a single attenuator (Crutz et al. 1990; Debarbouille et al. 1990). The trp operon of
B. subtilis, as in E, coli, is subject to attenuation control that involves
formation of alternative secondary structures in a leader transcript. However, in B. subtilis the formation of the transcript secondary structures is
not controlled by the position of a translating ribosome, but by the binding of a trans-acting regulatory protein (Mtr) encoded by the mtr gene.
Under conditions of abundant tryptophan, Mtr binds to a segment of the
leader transcript, preventing formation of a secondary structure functionally equivalent to the E. coli 2:3 hairpin and permitting formation of
a terminator hairpin (Shimotsu et al. 1986; Gollnick et al. 1990). The expression of the B. subtilis pur operon (Ebbole and Zalkin 1987), encoding all the purine biosynthetic enzymes, and the E. coli S10 operon
(Zengel and Lindahl 1990), which contains 11 ribosomal protein genes,
A
ti
i~
a
a
a
t:
a
Transcriptional Attenuation
lenuator
2
8p8p
+
Inactive
431
also appears to be subject to regulatory-factor-dependent attenuation control, although these studies are preliminary. The factor that controls transcriptional termination within the pur leader region remains to be identified, whereas ribosomal protein L4 is thought to facilitate termination at
a NusA-dependent attenuator in the SlO leader.
A final and novel example is represented by antisense RNA-induced
attenuation of staphylococcal plasmid pT181 repC transcription (Novick
et al. 1989). Apparently, an antisense RNA pairs with a target sequence
near the 5 ' end of the nascent repC transcript and promotes the formation
of a terminator hairpin. Premature transcriptional termination prevents
the synthesis of the repC-encoded replication initiator protein and thereby regulates plasmid copy number.
RHO-DEPENDENT ATTENUATION CONTROL
No p-glucoside,
BglG phosphorylated
by BgIF.
~l operon expression showing the
.phorylation or dephosphorylation
ide inducer, respectively. See text
,e utilization, appear to be subarne as that of the E. coli bgl
'egulatory genes are not linked
~s are sacT and sacY for the
'ely; each regulates a single at!t al. 1990). The trp operon of
enuation control that involves
'es in a leader transcript. Hownscript secondary structures is
ing ribosome, but by the bindlitr) encoded by the mtr gene.
Mtr binds to a segment of the
f a secondary structure funcin and permitting formation of
Gollnick et al. 1990). The ex)ole and Zalkin 1987), encodand the E. coli S 10 operon
s 11 ribosomal protein genes,
A fourth class of attenuation mechanisms employs p-dependent termination at an attenuator in place of p-independent termination. This scheme
is used to regulate expression of the E. coli tryptophanase (tna; Stewart
and Yanofsky 1985) and LlV -I transport (liv; Landick 1984; Williamson
and Oxender 1992) operons and, interestingly, rho itself (Matsumoto et
al. 1986). The ntost extensively studied of these examples, summarized
briefly here, is tna regulation; in general, much remains to be learned
about these mechanisms.
The tna operon consists of two genes: tnaA, encoding tryptophanase,
and tnaB, which encodes a tryptophan permease. Operon expression is
induced in E. coli by the presence of tryptophan, allowing the bacterium
to use this amino acid as a sole carbon or nitrogen source. The tna
mRNA has a 319-nucleotide leader region that contains an open reading
frame (tnaC) for a 24-amino acid leader peptide, with a single tryptophan
at residue 12, and a long, relatively unstructured sequence between tnaC
and tnaA within which p-dependent termination can occur both in vivo
and in vitro (Fig. 7) (Stewart et al. 1986). Addition of 0.5 mM tryptophan
to cultures induces tna operon expression nearly lOO-fold by preventing
p-dependent termination in the leader region (Stewart and Yanofsky
1985).
Induction of tna expression by tryptophan requires translation of the
tryptophan codon at position 12 in the leader peptide coding region, since
mutation of the tnaC initiation codon or replacement of the tryptophan
codon with a stop codon or a eGG arginine codon, even when a new
tryptophan codon is present at position 13, eliminates induction (Fig. 7)
(Gollnick and Yanofsky 1990). Furthermore, translation of tnaC codon
12 by tRNATrp, rather than suppressor tRNAs, is required for induction
432
R. Landick and C.L. Turnbough, Jr.
-Trp"~""""""""""------
or tnaC(Met 1~UAG)
or tnaC(Trp 12~Stop or Arg)
_____~
+Trp_
..............~~..~......t..~
or frameshift that extends tnaC beyond rut
1--50 bp
I
Ina
r
---I
+1 RNA
promoter
I
boxA
gl!UiJ
maC
'A"
,
---------t--1
'"
'"
C
B C---·D·--- ___ ~
Ina
..........
·MetAsnIleLeuHisIleCysValThrSerLysTrpPheAsnIleAspAsn
ATGAATATCTTACATATATGTGTGACCTCAAAATGGTTCAATATTGACAAC
F
'"
+25
.
A
LysIleValAspHlsArgProEnd ~
AAAATTGTCGATCACCGCCCTTGATTfGCCCTTCTGTAGCCATCACCAGAG
boxA
rut
Figure 7 Attenuation control region in the E. coli tryptophanase (tna) operon.
Vertical arrows indicate positions at which pausing (A-F) or p-dependent
termination (B-F) were detected during in vitro transcription (Stewart et al.
1986). Horizontal arrows indicate the approximate extent of transcription with
the conditions or mutations indicated.
(Gollnick and Ya,nofsky 1990). In contrast, several mutations that disrupt
a boxA-like element in the tna leader region (Fig. 7) cause partially constitutive expression (Stewart and Yanofsky 1985). Finally, deletion of an
apparent p-utilization sequence (rut site; Fig. 7) located immediately
downstream from tnaC, as well as tnaC frameshift mutations that cause
translation past the rut site, result in constitutive expression.
These results suggest that attenuation in the tna leader region might
involve repositioning of the ribosome translating tnaC, in a process
somehow dependent on translation of tnaC codon 12 by tRNATrp, to prevent binding of p to the nascent transcript. However, frameshifting by a
ribosome translating tnaC has not been detected with out-of-frame gene
fusions joining the first 21 codons of tnaC to lacZ (Gollnick and
Yanofsky 1990). In addition, although induction is blocked by the miaA
mutation, which prevents isopentenylation of tRNA Trp and slows
ribosome movement over tryptophan codons, regulatory models that involve effects on tRNA charging or utilization seem inviable, as induction
occurs over a range of tryptophan concentrations far above the Km for
tryptophanyl-tRNA synthetase, and tryptophan analogs such as 5-methyl
tryptophan, which are very poor substrates for the synthetase, are efficient inducers.
Recently, Yanofsky and co-workers have found evidence for a limiting, trans-acting factor required for the tryptophan-mediated relief of pdependent termination (c. Yanofsky, pers. comm.). A multicopy plasmid
carry
toph'
Furtt
that
Stud
rave
ATTE
Witl
con1
tion
Reg
of t
pre1
sen
vin
the
dea
19~
Ka
the
sin
SCI
is
sc:
eu
or
is
(I
1(
C(
a1
1
b
V
t1
n
t
Transcriptional Attenuation
carrying the tna promoter-leader region prevents in~uct~on of tryptophanase, but only when the pl.asmid-borne lea?er regIOn IS translated.
Furthermore, trans-acting mutations that are u?hnked to tna ~r rh~ ~nd
that prevent induction of tna operon expressIOn have been Identified.
Studies currently under way that exploit these findings should help unravel this apparently complex mechanism of attenuation control.
beyond rut
;t--.t--_
t
YSTrpPheAS;~{~~PASn
433
1F
AATGGTTCAATATTGACAAC
TTCTGTAGCCATCACCAGAG
rur
:. coli tryptophanase (tna) operon.
I pausing (A-F) or p-dependent
vitro transcription (Stewart et al.
:imate extent of transcription with
t, several mutations that disrupt
on (Fig. 7) cause partially cony 1985). Finally, deletion of an
; Fig. 7) located immediately
frameshift mutations that cause
itutive expression.
in the tna leader region might
~ranslating tnaC, in a process
-; codon 12 by tRNATrp, to pret. However, frameshifting by a
etected with out-of-frame gene
tnaC to lacZ (Gollnick and
:Iuction is blocked by the miaA
tion of tRNATrp and slows
ons, regulatory models that inion seem inviable, as induction
ntrations far above the Km for
phan analogs such as 5-methyl
es for the synthetase, are effilve found evidence for a limityptophan-mediated relief of p. comm.). A multi copy plasmid
ATTENUATION IN EUKARYOTES
With our current knowledge of the many different types of attenuation
control in prokaryotes, it would be surprising if transcriptional attenuation were not employed as a genetic regulatory mechanism in eukaryotes.
Regulatory-factor-dependent attenuation has been described in the case
of the viral RNA polymerase from vaccinia virus (Moss 1990). To date,
premature termination (or arrest) has been reported. to occur during transcription by RNA polymerase II of SV40, adenOVIrUs type 2, polyomavirus, human immunodeficiency virus (HIV), minute virus of mice, and
the c-myc, L-myc, N-myc, c-myb, c-erbB, c-fos, c-mos, and adenosine
deaminase genes from humans, mice, or rats (Spencer and Groudine
1990 and references therein; Haley and Waterfield 1991; Kerppola and
Kane 1991 and references therein; Xu et a1. 1991). However, in none of
these cases has it been established that true termination, rather than
simple arrest or pausing, is responsible for the observed block to transcriptional elongation, nor in some cases has it been shown that the block
is regulated by a metabolic or developmental signal, a hallmark of transcriptional attenuation in bacteria.
The most complete description of regulated transcript elongation in
eukaryotes comes from studies of the murine and human c-myc protooncogenes, where nuclear run-on assays showed that the first c-myc exon
is transcribed at an approximately tenfold higher rate than exons 2 and 3
(Bentley and Groudine 1986; Eick and Bornkamm 1986; Mechti et a1.
1986; Nepveu and Marcu 1986). In the human promyelocytic leukemia
cell line HL60 (Bentley and Groudine 1986; Eick and Bornkamm 1986)
and a mouse erythroleukemia cell line (Mechti et a1. 1986; Nepveu et a1.
1987), the block to elongation is not apparent during proliferative growth
but becomes significant when the cells are triggered to differentiate.
When the human c-myc gene was injected into oocytes, several c-myc
transcripts were observed, the most prominent of which had 3' ends that
mapped to two T-rich sequences preceding and following the junction
between exon 1 and intron 1 (Tl and T2, Fig. 8). Interestingly, many
somatic mutations are found within this region of the c-myc genes from
some Burkitt's lymphomas, where expression of c-myc is elevated and
434
R. Landick and C.L. Turnbough, Jr.
+l~A
, c-myc P1 ,,,. , c-myc P2
1-100 bp-t
L __________eX~~_l______
- - - --
.
350
T1
~j~tron
1%/.ff~
T2
---______
~
I
.
.
-
__ _
GCTGCCAGGACACCGCTTCTCTGAAAGGCTCTCCTTGCAGCTGCTTAGACGCTGGAI I I ITTTCGGGTAGTGG
.
400
I
.
.
.
.
T1
450
I
AAAACCAGGTAAGCACCGAAGTCCACTTGCCTTTTAATTTATTTTTTTATCACTTTAATGCTGAGATGAGTCG
exon~tron 1
T2
Figure 8 Major transcriptional stop sites in the human c-myc gene. T1 and T2
refer to the transcriptional stop sites mapped by Bentley and Groudine (1988).
tiO,
act
(M
the
CO
(SI
Bl
lyl
rel
BI
tic
the transcriptional block is alleviated (Cesarman et al. 1987). These findings, together with the proposal that alternative RNA secondary structures might form preceding site T1, suggested an attenuation mechanism
involving an RNA-based transcriptional termination signal similar to the
bacterial paradigm (Eick and Bornkamm 1986; Bentley and Groudine
1988).
However, other results are inconsistent with this simple model. First,
although purified calf thymus RNA polymerase terminates at the T2 site
of c-myc, termination is unchanged under conditions in which the RNA
transcript remains hybridized to the DNA template, thus precluding
formation of RNA secondary structures (Kerppola and Kane 1988). Second, although fragments of the human and murine c-myc genes bearing
the ex on 1/intron 1 junction produce a transcriptional block when introduced downstream from either the herpes TK or human a-globin
promoters, comparable DNA fragments have no effect when placed
downstream from the SV40 early or the MHC H-2'''· promoters (Miller et
al. 1989; Wright and Bishop 1989). With the adenovirus major late
promoter, stopping is not observed when T2 is positioned 500 bp after
the initiation site (Bentley and Groudine 1988) but does occur when it is
placed closer (Roberts and Bentley 1992); thus, the distance between the
stop site and the promoter or properties of the intervening transcript may
be important. Furthermore, it is important to note that transcripts ending
at T1 and T2 have been detected only in vitro and in oocytes. Results of
nuclear run-on assays using tissue culture cells indicate only that transcription stops somewhere after initiation and before or early in intron 1.
Thus, it is possible that although T1 or T2 sequences can stop RNA
polymerase II transcription under certain conditions, they are neither
necessary nor sufficient for control of transcriptional elongation in c-myc
in vivo.
Recent work on the human and murine c-myc genes suggests that sequences in or near the P2 promoter (Fig. 8) affect the block to transcrip-
sc
sil
et
ac
til
A
tt
5(
CI
tl
n
tl
f
c
Transcriptional Attenuation
T1
W7/jntron 1W0'l~
T2
----- ________ _
GCTTAGACGCTGGAI I I I l'rTCG~~~AGTT1
GG
•
450
I
rTTTTTATCACTTTAATGCTGAGATGAGTCG
Ie human c-myc gene. Tl and T2
, Bentley and Groudine (1988).
lrman et al. 1987). These find"native RNA secondary struc;ted an attenuation mechanism
rmination signal similar to the
1986; Bentley and Groudine
with this simple model. First,
erase terminates at the T2 site
conditions in which the RNA
rA template, thus precluding
:erppola and Kane 1988). Sec:I murine c-myc genes bearing
nscriptional block when intropes TK or human a-globin
have no effect when placed
HC H-2K promoters (Miller et
th the adenovirus major late
T2 is positioned 500 bp after
~88) but does occur when it is
thus, the distance between the
the intervening transcript may
to note that transcripts ending
itro and in oocytes. Results of
cells indicate only that trannd before or early in intron 1.
T2 sequences can stop RNA
conditions, they are neither
criptional elongation in c-myc
c-myc genes suggests that se) affect the block to transcrip-
435
tion near the exonllintronl junction. Inclusion of the P2 promoter region
activates the transcriptional block in MHC H-2K -murine c-myc fusions
(Miller et al. 1989). In the human c-myc gene, selective inactivation of
the P1 or P2 promoters by small deletions revealed that transcription
complexes that initiate at P2 stop more efficiently in the Tl-T2 region
(Spencer et al. 1990). Furthermore, when the mutant c-myc alleles from
Burkitt's lymphomas described above were transfected into murine
lymphoid cells and monitored when differentiation was induced, normal
regulation was observed. Readthrough of the Tl-T2 region in the
Burkitt's lymphoma cells correlates with a shift in initiation of transcription from P2 to PI (Spencer et al. 1990). The apparent increase in transcripts initiating at PI may occur because a previously undetected stop
site between PI and P2 becomes abrogated in transformed cells (Wright
et al. 1991).
Control of transcript elongation in c-myc may thus involve two cisacting elements: a site or sites with an intrinsic tendency to block elongation and an element in or near the promoter that can potentiate the block.
At least two models are consistent with the available data. It is possible
that a trans-acting factor binds in the Tl-T2 region and controls transcriptional elongation. Conceivably, a promoter-region element might
contribute to the binding of such a factor; if so, then promoters such as
the a-globin and herpes TK promoters must contain sequences that can
replace the c-myc promoter element. Alternatively, the composition of
transcription complexes assembled at or modified shortly downstream
from particular promoters may differ in ways that affect elongation.
There are several possible modifications that could account for such
differences in transcription complexes. At P2-like promoters, a factor
that normally overrides stop signals could be omitted. This factor must
be present in excess in HeLa nuclear extracts, since only readthrough
transcription is observed in the absence of inhibitors such as sarkosyl or
KCI (London et al. 1991). Several candidates for such a factor are
known. Transcription factors lIS, IIF, and IIX all have been found to increase elongation by RNA polymerase in vitro (SivaRaman et al. 1990;
Bengal et al. 1991; Wiest et al. 1992). Omission of one of these, or an
undiscovered factor, from the transcription complex during assembly
might regulate transcription in c-myc much as the A Nand Q proteins act
at the nut and qut sites to control transcription antitermination in A (see
Greenblatt; Roberts; both this volume). Alternatively, inclusion at P2like promoters of a factor analogous to the Nun protein of phage HK022
(Robledo et al. 1990) could predispose the transcription complex to pausing or termination. Finally, modification of RNA polymerase itself by
phosphorylation of the carboxy-terminal heptapeptide repeat appears to
436
R. Landick and C.L. Turnbough, Jr.
accompany the transition from initiation to elongation (Payne et al.
1989), leading Spencer and Groudine (1990) to suggest that different degrees (or sites) of phosphorylation could occur at different promoters and
under different cellular conditions so that the propensity for transcrip_
tional elongation is modulated.
Several important questions remain to be answered about the control
of transcript elongation in c-myc and other genes. Is the apparent block to
transcription a true termination event, with concomitant release of the
transcript and RNA polymerase from the DNA template? Is it a processing event that results in unstable transcription past the site much as
cleavage of the transcript at a polyadenylation site destabilizes the
elongation complex, or does it result from strong transcriptional pausing
or arrest? What trans-acting factors regulate the process, and do they act
at a specific site, making the control mechanism analogous to attenuation
in prokaryotes? Do they affect elongation at many sites on the template,
making it more akin to antitermination? In addition to continued analysis
of these phenomena in mammalian cells and in oocytes, two experimental directions deserve exploration. First, if the block to transcription occurs when appropriate sequences and genes are placed in yeast, then a
genetic analysis 9f the process will become possible. Second, an in vitro
transcription system that faithfully recapitulates the promoter-elementdependence of elongation control in c-myc would allow both biochemical
identification of the important factors and discrimination between pausing, termination, and processing.
CONCLUSIONS AND PERSPECTIVES
Why Attenuation Control?
An often-asked question about transcriptional attenuation is why
regulatory mechanisms would evolve that require the synthesis of apparently nonfunctional transcripts and, in some cases, polypeptides. The expenditure of energy for the synthesis of these macromolecules seemingly
would impair the cell's ability to grow optimally, which would be particularly deleterious for bacteria that must survive in a highly competitive
environment. One answer is that transcriptional attenuation, in some
cases, actually is the most efficient control mechanism available. All
regulatory decisions require information and therefore, of thermodynamic necessity, require the expenditure of energy. The energetic cost
for regulation by attenuation may well be less than that of controls on
transcriptional initiation that require the synthesis of trans-acting repressor and activator proteins, particularly in situations where the regulatory
deci
tran:
bios
coul
the
dire
in n
olis
this
ic 2
the
ref]
cia
Atl
Na
01
sc
pc
ar
0(
pI
in
al
'R
e
Transcriptional Attenuation
ion to elongation (Payne
9
et al
90) to suggest that different d .
I occur at different promote
ers and
hat the propensity for transc .
npto be answered about the Control
er. genes. Is the apparent block to
wIth concomitant release of the
e ~N~ template? Is it a process_
scnptIon past the site much
deny I
··
as
atIon SIte destabilizes the
1m strong transcriptional pausing
date. the process, and do they act
;hamsm analogous to attenuation
m at ~a.ny sites on the template,
In ad~ItlOn to continued analysis
; ~nd III oocytes, two experimen_
If the block to transcription oc.enes are placed in yeast, then a
Ime possible. Second, an in vitro
Lpitulates the promoter-element_
vc would allow both biochemical
ld discrimination between paus-
,criptional attenuation is why
Lt require the synthesis of apparIme cases, polypeptides. The exh:se macromolecules seemingly
JtImally, which would be particsurvive in a highly competitive
criptional attenuation, in some
I1trol mechanism available. All
)n and therefore, of thermore of energy. The energetic cost
Je less than that of controls on
,ynthesis of trans-acting repressituations where the regulatory
437
deCISIon requires information about the state of the transcriptional or
translational machinery (such as regulation of amino acid or pyrimidine
biosynthetic operon expression). Here, attenuation control can be
coupled directly to metabolic activities dependent on the end product of
the regulated genes without requiring a separate sensor protein. This
direct coupling also may provide enhanced sensitivity to small changes
in metabolic activity as well as a means for rapidly adjusting this metabolism in response to the needs of the cell. It is tempting to speculate that
this efficient control mechanism arose early in the evolution of the genetic apparatus, perhaps in an "RNA world" before regulatory proteins and
their interactive sites made their appearance. Present-day examples may
reflect the adaptation of this primitive regulatory circuit to several specialized uses.
Attenuation Control Uses Information in the
Nascent RNA Transcript
One clear advantage of deferring the regulatory decision until after transcriptional initiation is that the nascent transcript can be used as a component of the control mechanism. The ability of RNA to form complex
and competing structures allows it to specify information in ways that are
not readily achieved by duplex DNA. Thus, even where trans-acting
proteins participate in attenuation control, they bind an RNA target and
influence the conformation of the nascent transcript. Such mechanisms
also may occur in eukaryotes: Binding of the HIV Tat protein to the
RNA hairpin TAR element has been reported to influence transcript
elongation (Kao et al. 1987).
The advantage of RNA as a regulatory target may account for the
striking absence of attenuation control mechanisms mediated by DNAbinding proteins. Such mechanisms clearly are possible. In prokaryotes,
both the lac repressor (Deuschle et al. 1986) and an EcoRI endonuclease
mutant defective in cleavage (Pavco and Steege 1990), when bound to
DNA, can block transcriptional elongation, and, in eukaryotes, both
DNA-bound lac repressor (Deuschle et al. 1990) and proteins bound to
the CCAAT promoter element (Connelly and Manley 1989) have been
shown to block elongation. Nonetheless, there are no established examples of physiologically important control of elongation by a DNAbinding protein. Perhaps such mechanisms have not been favored during
evolution because they indeed would waste energy required for RNA
synthesis and offer no advantage over regulation of transcriptional initiation.
438
R. Landick and C.L. Turnbough, Jr.
Future Prospects
In considering what directions future research on transcriptional attenua_
tion may take, we are struck by several key issues. First, despite all the
evidence that RNA secondary structures function during transcription as
pause signals, termination signals, and targets for regulatory factors, to
date no systematic mutagenesis of an RNA hairpin involved in attenua_
tion in prokaryotes has been reported. Such analyses are long overdue
and will be required to resolve important remaining questions. For example, exactly what are the requirements for stable RNA structures to form
in a nascent transcript? Are the mismatched regions in some RNA hairpins important? What are the rates of RNA hairpin formation relative to
the rates of transcription and translation? Do the sequences of certain
loop regions affect the stability or rate of formation of hairpins? A complete understanding of transcriptional attenuation will require that we
answer these questions. With the development of methods for synthesis
of large amounts of any given RNA, it now is possible to determine
directly the stability and rate of formation of systematically altered RNA
secondary structures.
Second, although models for transcriptional pausing and termination
have found their way into current textbooks, in truth, we are remarkably
f
ignorant about the mechanisms that underlie these phenomena. Currently, the configuration of the RNA transcript within the transcription complex and the effects of RNA hairpin formation are subjects of intense
debate (Reynolds et al. 1992 and references therein; von Hippel and
Yager 1992). Understanding attenuation control requires first understanding these mechanisms. We anticipate that, in the coming decade, the
combined results from ongoing mutational studies on RNA polymerase;
the dissection of interactions between polymerase, the nascent transcript,
and the DNA template by approaches such as RNA-polymerase crosslinking and chemical probing; and direct analysis of RNA polymerase
structure (see Kornberg et aI., this volume) will resolve these current
controversies.
Finally, we are left to wonder what types of attenuation control
remain to be discovered. Given that attenuation control mechanisms have
evolved to use the information uniquely contained in the nascent RNA
transcript and the demands for energetic efficiency in bacteria, we expect
that many additional examples will emerge as the study of gene regulation in a variety of bacterial species progresses. Our present inability to
explain the complicated mechanism that regulates tryptophanase operon
expression shows that we have yet to fully appreciate the possible ways
attenuation control can be accomplished. If attenuation was an early invention during evolution, important advances could come from a better
know I
thO ug1
Hi
tional
sugge
proka
tion il
elong
activ(
semb
scrip1
Oshe
to reI
seqw
KraiJ
tiona
et al
term
(Mal
the'
stru<
tribt
bet~
will
in e1
sur~
the
ACt<
We
We
Wr
and
REI
Am
a'
An,
c
Ar1
Q
Transcriptional Attenuation
:h.
on transcriptional
att enua_
.
Issues. FIrst, despite all h
d .
t e
t·
CIon
unng transcriptl· On as
:!ts .for. regulatory
fact ors, to
.
h alrpm mvolved in att
enua1 analyses are long ov d
. .
er ue
lamIng questions. For exam_
ible RNA structures to £;
..
onn
regIOns
.
. . In some RNA halrhalrpm formation relative to
)0 the sequences of cert .
.
run
·matron of hairpins? A Comuation will require that We
~nt of
methods for synthes·IS
•
IW IS possible to determine
systematically altered RNA
nal pausing and termination
in truth, we are remarkably
these phenomena. Currentrithin the transcription comtion are subjects of intense
;s therein; von Hippel and
)ntrol requires first underIt, i.n the coming decade, the
tudles on RNA polymerase;
;rase, the nascent transcript,
as RNA-polymerase crosslalysis of RNA polymerase
, will resolve these current
pes of attenuation control
m control mechanisms have
tained in the nascent RNA
:ency in bacteria, we expect
s the study of gene regulaes. Our present inability to
lates tryptophanase operon
Ipreciate the possible ways
ttenuation was an early incould come from a better
439
knowledge of gene regulation in archaebacteria, the third kingdom
thought to be most similar to early life forms.
H is less clear what the existing data predict for control of transcriptional elongation in eukaryotes. However, one fascinating possibility is
suggested by the parallels between the eukaryotic spliceosome and the
prokaryotic ribosome. If translation is coupled to and regulates transcription in bacteria, might a similar relationship exist between transcriptional
elongation and splicing in eukaryotes? Electron microscopy studies of
actively transcribed Drosophila chromatin suggest that spliceosomes assemble rapidly on the nascent RNA and, on occasion, splice the transcript prior to its release from the transcription complex (Beyer and
Osheim 1988). In many cases, additional RNA-binding proteins appear
to regulate alternative mRNA splicing (Maniatis 1991). Furthermore, the
sequence of one of these factors from humans (ASF/SF2; Ge et al. 1991;
Krainer et al. 1991) is similar to a protein that accumulates in transcriptionally active regions of Drosophila polytene chromosomes (Champlin
et aJ. 1991). There also is evidence that snRNPs may be involved in
termination of RNA polymerase III transcripts and histone mRNAs
(Manley et aJ. 1989). It is tempting to speculate that coupling between
the movement of RNA polymerase, the formation of RNA secondary
structure, and the binding of snRNPs or regulatory proteins might contribute both to control of transcriptional elongation and to the decision
between alternative mRNA splicing patterns. Detection of such effects
will require advances in techniques to analyze transcriptional elongation
in eukaryotes. In any event, it seems likely that we have not seen the last
surprise from investigations into the role of transcriptional attenuation in
the regulation of gene expression.
7
ACKNOWLEDGMENTS
We thank Joe Calvo, Don Court, Martin Freundlich, Mark Groudine,
Wes Hatfield, Caroline Kane, Robert Switzer, Edwin Umbarger, Andrew
Wright, and Charles Yanofsky for helpful comments on the manuscript
and for discussion of results prior to publication.
REFERENCES
Amster-Choder, O. and A. Wright. 1990. Regulation of activity of a transcriptional
antiterminator in E. coli by phosphorylation in vivo. Science 249: 540-542.
Andersen, J.T., K.F. Jensen, and P. Poulsen. 1991. Role of transcription pausing in the
control of the pyrE attenuator in Escherichia coli. Mol. Microbiol. 5: 327-333.
Artz, S.W. and D. Holzschu. 1983. Histidine biosynthesis and its regulation. In Amino
acids: biosynthesis and genetic regulation (ed. K.M. Herrmann and R.L. Somerville),
440
R. Landick and C.l. Turnbough, Jr.
pp. 379-404. Addison-Wesley, Reading, Massachusetts.
Bartkus, J.M., B. Tyler, and J.M. Calvo. 1991. Transcription attenuation-mediated
.
Control
of leu operon expreSSIOn: Influence of the number of Leu control codons.l. Bacter'
173: 1634-1641.
101.
bloC
Donat
fron
Bauer, C.E., J. Carey, L.M. Kasper, S.P. Lynn, and J.F. Gardner. 1983. Attenuation'
bacterial operons. In Gene function in prokaryotes (ed. J.Beckwith, et al.), pp. 65_8~n
Cold Spring Harbor Laboratory, Cold Spring Harbor, New York.
.
Bengal, E., O. Flores, A Krauskopf, D. Reinberg, and Y. Aloni. 1991. Role of the rna _
malian transcription factors IIF, lIS, and IIX during elongation by RNA polymerase ~
Mol. Cell. BioI. 11: 1195-1206.
.
Bentley, D.L. and M. Groudine. 1986. A block to elongation is largely responsible for
decreased transcription of c-myc in differentiated HL60 cells. Nature 321: 702-706.
- - - . 1988. Sequence requirements for premature termination of transcription in the
human c-myc gene. Cell 53: 245-256.
Beyer, AL. and Y.N. Osheim. 1988. Splice site selection, rate of splicing, and alternative
splicing on nascent transcripts. Genes Dev. 2: 754-765.
Bonekamp, F., K Clemmesen, O. KarIstriim, and KF. Jensen. 1984. Mechanism of UTPmodulated attenuation at the pyrE gene of Escherichia coli: An example of operon
polarity control through the coupling of translation to transcription. EMBO 1. 3:
2857-2861.
Carter, P.W., D.L. Weiss, H.L. Weith, and J.M. Calvo. 1985. Mutations that convert the
four leucine residues of the Salmonella typhimurium leu leader to four threonine
codons.l.Bacteriol. 162: 943-949.
Cesarman, E., R. Dalla-Favera, D. Bentley, and M. Groudine. 1987. Mutations in the first
exon are associated with altered transcription of c-myc in Burkitt lymphoma. Science
238: 1272-1275.
Champlin, D.T., M. Frasch, H. Saumweber, and J.T. Lis. 1991. Characterization of a
Drosophila protein associated with boundaries of transcriptionally active chromatin.
Genes Dev. 5: 1611-1621.
Chan, c.L. and R. Landick. 1989. The Salmonella typhimurium his operon leader region
contains an RNA hairpin-dependent transcription pause site. 1. BioI. Chem. 264:
20796-20804.
Chen, J.-W., E. Harms, and H.E. Umbarger. 1991. Mutations replacing the leucine
codons or altering the length of the amino acid-coding portion of the ilvGMEDA leader
region of Escherichia coli. 1. Bacteriol. 173: 2341-2353.
Clemmesen, K., F. Bonekamp, O. KarIstriim, and KF. Jensen. 1985. Role of translation
in the UTP-modulated attenuation at the pyrBI operon of Escherichia coli. Mol. Gen.
Genet. 201: 247-251.
Connelly, S. and J.L. Manley. 1989. RNA polymerase II transcription termination is
mediated specifically by protein binding to a CCAA T box sequence. Mol. Cell. Bioi. 9:
5254-5259.
Crutz, A-M., M. Steinmetz, S. Aymerich, R. Richter, and D. Le Coq. 1990. Induction of
levansucrase in Bacillus subtilis: An antitermination mechanism negatively controlled
by the phosphotransferase system. 1. Bacteriol. 172: 1043-1050.
DebarbouiIIe, M., M. Arnaud, A. Fouet, A Klier, and G. Rapoport. 1990. The sacT gene
regulating the sa cPA operon in Bacillus subtilis shares strong homology with transcriptional antiterminators. 1. Bacteriol. 172: 3966-3973.
Deuschle, U., R. Gentz, and H. Bujard. 1986. lac repressor blocks transcribing RNA
polymerase and terminates transcription. Proc. Natl. Acad. Sci. 83: 4134-4137.
Deuschle, U., R.A Hipskind, and H. Bujard. 1990. RNA polymerase II transcription
Ebbo i
Bac
Bio
Eick,
cor
Farnl
cal
56:
Fishl
265
le~
N~
Ge,
A:
Gol!
ot
3'
Gol
is
Sl
Gn
a
Gu
c
Ha
H(
H
JI
Transcriptional Attenuation
:husetts.
nscription attenuation-med'
lated COnt I
ler of Leu control codons J B
ro
. . acteriol.
md J.F. Gardner. 1983 Att
.
enuatlOn .
.
tes (ed. J.Beckwith et al)
In
,
. , pp 65 89
rbor, New York.
. - .
and Y. Aloni. 1991. Role of th
.
e mam
mg elongation by RNA polym
erase II.
) elongation is largely respo 'bl
nSI e for
HL60 cells. Nature 321: 702-706
ure termination of transcriptio .'
n In the
ection, rate of splicing, and altern .
alIve
~-765.
~.F. Jensen. 1984. Mechanism of UTp_
he~ichia coli: An example of operon
.JatlOn to transcription. EMBQ J. 3:
alvo. 1985. Mutations that convert th
.
I
e
nurlUm eu leader to four threonine
Groudine. 1987. Mutations in the first
c-myc in Burkitt lymphoma. Science
J.T. Lis. 1991. Characterization of a
of transcriptionally active chromatin.
typhimurium his operon leader region
on pause site. 1. Bioi. Chem. 264:
91. Mutations replacing the leucine
Iding portion of the ilvGMEDA leader
-2353.
C.F. Jensen. 1985. Role of translation
peron of Escherichia coli. Mol. Gen.
lerase II transcription termination is
AT box sequence. Mol. Cell. BioI. 9:
r, and D. Le Coq. 1990. Induction of
on mechanism negatively controlled
~: 1043-1050.
d G. Rapoport. 1990. The sacT gene
ares strong homology with transcrip3.
repressor blocks transcribing RNA
'. Acad. Sci. 83: 4134-4137.
I. RNA polymerase II transcription
441
blocked by Escherichia coli lac repressor. Science 248: 480-483.
Donahue, J.P. and c.L. Turnbough, Jr. 1990. Characterization of transcriptional initiation
from promoters P J and P2 of the pyrB! operon of Escherichia coli K12. J. BioI. Chem.
265: 19091-19099.
Ebbol e , D.J. and H. Zalkin. 1987. Cloning and characterizati~n of a 12-g.ene cluster ~rom
Bacillus subtilis encoding nine enzymes for de novo purme nucleotIde syntheSIS. 1.
BioI. Chem. 262: 8274-8287.
Eick, D. and G.W. Bornkamm. 1986. Transcriptional arrest within the first exon is a fast
control mechanism in c-myc gene expression. Nucleic Acids Res. 14: 8331-8346.
Farnham, P.J. and T. Platt. 1981. Rho-independent termination: Dyad symmetry in DNA
causes RNA polymerase to pause during transcription in vitro. Nucleic Acids Res. 9:
563-577.
Fisher, R. and C. Yanofsky. 1984. Use of complementary DNA oligomers to probe trp
leader transcript secondary structures involved in transcription pausing and termination.
Nucleic Acids Res. 12: 3295-3302.
Ge, H., P. Zuo, and J.L. Manley. 1991. Primary structure of the human splicing factor
ASF reveals similarities with Drosophila regulators. Cell 66: 373-382.
Gollnick, P. and C. YanOfsky. 1990. tRNATrp translation of leader peptide codon 12 and
other factors that regulate expression of the tryptophanase operon. 1. Bacteriol. 172:
3100-3107.
Gollnick, P., S. Ishino, M.l. Kuroda, D.J. Henner, and C. Yanofsky. 1990. The mtr locus
is a two-gene operon required for transcription attenuation in the trp operon of Bacillus
subtilis. Proc. Natl. Acad. Sci. 87: 8726-8730.
Grundstrom, T. a~d S. Normark. 1985. Initiation of translation makes attenuation of
ampC in E. coli dependent on growth rate. Mol. Gen. Genet. 198: 41/-415.
Gutman, G.A. and G.W. Hatfield. 1989. Nonrandom utilization of codon pairs in Escherichia coli. Proc. Natl. Acad. Sci. 86: 3699-3703.
Haley, J.D. and M.D. Waterfield. 1991. Contributory effects of de novo transcription and
premature transcript termination in the regulation of human epidermal growth factor
receptor proto-oncogene RNA synthesis. 1. Bioi. Chem. 26: 1746-1753.
Houman, F., M.R. Diaz-Torres, and A. Wright. 1990. Transcriptional antitermination in
the bgl operon of E. coli is modulated by a specific RNA binding protein. Cell 62:
1153-1163.
Hsu, J.-H., E. Harms, and H.E. Umbarger. 1985. Leucine regulation of the ilvGEDA
operon of Serratia marcescens by attenuation is modulated by a single leucine codon.
1. Bacteriol. 164: 217-222.
Jaurin, B., T. Grundstrom, T. Edlund, and S. Normark. 1981. The E. coli ~-Iactamase attenuator mediates growth rate-dependent regulation. Nature 290: 221-225.
Jensen, K.F. 1979. Apparent involvement of purines in the control of expression of Salmonella typhimurium pyr genes: Analysis of a leaky guaB mutant resistant to
pyrimidine analogs. 1. Bacteriol. 138: 731-738.
- - - . 1988. Hyper-regulation of pyr gene expression in Escherichia coli cells with
slow ribosomes. Evidence for RNA polymerase pausing in vivo? Eur. 1. Biochem. 175:
587-593.
Jensen, K.F., R. Fast, O. Karlstrom, and J.N. Larsen. 1986. Association of RNA
polymerase having increased Km for ATP and UTP with hyperexpression of the pyrB
and pyrE genes of Salmonella typhimurium. 1. Bacteriol. 166: 857-865.
Johnston, H.M. and J.R. Roth. 1981. DNA sequence changes of mutations altering attenuation control of the histidine operon of Salmonella typhimurium. 1. Mol. BioI. 145:
735-756.
442
R. Landick and C.L. Turnbough, Jr.
Johnston, H.M., W. M. Barnes, F.G. Chumley, L. Bossi, and J.R. Roth. 1980. Mod
regulation of the histidine operon of Salmonella. Proc. Natl. Acad. Sci. 77: 508_51e~ for
Kang, C. and C.R. Cantor. 1985. Structure of ribosome-bound messenger RNA'
revealed by enzymatic accessibility studies. 1. Mol. BioI. 181: 241-251.
as
Kao, S.-Y., AF. CaIman, P.A Luciw, and B.M. Peterlin. 1987. Anti-termination f
..
' I repeat 0 f HIV - 1 b y tat gene product. Nature
0 transCrIptIOn
wIt. h'm th
e ongI
termma
330'
489-493.
.
Kerppola, T.K. and C.M. Kane. 1988. Intrinsic sites of transcription termination a d
pausing in the c-myc gene. Mol. Cell. BioI. 8: 4389-4394.
n
- - - . 1991. RNA polymerase: Regulation of transcript elongation and termination.
FASEB 1.5: 2833-2842.
Kolter, R. and C. Yanofsky. 1982. Attenuation in amino acid biosynthetic operons. Annu.
Rev. Genet. 16: 113-134.
- - - . 1984. Genetic analysis of the tryptophan operon regulatory region using sitedirected mutagenesis. 1. Mol. Bioi. 175: 299-312.
Krainer, A., R.A. Mayeda, D. Kozak, and G. Binns. 1991. Functional expression of
cloned human splicing factor SF2: Homology to RNA-binding proteins, Ul 70K, and
Drosophila splicing regulators. Cell 66: 383-394.
Kuroda, M.I. and C. Yanofsky. 1984. Evidence for the transcript secondary structures
predicted to regulate transcription attenuation in the trp operon. 1. Bioi. Chem. 259:
12838-12843.
Kwak, J.-H., E.-C. Choi, and B. Weisblum. 1991. Transcriptional attenuation control of
ermK, a macrolide-Iincosamide-streptogramin B resistance determinant from Bacillus
licheniformis.l. Bq.cteriol. 173: 4725-4735.
Landick, R. 1984. R~gulation of LIV-I transport system gene expression. In Microbiology 1984 (ed. L. Leive and D. Schlessinger), pp. 71-74. American Society for Microbiology, Washington D.C.
Landick, R. and C. Yanofsky. 1984. Stability of an RNA secondary structure affects in
vitro transcription pausing in the trp operon leader region. 1. BioI. Chem. 259: 1155011555.
- - - . Transcription attenuation. In Escherichia coli and Salmonella typhimurium: Cellular and molecular biology (ed. F.C. Neidhardt et al.), pp. 1276-1301. American
Society for Microbiology, Washington, D.C.
- - - . 1987b. Isolation and structural analysis of the Escherichia coli trp leader paused
transcription complex. 1. Mol. Bioi. 196: 363-377.
Landick, R., J. Carey, and C. Yanofsky. 1987. Detection of transcription-pausing in vitro
in the trp operon leader region. Proc. Natl. Acad. Sci. 84: 1507-1511.
Landick, R., C. Yanofsky, K. Choo, and L. Phung. 1990. Replacement of the Escherichia
coli trp operon attenuation control codons alters operon expression. 1. Mol. BioI. 216:
25-37.
Lee, D.N. and R. Landick. 1992. Structure of RNA and DNA chains in paused transcription complexes containing Escherichia coli RNA polymerase. 1. Mol. BioI. (in press).
Lee, D.N., L. Phung, J. Stewart, and R. Landick. 1990. Transcription pausing by E. coli
RNA polymerase is modulated by downstream DNA sequences. 1. Bioi. Chem. 265:
15145-15153.
Levin, H.L., K. Park, and H.K. Schachman. 1989. Attenuation in the regulation of the
pyrBloperon in Escherichia coli. In vivo studies of transcriptional termination. 1. Bioi.
Chem. 264: 14638-14645.
Liu, C. and C.L. Turnbough, Jr. 1989. Multiple control mechanisms for pyrimidine-
rnt
17
Lonl
du
11
Lop
E:
4:
Lo~
8
Lyr
tl
tt
LYI
1
(
M:
M
M
M
Transcriptional Attenuation
ossi, and 1.R. Roth. 1980 M
".,
. ' odel fo
oc. Hatl. Acad. SCI. 77: 508-512 r
bosome-bound messenger RN .
Bioi. 181: 241-251.
A as
:rlin. 1987. Anti-terminatio
f
no tran_
1 by tat gene product. Nature 330:
es of transcription termination and
-4394.
mscript elongation and term' .
mallon.
ino acid biosynthetic operons A
. nnu.
'peron regulatory region using site~s. 1991. Functional expression
~NA-binding
f
proteins, VI 70K, a:d
the transcript secondary structures
he trp operon. J. BioI. Chem. 259:
'anscriptional attenuation control of
sistance determinant from BaCillus
tern gene expression. In Microbiol1-74. American Society for MicroRNA secondary structure affects in
region. J. BioI. Chem. 259: 11550-
and Salmonella typhimurium: Celet al.), pp. 1276-1301. American
: Escherichia coli trp leader paused
on of transcription-pausing in vitro
. 84: 1507-1511.
10. Replacement of the Escherichia
~ron expression. J. Mol. BioI. 216:
d DNA chains in paused transcriprmerase. J. Mol. BioI. (in press).
l. Transcription pausing by E. coli
A sequences. J. Bioi. Chem. 265:
ttenuation in the regulation of the
ranscriptional termination. J. Bioi.
Itrol mechanisms for pyrimidine-
443
mediated regulation of pyrBI operon expression in Escherichia coli K-12. J. Bacterial.
171: 3337-3342.
London, L., R. Keene, and R. Landick. 1991. Analysis of premature termination in c-myc
during transcription by RNA polymerase II in a HeLa nuclear extracts. Mol. Cell. BioI.
11: 4599-4615.
Lopilato, 1. and A. Wright. 1990. Mechanisms of activation of the cryptic bgl operon of
Escherichia coli K-12. In The bacterial chromosome (ed. K. Drlica and M. Riley), pp.
435-444. American Society for Microbiology, Washington, D. C.
Lovett, P.S. 1990. Translational attenuation as the regulator of inducible cat genes. J.
Bacterial. 172: 1-6.
Lynn, S.P., L.M. Kasper, and 1.F. Gardner. 1988. Contributions of RNA secondary structure and length of the thymidine tract to transcription termination at the thr operon attenuator. J. Bioi. Chem. 263: 472-479.
Lynn, S.P., W.S. Burton, T.1. Donohue, R.M. Gould, R.I. Gumport, and 1.F. Gardner.
1987. Specificity of the attenuation response of the threonine operon of Escherichia
coli is determined by the threonine and isoleucine codons in the leader transcript. J.
Mol. Bio1.194: 59-69.
Mahadevan, S. and A. Wright. 1987. A bacterial gene involved in transcription
antitermination: Regulation at a rho-independent terminator in the bgl operon of E. coli.
Cell 50: 485-494.
Maniatis, T. 1991. Mechanisms of alternative pre-mRNA splicing. Science 251: 33-34.
Manley, 1.L., N.l. Proudfoot, and T. Platt. 1989. RNA 3' -end formation. Genes Dev. 3:
2218-2222.
Matsumoto, Y., K.,shigesada, M. Hirano, and M. Imai. 1986. Autogenous regulation of
the gene for tran~cription termination factor rho in Escherichia coli: Localization and
function of its attenuators. J. Bacterial. 166: 945-958.
Mechti, N., M. Piechaczyk, 1.-M. Blanchard, L. Marty, A. Bonnieu, P. leanteur, and B.
Lebleu. 1986. Transcriptional and post-transcriptional regulation of c-myc expression
during the differentiation of murine erythroleukemia Friend cells. Nucleic Acids Res.
14: 9653-9666.
Michaels, G., R.A. Kelln, and F.E. Nargang. 1987. Cloning, nucleotide sequence and expression of the pyrBI operon of Salmonella typhimurium LT2. Eur. J. Biochem. 166:
55-61.
Miller, H., C. Asselin, D. Dufort, 1.-0. Yang, K. Gupta, K.B. Marcu, and A. Nepveu.
1989. A cis-acting element in the promoter region of the murine c-myc gene is necessary for transcriptional block. Mol. Cell. BioI. 9: 5340-5349 .
Moss, B. 1990. Regulation of vaccinia virus transcription. Annu. Rev. Biochem. 59: 661688.
Navre, M. and H.K. Schachman. 1983. Synthesis of aspartate transcarbamoylase in Escherichia coli; Transcriptional regulation of the pyrB-pyrI operon. Proc. Natl. Acad.
Sci. 80:1207-1211.
Nepveu, A. and K.B. Marcu. 1986. Intragenic pausing and anti-sense transcription within
the murine c-myc locus. EMBO J. 5: 2859-2865.
Nepveu, A., K.B. Marcu, A.I. Skoultchi, and H. Lachman. 1987. Contributions of transcriptional and post-transcriptional mechanisms to the regulation of c-myc expression
in mouse erythroleukemia cells. Genes Dev. 1: 938-945.
Neuhard, 1. and P. Nygaard. 1987. Purines and pyrimidines. In Escherichia coli and Salmonella typhimurium: Cellular and molecular biology (ed. F. C. Neidhardt et al.), pp.
445-473. American Society for Microbiology, Washington, D.C.
Novick, R.P., S. Iordanescu, S.l. Projan, 1. Kornblum, and I. Edelman. 1989. pT181 plas-
444
R. Landick and C.L. Turnbough, Jr.
mid replication is regulated by a countertranscript-driven transcriptional attenuator.
Cell 59: 395-404.
Ost, K.A. and M.P. Deutscher. 1991. Escherichia coli orfE (upstream of pyrE) encodes
RNase PH. J. Bacterial. 173: 5589-5591.
Oxender, D.L., G. Zurawski, and C. Yanofsky. 1979. Attenuation in the Escherichz'
I'
a co I
tryptophan operon: Role of RNA secondary structure involving the tryptophan cod
on
region. Proc. Natl. Acad. Sci. 76: 5524-5528.
Pavco, P.A. and D.A. Steege. 1990. Elongation by Escherichia coli RNA polymerase is
blocked in vitro by a site-specific DNA binding protein. J. Bioi. Chern. 265: 99609969.
Payne, J.M., PJ. Laybourn, and M.E. Dahmus. 1989. The transition of RNA polymerase
II from initiation to elongation is associated with phosphorylation of the carboxyl_
terminal domain of subunit IIa.J. BioI. Chern. 264: 19621-19629.
Pierard, A., N. G1andsdorff, D. Gigot, M. Crabeel, P. Halleux, and L. Thiry. 1976.
Repression of Escherichia coli carbamoylphosphate synthase: Relationships with enzyme synthesis in the arginine and pyrimidine pathways. J. Bacterial. 127: 291-30l.
Poulsen, P. and K.F. Jensen. 1987. Effect of UTP and GTP pools on attenuation at the
pyrE gene of Escherichia coli. Mol. Gen. Genet. 208: 152-158.
Poulsen, P., F. Bonekamp, and K.F. Jensen. 1984. Structure of the Escherichia coli pyrE
operon and control of pyrE expression by a UTP modulated intercistronic attenuation.
EMBOJ. 3: 1783-1790.
Quinn, C.L., B.T. Stephenson, and R.L. Switzer. 1991. Functional organization and
nucleotide sequenc.e of the Bacillus subtilis pyrimidine biosynthetic operon. J. Bioi.
Chern. 266: 9113-~127.
Reynolds, R., R.M. Bermudez-Cruz, and MJ. Chamberlin. 1992. Parameters affecting
transcription termination by Escherichia coli RNA polymerase. I. Analysis of 13 rhoindependent terminators. J. Mol. Bioi. 224: 31-51.
Roberts, S. and D. Bentley. 1992. Distinct modes of transcription read through or
terminate at the c-myc terminator. EMBO J. 11: 1085-1093.
Robledo, R., M.E. Gottesman, and R.A. Weisberg. 1990. Lambda nutR mutations convert
HK022 Nun protein from a transcription termination factor to a suppressor of termination. J. Mol. Bioi. 212: 635-643.
Roesser, J.R. and C. Yanofsky. 1988. Ribosome release modulates basal level expression
of the trp operon of Escherichia coli. J. BioI. Chern. 263: 14251-14255.
Roesser, J.R., Y. Nakamura, and C. Yanofsky. 1989. Regulation of basal level expression
of the tryptophan operon of Escherichia coli. J. BioI. Chern. 264: 12284-12288.
Roghani, A., R.l. Gumport, and J.F. Gardner. 1985. Site-directed mutagenesis in the
study of the molecular mechanism of attenuation in the threonine operon of Escherichia coli. UCLA Syrnp. Mol. Cell. BioI. 30: 553-564.
Roland, K.L., C. Liu, and c.L. Turnbough, Jr. 1988. Role of the ribosome in suppressing
transcriptional termination at the pyrBl attenuator of Escherichia coli K-12. Proc. Natl.
Acad. Sci. 85: 7149-7153.
Roland, K.L., F.E. Powell, and C.L. Turnbough, Jr. 1985. Role of translation and attenuation in the control of pyrBl operon expression in Escherichia coli K-12. J. Bacterial.
163: 991-999.
Roof, W.D., K.F. Foltermann, and J.R. Wild. 1982. The organization and regulation of
the pyrBl operon in E. coli includes a rho-independent attenuator sequence. Mol. Gen.
Genet. 187: 391-400.
Ryan, T. and MJ. Chamberlin. 1983. Transcription analyses with heteroduplex trp at-
tenU~
term
seh nel
seri~
Sehne
coli
tion
257
Sehw
typl
teTI
Shim
ser
8a
Siva
cit
sil
Spe
re
Spe
b
I~
Ste
(
Stt
St
S
1
Transcriptional Attenuation
iven transcriptional att
fE (upstream of pyrE)
enuator.
enCOdes
~nuation in the Escher' h'
•
nvolvmg the tryptoph
coli
an codon
lC La
'richia coli RNA polym
.
.
erase IS
In. J. BioI. Chem. 265: 9960_
~ transition of RNA poly
me rase
CJsphory lation of the carb
I
~1-19629.
oxy_
Halleux, and L. Thiry. 197
nthase: Relationships with e:~
J. Bacteriol. 127: 291-301.
TP pools on attenuation at th
2-158.
e
re of ~he E~cherichia coli pyrE
lated mterclstronic attenuation.
. Functional organization and
e biosynthetic operon. J. BioI.
in. 1992. Parameters affecting
'merase. I. Analysis of 13 rhotranscription read through or
193.
,ambda nutR mutations convert
;tor to a suppressor of term ina-
odulates basal level expression
14251-14255.
lation of basal level expression
~m. 264: 12284-12288.
e-directed mutagenesis in the
the threonine operon of Es-
)f the ribosome in suppressing
!erichia coli K-12. Proc. Natl.
,ole of translation and attenua'ichia coli K-12. J. Bacteriol.
rganization and regulation of
tenuator sequence. Mol. Gen.
;es with heteroduplex trp at-
445
tenuator templates indicate that the transcript stem and loop structure serves as the
termination signal. J. BioI. Chem. 258: 4690-4693.
schnetz, K and B. Rak. 1988. Regulation of the bgl operon of Escherichia coli by transcriptional antitermination. EMBO J. 7: 3271-3277.
Schnetz, K., C. Toloczyki, and B. Rak. 1987. f3-Glucoside (bgl) operon of Escherichia
coli K-12: Nucleotide sequence, genetic organization, and possible evolutionary relationship to regulatory components of two Bacillus subtilis genes. J. Bacteriol. 169:
2579-2590.
Schwartz, M. and J. Neuhard. 1975. Control of expression of the pyr genes in Salmonella
typhimurium: Effects of variations in uridine and cytidine nucleotide pools. J. Bacteriol. 121: 814-822.
Shimotsu, H., M.1. Kuroda, C. Yanofsky, and D.J. Henner. 1986. Novel form of transcription attenuation regulates expression of the Bacillus subtilis tryptophan operon. J.
Bacteriol. 166: 461-471.
SivaRaman, L., D. Reines, and C.M. Kane. 1990. Purified elongation factor SII is sufficient to promote read-through by purified RNA polymerase II at specific termination
sites in the human histone H3.3 gene.J. BioI. Chem. 265: 14554-14560.
Spencer, C.A. and M. Groudine. 1990. Transcription elongation and eukaryotic gene
regulation. Oncogene 5: 777-785.
Spencer, C.A., R.C. LeStrange, U. Novak, W.S. Hayward, and M. Groudine. 1990. The
block to transcription elongation is promoter dependent in normal and Burkitt's
lymphoma c-myc alleles. Genes Dev. 4: 75-88.
Steitz, J.A. and K. Jakes. 1975. How ribosomes select initiator regions in mRNA: Base
pair formation betweep the 3' terminus of 16S rRNA and the mRNA during initiation
of protein synthesis in Escherichia coli. Proc. Natl. Acad. Sci. 72: 4734-4738.
Stewart, V. and C. Yanofsky. 1985. Evidence for transcription antitermination control of
tryptophanase operon expression in Escherichia coli K-12. J. Bacteriol. 164: 731-740.
Stewart, V., R. Landick, and C. Yanofsky. 1986. Rho-dependent transcription termination
in the tryptophanase operon leader region of Escherichia coli K-12. J. Bacteriol. 166:
217-223.
Stroynowski, I. and C. Yanofsky. 1982. Transcript secondary structures regulate transcription termination at the attenuator of the Serratia marcescens tryptophan operon.
Nature 298: 34-38.
Turnbough, c.L., Jr. 1983. Regulation of Escherichia coli aspartate transcarbamylase
synthesis by guanosine tetraphosphate and pyrimidine ribonucleoside triphosphates. J.
Bacteriol. 153: 998-1007.
Turnbough, c.L., Jr., KL. Hicks, and J.P. Donahue. 1983. Attenuation control of pyrBI
operon expression in Escherichia coli K-12. Proc. Natl. A cad. Sci. 80: 368-372.
von Hippel, P.H. and T.D. Yager. 1992. The elongation-termination decision in transcription. Science 255: 809-812.
Weisblum, B. 1983. Inducible resistance to macrolides, lincosamides, and streptogramin
type-B antibiotics: The resistance phenotype, its biological diversity, and structural elements that regulate expression. In Gene function in prokaryotes (ed. J. Beckwith et al.)
pp. 91-121. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York.
Wiest, D.K., D. Wang, and D.K Hawley. 1992. Transcription arrest of purified RNA
polymerase II and washed elongation complexes at the adenovirus major late attenuation site. J. BioI. Chem. 267: 7733-7744.
Williamson, R.M. and D.L. Oxender. 1992. Premature termination of in vivo transcription of a gene encoding a branched-chain amino acid transport protein in Escherichia
coli. J. Bacteriol. 174: 1777-] 782.
,
'r
446
R. Landick and C.L. Turnbough. Jr.
Winkler, M.E. and C. Yanofsky. 1981. Pausing of RNA polymerase during in vitro
tran_
scription of the tryptophan operon leader region. Biochemistry 20: 3738-3744.
Wright, S. and J.M. Bishop. 1989. DNA sequences that mediate attenuation of trans .
cnp_
tion from the mouse protooncogene myc. Proc. Nat!. A cad. Sci. 86: 505-509.
Wright, S., L.F. Mirels, M.e.B. Calayag, and J.M. Bishop. 1991. Premature term,' .
natIon
of transcription from the PI promoter of the mouse c-myc gene. Proc. Nat!. Acad S .
88: 11383-11387.
. Cl.
Xu, L., S.D. Morgenbesser, and R.A. DePinho. 1991. Complex transcriptional regulatio
of myc family gene expression in the developing mouse brain and liver. Mol. Cell. Bio~
11: 6007-6015.
Yager, T.D. and P.H. von Hippel. 1987. Transcript elongation and termination in Escherichia coli. In Escherichia coli and Salmonella typhirnurium: Cellular and
molecular biology (ed. F.e. Neidhardt et al.), pp. 1241-1275. American Society for
Microbiology, Washington, D.e.
Yang, M.-T. and J.F. Gardner. 1989. Transcription termination directed by heteroduplex
thr attenuator templates. J. Bioi. Chem. 264: 2634-2639.
Yanofsky, C. 1984. Comparison of regulatory and structural regions of genes of tryptophan metabolism. Mol. Bioi. Evol. 1: 143-161.
Yanofsky, e., R.L. Kelley, and V. Horn. 1984. Repression is relieved before attenuation
in the trp operon of Escherichia coli as tryptophan starvation becomes increaSingly
severe. J. Bacterial. 158: 1018-1024.
Zengel, 1.M. and L. Lindahl. 1990. Ribosomal protein L4 stimulates in vitro termination
of transcription at a NusA-dependent terminator in the S10 operon leader. Proc. Natl.
Acad. Sci. 87: 2675,2679.
--~---
51