Download Sequence variation characteristics of D

Retrospective Theses and Dissertations
1995
Sequence variation characteristics of D-loop,
rRNA, tRNA, and polypeptide coding region of
bovine mitochondrial DNA
Jianming Wu
Iowa State University
Follow this and additional works at: http://lib.dr.iastate.edu/rtd
Part of the Agriculture Commons, Animal Sciences Commons, Genetics Commons, and the
Molecular Biology Commons
Recommended Citation
Wu, Jianming, "Sequence variation characteristics of D-loop, rRNA, tRNA, and polypeptide coding region of bovine mitochondrial
DNA " (1995). Retrospective Theses and Dissertations. Paper 10994.
This Dissertation is brought to you for free and open access by Digital Repository @ Iowa State University. It has been accepted for inclusion in
Retrospective Theses and Dissertations by an authorized administrator of Digital Repository @ Iowa State University. For more information, please
contact [email protected].
INFORMATION TO USERS
This manuscript has been reproduced from the microfilm master. UMI
the text directly from the original or copy submitted- Thus, some
thesis and dissertation copies are in typewriter face, while others may
be from any type of computer printer.
The quality of this reproduction is dependent upon the quality of the
copy submitted. Broken or indistinct print, colored or poor quality
illustrations and photographs, print bleedthrough, substandard margins,
and in::^roper alignment can adversely affect reproduction.
In the unlikely event that the author did not send UMI a complete
manuscript and there are missing pages, these will be noted. Also, if
unauthorized copyright material had to be remove4 a note will indicate
the deletion.
Oversize materials (e.g., maps, drawings, charts) are reproduced by
sectioning the original, beginning at the upper left-hand comer and
continuing from left to right in equal sections with small overl^s. Each
original is also photographed in one exposure and is included in
reduced form at the back of the book.
Photographs included in the original manuscript have been reproduced
xerographically in this copy. Higher quality 6" x 9" black and white
photographic prints are available for aity photographs or illustrations
appearing in this copy for an additional charge. Contact UMI directly
to order.
A Bell & Howell tnformaiion Company
300 North Zeeb Road. Ann Arbor. Ml 48106-1345 USA
313.'761-4700 800/521-0600
Sequence variation characteristics of D-loop, rRNA, tRNA, and polypeptide
coding region of bovine mitochondrial DNA
by
Jianming Wu
A Dissertation Submitted to the
Graduate Faculty in Partial Fulfillment of the
Requirements for the Degree of
DOCTOR OF PHILOSOPHY
Department:
Interdepartmental Major:
Animal Science
Molecular, Cellular, and
Developmental Biology
Approved:
Signature was redacted for privacy.
Signature was redacted for privacy.
In Chargb-bfjVIajpr Work
Signature was redacted for privacy.
For the Interdepartmental Major
Signature was redacted for privacy.
F
Major Departnient
Signature was redacted for privacy.
For the Gra^ate^ollege
Iowa State University
Ames, Iowa
1995
UMI Number: 9540955
OMI Microform 9540955
Copyright 1995, by OMI Company. All rights reserved.
This microform edition is protected against unauthorized
copying under Title 17, United States Code.
UMI
300 North Zeeb Road
Ann Arbor, MI 48103
ii
TABLE OF CONTENTS
ABBREVIATIONS
iv
GENERAL INTRODUCTION
1
Dissertation Organization
1
General Bactcground
1
LITERATURE REVIEW
4
General Information about Mitochondria
4
Mammalian mtDNA
7
Replication of mtDNA
11
Transcription and RNA Processing in Mitochondria
16
Protein Translation in Mitochondria
21
Import of Mitochondrial Proteins
23
Genetics of Mammalian mtDNA
25
Mutation and Sequence Variations of mtDNA
28
Mitochondrial DNA Heteropiasmy in Animals
31
Phenotypic Effects of mtDNA Variations
35
Mitochodrial DNA Genetics in Cattle
37
References
40
iii
SEQUENCE HETEROPLASMY OF D-LOOP AND rRNA CODING REGIONS IN
MITOCHONDRIAL DNA FROM HOLSTEIN COWS OF INDEPENDENT
MATERNAL LINEAGES
56
Abstract
56
Introduction
57
Materials and Methods
60
Results
62
Discussion
72
References
77
SEQUENCE VARIATIONS IN tRNA AND PROTEIN CODING GENES OF
BOVINE mtDNA
80
Abstract
80
Introduction
81
Materials and Methods
84
Results
88
Discussion
93
References
100
GENERAL SUMMARY
104
ACKNOWLEDGMENT
107
iv
ABBREVIATIONS USED
A
Adenine
Amino Acid Abbreviations:
A
Ala
Alanine
R
Arg
Arginine
N
Asn
Asparagine
D
Asp
Aspartate
C
Cys
Cysteine
Q
Gin
Glutamine
E
Glu
Glutamate
G
Gly
Glycine
H
His
Histidine
I
He
Isoleucine
L
Leu
Leucine
K
Lys
Lysine
M
iVIet
Methionine
F
Phe
Phenylalanine
P
Pro
Proline
S
Ser
Serine
T
Thr
Threonine
W
Trp
Tryptophan
Y
Tyr
Tyrosine
V
Val
Valine
ADP
Adenosine diphosphate
ATP
Adenosine triphosphate
ATPase
Adenosine triphosphatase
ATPase 6
Adenosine triphosphatase subunit 6
ATPase 8
Adenosine triphosphatase subunit 8
bp
Base pair
C
Cytosine
COI
Cytochrome c oxidase subunit I
con
com
Cytochrome c oxidase subunit II
CSB
Conserved sequence block
Cyt b
Cytochrome b molecule in the electron transport chain
D-ioop
Displacement loop
DNA
Deoxyribonucleic acid
G
Guanine
H-strand
Heavy strand
Kb
Kilobase pairs
L-strand
Light strand
MOM
Mitochondrial outer membrane
mRNA
Messenger RNA
mtDNA
Mitochondrial DNA
mtRNA
Mitochondrial RNA
mtTFl
Mitochondrial transcription factor 1
N
Any nucleotide (A, C, G, T, or U)
NADH
Nicotinamide adenine dinucleotide
ND
NADH dehydrogenase subunit
nt
Nucleotide
PCR
Polymerase chain reaction
RFLP
Restriction fragment length polymorphism
RNA
Ribonucleic acid
RNase
Ribonuclease
RNase MPR.
Ribonuclease involved in mitochondrial RNA processing
rRNA
Ribosomal RNA
Cytochrome c oxidase subunit III
SSB
Single strand DNA binding protein
ssDNA
Single strand DNA
tRNA
Transfer RNA
U
Uracil
1
GENERAL INTRODUCTION
Dissertation Organization
The dissertation starts with the Literature Review, which provides the readers with
general background about mitochondria and recent developments in mitochondrial genetics
and mitochondrial DNA (mtDNA).
Following the Literature Review, two separate manuscripts suitable for publication in
scientific journals are presented, A general summary follows which is intended to conclude
the major findings of the study. The data were gathered between 1991 and 1995 in partial
fijlfillment of the requirements for the Doctor of Philosophy degree. A portion of data related
to the sequence variations of D-loop region of bovine mtDNA, which were obtained
collectively by the author and Renotta K. Smith, has been reported in Renotta K. Smith's
thesis "Nucleotide sequence variations in the displacement-loop regions of bovine
mitochondrial DNA".
General Background
Mitochondria are the major sites of cellular respiration in eucaryotic organisms.
Mitochondria possess their own DNA (mtDNA) that replicates independently from the
nuclear DNA and is inherited maternally. Mutations caused by changes in the nucleotide
sequence of mtDNA can cause differences in productivity of dairy cattle and other domestic
animals. Several human genetic diseases reportedly are caused by mutations of mtDNA.
2
The genes of mtDNA are essential for organelle function. It has been documented that
the maternal lineage effects account significantly for differences in milk yield, fat yield , fat
percentage, fat corrected milk volume, milk net economic returns, days open, and days to first
breeding in dairy cattle (Schutz el al., 1992; 1993; 1994). Maternal lineages are defined by
tracing an animal's geneology backward through the maternal pedigrees as many generations
as possible, often to the beginning of a herd book registry. Because mtDNA in mammals is
the only known genetic element in the cytoplasm, cytoplasmic inheritance of different mtDNA
genotypes is thought to be the origin of the cytoplasmic effect. Maternal lineages frequently
are considered to be indicative of cytoplasmic inheritance. Mitochondrial DNA is transmitted
along with maternal cytosol and, being the only known extra-nuclear genetic component in
mammals, is a logical explanation for cytoplasmic inheritance. Therefore, the relationship
between mtDNA and the cytoplasmic effect is established.
The sequence variability in the displacement loop (D-loop) region of bovine mtDNA
affects specific traits including milk yield, fat yield, and total energy present in milk (Schutz et
ai, 1992; 1993; 1994). However, the mechanism of transmission and segregation of different
mtDNA genomes within an individual animal is not fully understood. It is not a consensus
concept that mtDNA of mammals is exclusively maternally inherited (Gyllensten et al., 1991).
There is ample evidence that human genetic diseases can be caused by mutations of mtDNA.
Nucleotide sequence variations leading to the functional differences of protein products of the
mtDNA coding genes are expected to explain the different rates of oxidative phosphorylation,
and thus the differences on production, reproduction, and health traits of animals. Although
3
the complete nucleotide sequence of bovine mtDNA sequence has been determined (Anderson
et al, 19S2), the extent and type of sequence variations in the protein coding region of mtDNA
are not documented in dairy cattle.
Our hypothesis is that the inheritance of mtDNA is the result of random passing from
ancestor to progeny instead of the selection effect and that any nucleotide changes that atlect
the function of gene products of mtDNA would have effects on the production traits of
animals. Therefore, the first study was designed to determine the nucleotide sequence
variation sites in the D-loop and rRNA coding regions of mtDNA from 18 maternal lineages
of dairy cattle on which extensive records of relationship of the cows within the lineages are
available and to analyze the phenomena of heteroplasmy (different types of mtDNA exist
within an individual animal) and try to investigate the characteristics of bovine mtDNA
inheritance. The DNA sequence variations that change amino acid sequence within protein
coding regions of mtDNA would have direct impact on the enzyme activities. The second
study was carried out to obtain the information about the type and extent of sequence variance
within tRNA and protein coding regions of mtDNA and to predict the effect of the nucleotide
sequence variations on the function of the mtDNA gene products.
4
LITERATURE REVIEW
General Inrorniation about Mitochondria
The average mitochondrion, whether in a mammalian or in a lower eucaryotic cell
(e.g., yeast), has approximately the same dimensions as the bacterium Escherichia coli. It is
most commonly observed as an oval particle, 1-2 um long and 0.5-1 um wide. Mitochondria,
therefore, are sufficiently large to be seen in the light microscope, and the earliest descriptions
of this organelle were based on observations of fixed and stained tissues. Mitochondria are
the powerhouses of eucaryotic cells, producing most of the energy of the cell in the form of
adenosine triphosphate (ATP).
Mitochondria occupy a substantial portion of the cytoplasmic volume of eucaryotic
cells, and they have been essential for the evolution of complex animals. Without
mitochondria, present-day animal cells would depend on anaerobic glycolysis for all of their
ATP. However, when glucose is converted to pyruvate by glycolysis, only a very small
fraction of the total free energy potentially available from the glucose is released. In
mitochondria, the catabolism of glucose and other fuel molecules is completed; the pyruvate is
imported into the mitochondrion and is oxidized by molecular oxygen to CO2 and HjO. The
energy released is harnessed so etTiciently that about 36 molecules of ATP are produced for
each molecule of glucose oxidized. By contrast, only two molecules of ATP are produced by
anaerobic glycolysis alone (Stryer, 1995).
Mitochondria are usually depicted as elongated cylinders with a diameter of 0.5 to I .O
|.im. Time-lapse microcinematography of living cells, however, shows that mitochondria are
remarkably mobile and plastic organelles, constantly changing their shape and even fijsing with
one another and then separating again. As they move about in the cytoplasm, they often
appear to be associated with microtubules, which may determine the unique orientation and
distribution of mitochondria in different types of cells. Thus, the mitochondria in some cells
form long moving filaments or chains, while in others they remain fixed in one position where
they provide ATP directly to a site of unusually high ATP consumption, such as being packed
between adjacent myofibrils in a cardiac muscle cell or wrapped tightly around the fiagellum
of a sperm.
Although mitochondria are large enough to be seen in the light microscope and were
first identified in the nineteenth century, real progress in the understanding of their flinction
depended on procedures developed in 1948 for isolating intact mitochondria. For technical
reasons, many biochemical studies have been carried out with mitochondria purified from
liver; each liver cell contains 1000 to 2000 mitochondria, which in total may occupy a fifth of
the cell volume. Each mitochondrion is bounded by two highly specialized membranes that
play a crucial part in its activities. Together, they create two separate mitochondrial
compartments: the internal matrix space and a narrow intermembrane space. The outer
membrane contains many copies of a transport protein called porin, which forms large
aqueous channels through the lipid bilayer. This membrane thus resembles a sieve that is
permeable to all molecules of 5000 daltons or less, including small proteins. Such molecules
6
can enter the intermembrane space, but most of them cannot pass the relatively impermeable
inner membrane. Other proteins in this membrane include enzymes involved in mitochondrial
lipid synthesis and enzymes that convert lipid substrates into forms that are subsequently
metabolized in the matrix. The intermembrane space contains several enzymes that use the
ATP passing out of the matrix to phosphorylate other nucleotides.
The major working part of the mitochondrion is the matrix space and the inner
membrane that surrounds it. The inner membrane is highly specialized. It contains a high
proportion of the "double" phospholipid cardiolipin, which contains four fatty acids and may
help make the membrane especially impermeable to ions. It also contains a variety of
transport proteins that make it selectively permeable to those small molecules that are
metabolized or required by the many mitochondrial enzymes concentrated in the matrix space.
The matrix enzymes include those that metabolize pyruvate and fatty acids to produce acetyl
CoA and those that oxidize acetyl CoA in the citric acid cycle. The principal end products of
this oxidation are CO2, which is released from the cell as waste, and NADH, which is the main
source of electrons for transfer among the respiratory chain components. The enzymes of the
respiratory chain are embedded in the inner mitochondrial membrane, and they are essential to
the process of oxidative phosphorylation, which generates most ATP in animal cells.
The matrix contains a highly concentrated mixture of hundreds of enzymes, including
those required for the oxidation of pyruvate and fatty acids and for the citric acid cycle. The
matrix also contains several identical copies of the mtDNA genome, special mitochondrial
ribosomes, tRNAs and various enzymes required for expression of the mitochondrial genes.
7
The inner membrane is folded into numerous cristae, which greatly increases its total surface
area. It contains proteins with three types of functions: (1) those that carry out the oxidation
reactions of respiratory chain, (2) an enzyme complex called ATP synthase that makes ATP in
the matrix, and (3) specific transport proteins that regulate the passage of metabolites into and
out of the matrix. Because an electrochemical gradient that drives the ATP synthase is
established across this membrane by the respiratory chain, it is important that the membrane
be impermeable to most small ions (Alberts et al., 1994).
Mammalian mtDNA
Eucaryotic organisms possess several identical copies of mtDNA in a single
mitochondrion (Robin and Wong, 1988). The genes that mtDNA encodes have been highly
conserved, but the structure and size vary dramatically (Morin and Cech, 1988). Most
eucaryotes contain a circular double-stranded mtDNA genome (Gray, 1982), but ciliated
protozoa Tetrahymena and Paramecium have linear mtDNA of about 50 kb (Suyama and
Miura, 1968; Goddard and Cummings, 1975), and hydra mtDNA consists of two linear
plastids of 7.5 kb each (Warrior and Gall, 1986).
Complete mitochondrial nucleotide sequences have been determined for human
(Anderson
a/., 1981), mouse (Bibb e/fl/., 1981), bovine (Anderson e/a/., \9Z2), Xenopus
laevis (Roe et ai, 1985), Drosophilayakuha (Clary and Wolstenholme, 1985), Ascaris suiim
(Wolstenholme et al., 1987), sea urchin (Jacobs et al., 1988; Cantatore et al., 1989), rat
s
(Gadaleta et al., 1989), chicken {Desjiardins and Morals, 1990), fin whale (Arnason et al.,
1991), and the blue moilusk My/ilii.s eJiili.s (Hoffman el ai, 1992).
The mitochondrial genome is much larger in yeast. The exact size varies quite widely
among different strains of Sacchromyces cerevisiae, it is roughly about 84 kb long. There are
about 22 mitochondria per yeast cell, which corresponds to 4 genomes per organelle. In
growing cells, the proportion of mtDNA can be as high as 18% of total cellular DNA. Plants
show an extremely wide range of variation in mtDNA size, with a minimum size of 100 kb.
The function of the additional DNA, in comparison with mammalian mtDNA, has not been
defined decisively, but it seems likely that much of it is noncoding. The size of the genome
makes it difficult to isolate intact mtDNA, but restriction mapping in several plants suggests
that each plant mtDNA has a single sequence, and it is organized as a circle. Within this
circle, there are short homologous sequences. Recombination between these elements
generates smaller, subgenomic circular molecules that coexist with the complete 'master'
genome, explaining the apparent complexity of plant mtDNAs (Lewin, 1994).
Mammalian mtDNA is approximately 16.5 kb in duplex circles. The mammalian
mtDNA genome is very compact in contrast to that of fungi and plants. The organization and
expression of the human mitochondrial genome reflects a strictly economical use of genetic
material (Barrell et al., 1980a; Anderson et a/., 1981). The genome has tRNA genes
interspersed amongst the rRNA and protein coding sequences and is very compact with
relatively few intergenic nucleotides and no detectable introns (Ojala et al., 1980; Battey and
Clayton, 1980; Anderson t?/a/., 1981).
Because the two strands ofnitDNA have different base compositions and can be
separated by their buoyant density in CsCI gradients on the basis of their density, one strand of
mtDNA is named as the heavy strand (H-strand) and the other complementary strand is
termed as the hght strand (L-strand),. The ratios of guanine (G) and thymine (T) in H-strand
to those of L-strand, are 2.27 for G and 1.25 for T in human mtDNA, whereas the
corresponding ratios are 1.92 and 1.20 in mouse mtDNA, respectively (Anderson et al, 1981;
Bibb et al., 1981).
A distinguishing feature of mtDNA is the formation of a transient triplex helical
structure in the region of the replication origin where a short nascent strand (H-strand) of
DNA is maintained at the origin of replication (Clayton, 1984). This region is located
between the proline transfer RNA (tRNA) and phenylalanine tRNA and is about 900
nucleotides in length. Because the nascent strand DNA separates and displaces the parental
double strands of DNA to form a loop within this region, the region is commonly called the
D-loop (displacement loop) region. The D-loop region contains the origin of replication for
H-strand mtDNA and the promoters for both L-strand and H-strand transcription, which are
located at the 5' end of the D-loop upstream from the origin of H-strand replication (Clayton,
1982; 1984; Channel a/., 1987; Nelson, 1987).
Over 90% of the mtDNA genome is the tRNA, rRNA, and protein coding region.
Mammalian mtDNA codes for a small (12S) and a large (16S) ribosomal RNA (rRNA)
subunit, 22 tRNAs and 13 polypeptides involved in oxidative phosphorylation (Anderson et
ai, 1982). These polypeptides are cytochrome c oxidase subunits L
and III; NADH
10
dehydrongenase subunits 1, 2, 3, 4, 5, 6, and 4L; ATPase subunits 6 and 8; and cytochrome b.
The tRNAs are spaced throughout the genome and are located between protein coding
regions (Barrell cV al., 1980; Anderson d a/., 1981). The significance of the alternation of
tRNA genes with rRNA and protein coding genes is that the tRNA indicate sites of RNA
cleavage. By cleaving the primary transcript on either side of each tRNA gene, all of the
genes except ATPase 6 and cytochrome c oxidase subunit III give rise to monocistronic
products. The rRNA molecules seem to be synthesized in greater amounts than are the
mRNAs. This difference could be caused by premature termination of some proportion of the
transcripts at some point after the two rRNA genes have been transcribed.
Another character that distinguishes mtDNA from chromosomal DNA is that the
mitochondrial genome reportedly has a high frequency of ribonucleotides incorporated. The
ribosubstitution occurs more frequently near the origin of H-strand replication and L-strand
replication, in the cytochrome c oxidase III, 12S rRNA and 16S rRNA, the tRNA''*""" and the
tRNA^"' genes than in the other regions. Other regions throughout the mtDNA, however,
also are ribosubsitituted at a low frequency (Brennicke and Clayton, 1981).
Mitochondrial DNAs are closed circular molecules, but a large portion of mammalian
mtDNA inside the cells exists as a circular dimer or concatemers, just like links in a chain
(Clayton and Vinograd, 1967). Two mtDNA strands usually are twisted around with about
100 negative supercoils (Clayton, 1982). The exposure of mouse cells to nalidixic acid, which
selectively inhibits bacterial type II DNA topoisomerases, caused the loss of mtDNA.
11
Therefore, the type II DNA topoisoinerase is essential for the maintenance of functional
mtDNA (Lawrence t'/a/., 1990).
The copy number of mtDNA per mitochondrion or per cell varies among species and
tissues and seems to be regulated by the need of energy within specific tissues. Bogenhagen
and Clayton (1974) found that mouse L cells contain about 1100 copies per cell and that Hela
cells have approximately four times as many molecules of mtDNA as normal epithelial cells.
More recently, Robin and Wong (1988) found that the number of mtDNA molecules per
mammalian ceil varies from 220 to 1720 copies/cell in rabbit lung macrophages. They also
found, however, that the number of copies of mtDNA molecules per mitochondrion seems to
remain constant at around 2.6 copies/mitochondrion within a species (Robin and Wong,
1988), This finding is contradicted by the study of Vetri et al. (1990) who found that the
number of copies per mitochondrion varies from 1 in mouse heart to 4.3 in mouse brain.
Williams (1986) found that the amount of mtDNA per gram of tissue varies directly with the
oxidative capacity of the tissue. Upon repeated contraction of muscle for 21 days,
cytochrome b mRNA becomes elevated coordinately v/ith mtDNA copy number (Williams et
al., 1986), suggesting that gene dosage may be important in the regulation of mtDNA
expression.
Replication of mtDNA
Mitochondria contain multiple copies of a closed circular DNA genome that is
replicated autonomously within the organelle matrix. It has been known for some time that
12
the control of replication for mtDNA is more relaxed than is that for chromosomal DNA.
There is an apparent lack of restriction on mtDNA replication with regard to cell cycle phase
(Clayton, 1982).
The major form of mtDNA observed in vertebrate animals is those with D-loop. It is
formed through maintaining a short piece of nascent DNA strand at the leading-strand origin
of replication. The D-loop then consists of a three-stranded structure with a short nascent Hstrand whose 5' end is located at the origin of H-strand replication (On). These short D-loop
strands seem to be metabolically unstable in that their turnover rate is much higher than that of
genomic replication.
A replicative intermediate is termed as a molecule in which DNA synthesis has
proceeded past the D-Ioop region around the molecule; this process occurs in a unidirectional
manner with an ever-increasing displacement of the parental H-strand. When the new Hstrand has elongated to two-thirds of its total length, the origin of L-strand replication ( O l) is
exposed on the displaced parental H-strand and then the initiation of daughter L-strand
synthesis is started. Thus, mammalian mtDNA have two separate and distinct origins of
replication. The asynchrony of mtDNA replication on H-strands and L-strands is caused by
the dominant effect of H-strand origin of replication and spatial distance between the two
origins of replication. During replication, dissimilar progeny DNA circles are produced and
segregated; one progeny DNA strand requires gap filling and subsequent introduction of
superhelical turns (Clayton, 1982),
13
A commitment to mtDNA replication begins by initiation of H-strand synthesis that
results in strand elongation over the entire length of the genome. Initiation of L-strand
synthesis only occurs after Oi, is exposed as a single stranded template, but replication has
never been found to begin at this origin. Thus, the H-strand (leading strand) origin is
dominant with respect to dictation of a replication event, whereas the L-strand (lagging
strand) is in effect, a secondary, albeit required, replication origin element. Interestingly, Oi,
seems to have been deleted (or was never present) in the chicken mtDNA (Desjardins and
Morais 1990), though the organization of the five tRNA genes has been conserved in this
region.
It is not clear whether H-strand synthesis is continued by extending the triplex D-loop
structure or by proceeding from the origin of H-strand replication as a single event. However,
replication priming and transcription begin at exactly the same site. Therefore, the replication
priming for O h is an event dependent upon transcription promoter fimction (Clayton, 1991a).
Another interesting feature of the origin of H-strand is that the transitions from RNA
synthesis to DNA replication occur at the region with three short conserved sequence
elements, which are termed conserved sequence blocks (CSBs) I, II, III. These sequences had
been identified previously by Walberg and Clayton (1981) based on the analysis of available
mtDNA sequence information. These blocks seem to be highly conservative within the region
of mtDNA that is otherwise highly divergent. On the basis of this observation, it was
speculated that the CBSs would have some regulatory role in mtDNA replication or
expression. A search for an enzymatic activity that might have the ability to recognize
14
features of these CSBs in order to process nucleic acid from this origin region proved
successtlil The enzyme is a ribonucleoprotein termed RNase MRP (for mitochondrial RNA
processing), and it has been characterized from both human and mouse (Clayton 1991).
The origin of L-strand replication is very short in size, approximately 30 nucleotides,
and it is within a cluster of five tRNA genes (Chang and Clayton, 1985). It is a small noncoding region tlanked by coding sequences, and it has the potential to form a stem-loop
structure that is highly conserved among sequenced vertebrate mtDNAs, except that of
chicken. The stem-loop structure is the only conserved feature. Therefore, the exact nature
of the primary sequence and its relationship to the population of surrounding tRNA genes may
be different.
Although the identification of O l was unambiguous (Martens and Clayton, 1979), our
current understanding of how Oi. functions requires the development of an in vitro replication
system capable of accurate initiation of L-strand synthesis. The use of an in vitro run-off
replication assay (Wong and Clayton, 1985a,b) demonstrated that human mitochondria
contains a mtDNA primase with the apparent ability to recognize Oi. and to initiate RNA
priming and DNA synthesis. The essential points are that daughter L-strand synthesis is
primed by RNA, which is complementary to a T-rich loop structure in O l and that a transition
from RNA synthesis to DNA synthesis occurs near the base of the stem. The site of transition
from RNA synthesis to DNA synthesis is actually part of a tRNA gene and is entirely
conserved in the human and bovine mtDNA,. Hixson et fl/.(1986b) demonstrated that both
the conserved stem-loop and divergent 5'-flanking sequences are necessary and sufficient to
15
support initiation of DNA replication and that the short pentanucieotide sequence at the base
of the Oi, stem is required to maintain a functional region.
DNA polymerase gamma (mtDNA polymerase) is necessary for initiation and chain
elongation of mtDNA. There are several reports of an associated 3' to 5' exonuclease activity
being an intrinsic part of the polymerase (Kunkel and Soni 1988; Insdorf and Bogenhagen
1989b; Kaguni and Olson 1989; Kunkel and Mosbangh 1989). The exonuclease activity may
confer a proofreading capacity consistent with studies on the error rate of DNA. Polymerase
gamma, unlike DNA polymerase alpha that acts on chromosomal DNA, acts more efficiently
on single-stranded templates (Kaguni et al., 1988). Polymerase gamma has been found to
replicate DNA with a remarkably high degree of fidelity. This high fidelity is a surprising
discovery because it had been considered that the high error rate of polymerase gamma was
responsible for the high rates of ribosubstitution and rapid evolution of mtDNA. The
processivity of polymerase gamma is very low. Polymerase gamma polymerizes
approximately 270 nucleotides per minute per strand. Compared with 60,000 nucleotides per
minute for DNA polymerase III holoenzyme of E. coli, the processivity of polymerase gamma
is about 200 times lower than that of E. coli DNA polymerase III (Clayton, 1982).
Polymerase gamma purified from Xenopus laevis (Insdorf and Bogenhagen, 1989a) possesses
a 140 kdal subunit. Single-strand DNA binding proteins (SSB) also play an important role in
the replication of mtDNA. Two single-stranded DNA binding proteins already have been
isolated from Xenopus laevis (Bogenhagen et a/., 1990). Another SSB has been isolated and
characterized from rat liver mitochondria (Hoke et al., 1990).
16
A mtDNA primase has been isolated and characterized by Wong and Clayton (1985a).
This complex makes an RNA primer of 9 to 25 nucleotides that is attached covalently to the
nascent DNA strand. The primase complex has an associated structural RNA, which is
encoded by a chromosomal gene that is necessary for primase function (Wong and Clayton,
1985a; 1986). It has been known for some time that mammalian mitochondria do not have
efficient system for removal of pyrimidine dimers, nor do they exhibit anything in the way of a
normal rate of recombination activity (Clayton, 1982). However, certain types of repair
enzymes have been identified in mitochondrial fractions (Tomkinson et ciL, 1990).
Transcription and RNA Processing in Mitochondria
The D-loop region of vertebrate mtDNA has evolved as the control site for both
transcription and replication. Each strand of the circular mtDNA genome is transcribed from
a single major promoter in the D-loop region, Approximately 150 DNA base pairs separate
the transcription start sites in mammals (Chang and Clayton 1984). The H-strand promoter
(HSP) and L-strand promoter (LSP) were determined by mutational analyses. The two
promoters on mouse and human mtDNA do not overlap and thus function as independent
entities (Chang and Clayton 1984). The processes of transcription for both strands of mtDNA
are initiated in the D-loop region. The promoters for L- and H-strand transcripts have been
located near the origin of H-strand replication (Clayton, 1984). These promoters contained at
least two types of functional domains, a short sequence at the transcription start site that was
absolutely necessary for transcription initiation and an upstream region that, when present.
17
resulted in an augmented etficiency of initiation (Hixson and Clayton, 1985; Topper and
Clayton, 1989). Linker analysis provided the evidence that the HSP or LSP each is composed
of approximately 50 base pair sequences that are separated into two functionally distinct
elements (Topper and Clayton, 1989).
Mitochondrial RNA (mtRNA) polymerase has been purified successftilly from rat, X.
laevis, and yeast. The enzyme from rats showed a strong template preference for the
supercoiled recombinant plasmid that consists of pBR322 vector and D-loop region of rat
mtDNA carrying the promoter origin of replication for H-strand (Yaginuma ct a/., 1982),
Mitochondrial RNA polymerase required a dissociable transcription factor for specific
transcription of.V. /acvis and S. ccrevista mtDNA (Bogenhagen and Insdorf, 1988; Ticho and
Getz, 1988; Schinlel el al., 1988). The mtRNA polymerase and the transcription factor
together are necessary and sufficient for active transcription from promoters in the D-loop
region.
The first trans-acting transcription factor in a mitochondrial system was isolated from
human mitochondria (Fisher and Clayton 1985). This mitochondrial transcription factor 1
(mtTFl) binds specifically to upstream sequences of the transcription start sites (Fisher et a/.,
1987). Promoter-specific transcription of human mtDNA required the presence of mtTFl in
addition to a mtRNA polymerase fraction. Mitochondrial RNA polymerase alone is not
effective for transcription. The mtTFl interacts with the mtDNA template by direct binding
mechanism. The mtTFl binding sites that have been assigned are located upstream of both
the HSP and LSP from position -12 to -39 of the respective transcription start sites, but the
18
affinity ofmtTFl for each of the promoters is different (Fisher ei al., 1987; Fisher and
Clayton, 1988). It is interesting that the relative binding atTinity is greater for the LSP than for
HSP. L-strand promoter is a stronger promoter than is HSP both in vivo and in vitro.
Mitochondrial TFl has been purified to homogeneity from human cells (Fisher and
Clayton, 1988; Fisher ct a/., 1991). By virtue of its targeting to mtDNA template immediately
upstream of the transcription start site, it is logical to assume that mtTFl activates
transcription as a result of DNA binding. It has been revealed that mtTFl has the capacity to
unwind and bind DNA, thereby suggesting the manner in which at least part of the
transcription initiation process takes place.
During transcription, the L- and H-strands of the mtDNA are transcribed from the
separate L- and H-strand promoters in the D-loop region. Two polycistronic RNAs are
synthesized from the two respective promoters. Each polycistronic RNA contains all the
genetic messages from the H-strand or L-strand of the mitochondrial genome (Chang et ai,
1987). Heavy strand transcription promoter regions of human mtDNA have been defined by
Montoya et al. (1982; 1983). The first promoter region is located 19 nucleotide upstream of
the 5' end of tRNA"""'. The second promoter region is located close to the 5' end of the 12S
rRNA coding region. Transcription from the first promoter region is believed to produce only
12S rRNA, 16S rRNA, tRNA'^", and tRNA^"', The transcript ends at the 3' end of the 16S
rRNA. The second promoter region near the 12S rRNA is believed to transcribe past the 3'
end of the 16S rRNA (Ojala et al, 1981). Initiation at the first promoter is believed to occur
at a higher frequency than at the second promoter. Complete transcripts from the second
19
promoter of H-strand will start at 5' end of 12S rRNA and include all the structural genes and
tRNAs downstream of the H-strand origin of transcription (Attardi et a/., 1983; Motoya et
al., 1982; Motoya c'/cv/., 1983).
The initiation site for L-strand transcription is near nucleotide 407 in human mtDNA
(Chang and Clayton, 1985; Hixson and Clayton, 1985). The L-strand initiation site has been
determined to be composed of nucleotides ATACCGCCAAAAGAT in human mtDNA.
Mutation analysis revealed that a mutation of one of the underlined nucleotides decreased the
efficiency of the promoter function (Hi.xson and Clayton, 1985). The replacement of the C
with other nucleotides to the right of the G in this sequence destroys the promoter function.
The second A after the underlined sequence has been determined as the initiation site of Lstrand synthesis. Light strand transcripts are in low abundance and seem to have a rapid
turnover rate (Cantatore and Attardi, 1980).
Once initiated, transcription of mtDNA proceeds around the entire genome, yielding a
polycistronic RNA molecule from each strand (Clayton, 1984). Then, the primary transcript is
processed by a series of endonuclolytic cleavages. An RNase P-type endonuclease that has
been purified from human mitochondria may be responsible for endonucleolytic cleavage of
the polycistronic RNA transcripts (Doerson el al., 1985). Because tRNAs are located
between rRNA genes and most of protein genes, excising the tRNAs from the primary
transcript will generate monocistronic RNAs (Battey and Clayton, 1980). This model
provides the reasonable explanation for transcript processing in which tRNA excision is the
major processing event to free RNA molecules for fijrther modification. However, the activity
20
of RNase P has not been demonstrated to cleave miRNA (Clayton, 1991a). Conversely
Karvvan et al (1991) showed that RNase P may be involved in multisile RNA processing.
Therefore, the role of the RNase P in mtRNA processing is not clear yet. The 3' ends of
mitochondrial mRNA precursors are polyadenylated, but the 5' end of niRNA is not modified
(Claylon, 1984). Polyadenylation is an important modification because many of the protem
coding genes contain incomplete termination codons and rely on polyadenylation to create a
functional stop codon (Anderson ei a/., 1981). When these genes are transcribed as part of a
large RNA precursor and adjacent gene transcripts are separated by endonucleolytic
processing, polyadenylation of the immature mRNAs creates in-phase U.A.A codons (Barrell et
al., 1980a; Anderson tv (//., 1981; Ojala cv «/., 1981). The processing of these mtRNAs must
operate with the precision similar to that observed for RNA splicing. Even a small error in the
site of polyadenylation would result in translation of a poly(A) tail and thus produce
polylysine-terminated proteins. However, the mitochondrial and the nuclear polyadenylation
processes are significantly different, because the AAUAAA sequence found upstream of
poly(A) addition sites in nuclear RNAs (Proudfoot and Brovvnlee, 1976) is absent from most
of the mitochondrial mRNAs (Anderson t'/a/., 1981; Ojala
1981). A polymerase for
the polyadenylation of 3' mitochondrial mRNAs in rats has been identified (Jacob, 1974). It
has been reported that the nutritional status of the rats could indirectly regulate the activity of
the poly(A) polymerase. Mitochondrial poly(A) polymerase activity significantly decreased
after rats were starved for 24 to 48 hours. However, the normal activity was restore within 1
to 2 hours by administering an amino acid mixture orally to rats (Jacob et al., 1976).
21
The concentrations of different mitochondrial niRNAs remain quite stable. However,
the mature rRNA and mRNA of mitochondria are metabolically unstable and the ratio of two
specific types of niRNAs may vary as much as 10 fold (Gelfand and Attardi, 1981; Bhat et a!.,
1985). Because the transcription from HSP or LSP is polycistronic, these mRNA population
differences must be caused by the stability of different transcripts. It has been suggested that
different lengths of poIy(A) additions to transcripts 3' end could lead to greater stability of
transcripts (Avadhani, 1979).
Protein Tnuishition in Mitochondria
Mammalian mitochondrial genetic code is different from the "universal" genetic code
in that UGA codes for tryptophan rather than termination, AUA for methionine and initiation
rather than isoleucine, and AGA and AGG for termination rather than for arginine (Barrell et
al., 1979; Barrell e! ai, 1980 a.b; Anderson et a!., 1981). This code is composed of four
termination codons and 22 codon "families", each of which is read by a single mitochondrial
tRNA. For families containing two codons, the decoding mechanism relies on G-U basepairing by the wobble position nucleotide in the tRNA. However, those tRNAs that read
four-codon families all have a U in the wobble position, and hence evidently decode by using
U-N or "2-out-of-3" base pairing (Barrell ct al., 1980b). Mammalian mitochondrial tRNAs
lack several "invariant" features found in all previously studied nonmitochondrial tRNAs
(Anderson et al., 1981), and likewise the 12S and 16S rRNAs exhibit only low homology to
nonmitochondrial rRNAs (Epron et a/., 1980).
22
DNA and RNA sequence analyses indicate that animal mitochondrial mRNAs contain
tew or no nucleotides as 5' or 3' untranslated leaders (Attardi, 1985; Ojala d al., 1980),
Hence, this system will not use a Shine Dalgarno sequence type of interaction to specify the
start AUG (Shine and Dalgarno, 1974). Furthermore, the lack of a 5' leader or cap structure
indicates that the mitochondrial ribosome will not use a cap binding and scanning mechanism
for initiation such as that found in the eukaryotic cytoplasmic system (Kozac, 1983). The
small subunit of the mitochondrial ribosome seems to have the ability to bind mRNA tightly in
a sequence-independent manner (Liao et al, 1989). Structures of rRNAs of mitochondrial
have been proposed (Dams et a/., 1988; Gutell and Fox, 1988; Neefs cl al., 1990). During
translation, the ribosome contacts the mRNA over about 80 nucleotides, with the small
subunit having a binding site for guanyl nucleotides (Denslow el al., 1991) that is not present
in either prokaryotic or eukaryotic cytoplasmic ribosomes. This interaction requires an RNA
having a minimal length and seems to be independent of the secondary structure of the RNA
(Liao et al., 1990a). It has been suggested that the first step in the initiation cycle in this
organelle may be the binding of the small subunit of ribosome to the mRNA.
Mitochondrial initiation factor 2 (IF-2mt) was the first animal mitochondrial initiation
factor detected and partially purified (Liao et al., 1990b). This factor promotes the binding of
fmet-tRNA to the mitochondrial ribosome. The binding reaction requires the presence of a
message such as poly (A, U, G) and GTP. The IF-2mt is more similar to the prokaryotic
initiation factor than to the eukaryotic cytoplasmic initiation factor (Liao et al., 1991). Eberly
et al. (1985) found that bovine mitochondrial ribosomes are active only with homologous
23
elongation factor G (EF-G), but elongation factor Tu (EF-Tu) can be replaced by the EF-Tu
from many other biological sources, including K. coli. Bacillus stihlHis, and Eitglena
chloroplasts.
It has been suggested that the translation of mitochondrial mRNA may be regulated.
Chomyn and Attardi (1987) showed that translational etTiciency varies over an eight-fold
range and suggested that the variation in translation rates may be responsible for different
syntheses of mRNAs. However, the synthesis of mitochondrial proteins does not correlate
with the amount of mitochondrial niRNAs, suggesting that translation may also be regulated
(Polosa and Attardi, 1991).
Import of Mitochondrial Proteins
Most mitochondrial proteins are encoded in the nucleus, synthesized in the cytoplasm,
and imported into the mitochondria (Schatz and Butow, 1983). Pathways for the import of a
number of mitochondrial proteins have been elucidated by two basic approaches: pulselabeling studies with intact cells in the presence and absence of inhibitors, followed by
subcellular fractionation and the incubation of isolated mitochondria or mitochondrial
fractions with radiolabeled protein precursors synthesized in vitro. The following key steps
have been identified: 1) synthesis of a precursor in the cytoplasm, 2) recognition of the
mitochondrial surface by the precursor, 3) transfer of the precursor into or across one or both
mitochondrial membranes, 4) conversion of the precursor to the mature form by proteolytic
24
cleavage, conformational change, or other modification, and 5) assembly of the polypeptide
into an active protein complex.
The import of proteins into mitochondria is a complex, multi-step process. In recent
years, a number of components of the mitochondrial import machinery have been identified.
Most proteins destined to be transported from the cytoplasm into the matrix are synthesized
with N-terminal amphiphilic targeting sequences that direct the proteins into mitochondria.
The precursor protein then binds to the mitochondrial surface and is transported across the
outer and the inner membrane at sites where the two membranes are closely opposed.
Passage across the two membranes requires that the protein be loosely folded. Once the
protein has reached the matrix, its targeting sequence is removed and the mature polypeptide
folds into native conformation (Attardi and Schatz, 1988; Hartl and Neupert, 1990). Each of
these steps is catalyzed by specific proteins. Premature folding in the cytoplasm is prevented
by cytosolic 'chaperones', which selectively bind and stabilize partially folded proteins;
specific binding to the mitochondrial surface is mediated by mitochondrial surface receptors.
Transport across the mitochondrial membrane is catalyzed by proteins forming 'proteintransport pores' across these membranes. The removal of the targeting sequence is effected
by a specific protease. The folding of protein transported is controlled by matrix-located
chaperones in the matrix. The mitochondrial members of this protein family collectively
represent the mitochondrial protein import machinery.
The biogenesis of mitochondria requires the coordinated action of both nuclear and
mitochondrial genomes (Grivell, 1989). Proper function of mitochondrial processes depends
25
on accurate import and suborganellar sorting of many preproteins synthesized on cytosolic
ribosomes. Protein import into mitochondria is a complex process that requires two separate
machinery in the outer and inner membranes, each consisting of a large number of components
(Pfanner and Neupert, 1990; Click and Schatz, 1991; Pfanner cV «/., 1992; Emtage and
Jensen, 1993; Segui-Real cV a/., 1993b). The translocation machinery of the mitochondrial
outer membrane (MOM) is comprised of at least six components organized in a complex
(Kiebler ct al., 1990; Moczko el a/., 1992). MOM 19 and MOM72 of Neiirospora crassa
mitochondria have been reported to be involved in the initial step of recognition and binding
of preproteins to the mitochondrial surface (Sollner et ai, 1989; 1990). Recently MOM22
has been shown to function in the passage of preproteins from this receptor binding stage to a
site where proteins are fully inserted into the outer membrane (Kiebler et al., 1993). At least
part of this site, the so-called 'general insertion pore' (Pfaller et al., 1988), consists of
MOM38 and M0M7 (Sollner et al., 1992).
Genetics of Mammalian mtDNA
Eukaryotic cells contain a class of cytoplasmic DNA molecules, which are found only
within the mitochondria where they replicate and are transcribed. This mtDNA constitutes the
mitochondrial genome and carries genetic information essential to mitochondrial function.
There is evidence that the mitochondrial genome of a fungus or amphibian individual is
derived solely from the maternal parent (Reich el al., 1966; Bernardi el al., 1968; Dawid et
26
a/., 1972). In a well-known experiment, Hutchinson ct al. (1974) provided evidence that the
mammalian mitochondrial genome exclusively is inherited maternally.
The study of the inheritance of mtDNA was performed by isolating pure mtDNA from
hybrids between two closely related mammalian species. The two parental mtDNAs are
readily distinguishable by restriction enzyme cleavage analysis; analysis of the mtDNA from
the hybrid animals yielded a fragment pattern characteristic of only the maternal animal. None
of the DNA fragments specific for the paternal animal was observed (Hutchinson et al., 1974).
In another study, use of litters of rats with two types of mtDNA for interbreeding
showed that the mtDNA type of progeny was the same as that of dams. This maternal
inheritance of mtDNA could be observed in all organs tested and thus suggests that during
development paternal mtDNA is not localized to a certain specific organ where it proliferates
(Hayashi et ol., 1978), These authors concluded that maternal inheritance of mtDNA is strict.
By examining the reciprocal crosses of two widely divergent species of mice, Gyllensten et al.
(1985) reached the same conclusion. The study spanned eight generations of backcrossing
and showed that mtDNA inheritance was at least 99.9 percent maternal.
For over 20 years, it has been assumed, on the basis of low-resolution experiments,
namely, restriction fragment length polymorphism (RFLP), that mtDNA has an exclusively
maternal mode of inheritance in animals. However, Gyllensten et al (1991) demonstrated the
existence of the paternal inheritance of mtDNA by the backcrossing of mice for 26
generations and by performing a more sensitive test, that is polymerase chain reaction (PGR),
to amplify paternally inherited mtDNA selectively. The proportion of paternal mtDNA that
27
can enter the egg cytoplasm and persist has been calculated about 10"' per generation. By
using the PCR, paternally inherited mtDNA molecules have been detected in mice at a
frequency of lO'"*, which is relative to the maternal contribution.
Biparental inheritance of mtDNA has been detected in mussels (Hoeh i't a/., 1991) and
yeast (Bernadi et a/., 1968). There are no exact reasons for the seemingly strict maternal
inheritance of mtDNA in mammals, because the middle piece of the mammalian spermatozoa
that contains the mitochondria usually enters the egg during fertilization (Austin, 1961). In
the mouse, mitochondria from the sperm have been observed to scatter in the cytoplasm of the
egg (Gresson, 1940). In light of these observations, it is possible that the maternal inheritance
may result from a quantitative preponderance of maternal (egg) mitochondria in the zygote. It
is amusing to consider some numerological consequences of the mechanism. It has been
estimated that a bull sperm contains 72 mitochondria (Bahr and Engler, 1970). Mammalian
eggs are known to be rich in mitochondria (Austin, 1961; Gresson, 1940), and, if the
concentration of mtDNA is similar to that found in the cytoplasm of echinoderm eggs (Piko et
a!., 1967; Piko et al, 1968), an entire egg would contain about lO*" molecules of mtDNA.
These figures would imply that if paternal and maternal mitochondria replicate at equal rates,
then only about lO"* of the mtDNA in a mammal would be derived paternally. This fraction
would be below the limit of detection by RFLP analyses. Furthermore, the sperm
mitochondria could be partitioned into cells during the formation of the blastocyst and before
the onset of mitochondrial replication. As a consequence, many clones of cells in the
developing embryo may be completely free of paternal mtDNA, even if paternal mitochondria
2S
are viable. It therefore seems unnecessary' to postulate any replicational defect in the paternal
mitochondria to account for the observed maternal inheritance of mtDNA. The possibility still
exists that paternal mitochondrial genomes are present in very small numbers in mammalian
tissues and that sufficiently sensitive experiments (such as PCR) could detect their presence
(Gyllensten f/«/., 1991).
Mutation and Sequence Variations of mtDNA
The mtDNA of many organisms has been isolated and studied, and the complete
mtDNA sequences of certain organisms have been obtained (Anderson et a/., 1981; Anderson
el a/., 1982; Bibb t'/a/., 1981; Roe cv a/., 1985; Clary and Wolstenholme, 1985;
Wolstenholme et a/., 1987; Jacobs et ai, 1988; Cantatore et at., 1989; Gadaleta e! a/., 1989;
Desjardins and Morais, 1990; Arnason t'/a/., 1991; Hoffman f/«/., 1992).
The mammalian lines that ultimately gave rise to humans and cows diverged from each
other about 80 million years ago (Wilson el a/., 1977). Because the rate of DNA sequence
divergence is relatively fast for mammalian mitochondrial genomes (Upholt and Dawid, 1977;
Brown el a/., 1979), those portions of the mtDNA sequence that have been conserved are
likely to have been subject to function-related constraints during mammalian evolution.
Functionally important higher order structures in those macromolecules coded for by
mammalian mtDNA are also likely to have been conserved; so, comparative analysis of
mtDNA sequences can be used to derive secondary or tertiary structure models for
mitochondrial rRNAs and tRNAs.
29
Brown et al. (1979) demonstrated that the rate of evolution of the mitochondrial
genome exceeds that of the single-copy fraction of the nuclear genome by a factor of 5 to 10,
and the high rate may be due, in part, to an elevated rate of mutation in mtDNA. The
nucleotide substitution rate is estimated at 0.02 substitutions per base pair per million years.
The nucleotide variation in mtDNA within an animal species was first described by
Brown and Vinograd (1974), who used RFLP techniques to study polymorphism in human
mtDNA. Since then, the rapid intraspecies variation in mitochondrial genotypes has been
noted for a number of mammalian species (Potter cr al., 1975; Brown el al., 1979; Brown,
1974; Upholt and David, 1977; Kroon et al., 1977; Buzzo et al., 1978; Hanswirth et al.,
1980). In the majority of these studies, variation was detected by restriction site
polymorphism and was explicable by simple gains or losses in sites. Nucleotide sequence data
for several EcoR I derived polymorphisms in rat mtDNA confirmed this view (Buzzo et al.,
1978; Hayashi et al., 1978). In one case, RFLPs suggested that insertional events occurred in
the D-loop region (Upholt and Dawid, 1977).
The variations of nucleotide sequences in the D-loop region of mtDNA have been
found in humans (Cann e?/a/., 1987), primates (Brown tV o/., 1982), mice (Ferris £?/«/., 1983),
and cattle (Hanswirth and Laipis, 1982; Olive et al., 1983; Watanabe et al., 1985; Koehler,
1989). Lindberg (1989) determined sequences of D-loop regions of mtDNA from cows from
38 maternal lineages of Holstein cattle and found 48 sites of nucleotide substitutions, one
deletion site, and two variable-length poly G/C regions. The most frequent variation was the
transition event, followed by transversion, and then deletion or insertion. It is accepted
31)
generally that the D-loop region is the least conserved ponion of the mammalian
mitochondrial genome.
Modification of nucleic acid sequences generates variations in nuclear and nitDNA.
The most common nuclear and mtDNA modifications are transitions (purine to purine
substitution or pyrimidine to pyrimidine substitution). A mechanism for the spontaneous
occurrence of transitions was suggested by Watson and Crick (1953) in their classic paper on
the DNA double helix. They noted that some of the hydrogen atoms on each of the four bases
can change their location to produce a tautomer. An amino group (-NH2) can tautomerize to
an imino form (=NH). Likewise, a keto group (-C=0) can tautomerize to an enol form (=COH). The fraction of each base in the form of these imino and enol tautomers is about lO"*.
These transient tautomers can form non-standard base pairs that fit into a double helix. For
example, the imino tautomer of adenine can pair with cytosine. This A-C pairing would allow
C to become incorporated into a growing DNA strand where T was expected, so that it would
lead to a mutation if left uncorrected. Following replication, one of the daughter DNA
molecules will contain a G-C base pair in place of the normal A-T base pair.
Mutations also can be caused by either the modification of the incorporated bases or
the incorporation of base analogs into the DNA strand during polymerization. Chemicals that
can react with DNA could alter bases directly. For example, nitrous acid will oxidize amino
groups of bases to keto groups. The significant conversions are A to hypoxanthine, C to U,
and methylcytosine to T. Each of the converted bases forms hydrogen bonds in such a way as
to cause transitions, and the G-C to A-T type has been reported most frequently. However,
31
even transversions are observed occasionaliy. Free radicals of oxygen, produced by radiation
or as byproducts of aerobic metabolism, have been suggested to cause base modifications and
to drive the high rate of mutation known to occur in mitochondria (Brown, 1981). Alkylating
agents or base analogs can directly change the hydrogen bond property and cause mutation of
DNA
The localization of length differences to a homopolymer region suggests that a
replication slippage mechanism may have generated some variation. DNA polymerases may
use a mispaired primer-template in which one strand has slipped relative to its complement to
generate insertions or deletions. Models using mispairing of homopolymers and larger repeats
during replication have been used to explain length variation in a number of prokaryotic,
eukaryotic, nuclear, and mitochondrial genes ( Efstratiadis et ai, 1980; Farabaugh et al.,
1978; Brown and DesPosiers, 1983).
Mitochondrial DNA Heteroplasniy in Animals
Heteroplasmy means that more than one type of mtDNA exists within a single
mitochondrion, a single cell, or an individual animal. There are two types of heteroplasmy.
The term length heteroplasmy or size variation is used when different sizes of mtDNA exist
within an individual animal. Site variants occur when mtDNA differs in nucleotide sequence
(the genome is the same size) as defined by RFLP or direct nucleotide sequencing.
32
Heteroplasmy has been found in insects (Harrison el al., 1985), fish (Bermingham et
a/., 1986), scallops (Snyder cv tj/., 1987), lizards (Densmore f/«/., 1985), humans with
diseases caused by mutations in mtDNA (Holt et al., 1988), and cattle (Hausvvirth and Laipis,
1982b; Hauswirth el al., 1984; Ashley el a/., 1989). Heteroplasmy of size variation is more
common in lower animals that in mammals (Bermingham et a!., 1986; Harrison et ai, 1985;
Buroker et o/., 1990; Densmore et a/., 1985). Heteroplasmy usually can be explained by
differences in the copy number of tandemly repeated sequences among otherwise identical
molecules (Snyder t'/a/., 1987; Harrison c/a/., 1985; Desmore t'/a/., 1985). Buroker
c?/.
(1990) cloned and sequenced the D-loop region of two extreme length variants and found that
extensive length polymorphism and heteroplasmy of the D-loop region are observed in
mtDNA of the white sturgeon. The nucleotide sequence of this region, for both a short and
long form, shows that the differences are the result of variable numbers of a perfect 82 base
pair (bp) direct repeat. These data allow Buroker and colleagues (1990) to propose that the
length heteroplasmy may be the result of frequent competitive misalignment in the repeat
region prior to replication. An alternative mechanism proposed by Rand and Harrison (1989)
suggests that frequent intermolecular recombination may cause heteroplasmy in crickets. The
frequency with which heteroplasmy has been observed in animals suggests that it occurs rather
frequently; yet, recombination in mtDNA has not been shown in mammals (Hayashi et a!.,
1985).
The evolution of heteroplasmy in maternal lineages has been examined in cattle
(Hauswirth and Laipis, 1982; Ashley
a/., 1989; Koehler t?/«/., 1991), DfosophUa
33
mauziiiana (Solignac et uL, 1984; Soliunac tv a!., 1987), and Giylliisfirnuis (Rand and
Harrison, 1986). By following the transmission of a heteroplasmic intDNA through four
generations of Holstein cows, Ashley a al. (1989) documented that substantial shifts in the
frequency of heteroplasmy occurred between single mammalian generations. The neutral
mitochondrial genotypes segregated in different directions in otTspring of the same female and
a return to homoplasmy occurred in only two or three generations. Koehler et al. (1991)
found the bovine mitochondrial genome can be replaced completely by a nucleotide sequence
variant within a single generation, and no replication advantage or other selective bias could
explain the rapid fixation of the mutation at the specific site.
Solignac et al. (1987) studied the mitochondrial genotype of all F1 female offspring
(426 individuals) of a single Di osophila maiiritiana female that was heteroplasmic for two
types of mtDNA, a short genome characterized by a duplication of 470 bp sequence and a
long genome characterized by a triplication of the same sequence. They found that all
descendants were heteroplasmic. An increase of the percentage of long DNA in offspring was
observed as the female became older. The variance of the genotypes increased as rounds of
stem cell division progressed. In crickets, a heteroplasmic mother also transmitted
heteroplasmy to her off^spring, suggesting that the segregation of mtDNA variation in cricket
germ cell lineages does not occur rapidly (Harrison et al, 1985).
Heteroplasmy of mammalian mtDNA usually involves point mutations and limited
length variations affecting essentially noncoding regions (Hauswirth et ai, 1984; Ashley et al.,
1989; Koehler et al, 1991). One case of heteroplasmy involving a large change in mtDNA
34
size has been reported to occur in mammals. Boursot ct al. (1987) found a mitochondrial
mutant with a very large deletion in a coding region in European mice. The deletion is 5 kb
long and encompasses six tRNA coding regions and seven protein genes. The mice were
heteroplasmic: they contained a mixture of normal mtDNA and the deletion mutant.
Although the mutant mtDNA is functionally defective, it represents 78% - 79% of the mtDNA
molecules in both animals. Size heteroplasmy also was demonstrated in humans by Holt et al.
(1988). The normal size of mtDNA co-existed with mtDNA containing deletions up to 7 kb
in length in a patient with mitochondrial disease.
Theoretically, site heteroplasmy should be common considering the high frequency of
mutation in mtDNA. When a mutation occurs, different types of mtDNA should co-exist at
some point of time, but site heteroplasmy rarely has been detected in normal mammals (Ashley
et al., 1989; Koehler et al., 1991). Nevertheless, site heteroplasmy is very common in human
mitochondrial disease with point mutations in mtDNA (Kobayashi et ai, 1994; Hayashi et ai,
1994; Pastores et al., 1994; Holt et al., 1990). Holt et al. (1990) reported that blood and
skeletal muscle from patients with retinitis pigmentosa, demention, seizures, ataxia, proximal
neurogenic muscle weakness, and sensory neuropathy contained two populations of mtDNA,
one of which had a restriction site for /Ira I. Sequence analysis showed that the heteroplasmy
was the result of a point mutation of nucleotide 8993, resulting in an amino acid change from
a highly conserved leucine to an arginine in subunit 6 of mitochondrial H"-ATPase. The
fraction of mutant mtDNA in patients is correlated positively with clinical severity. The
heteroplasmy is inherited from their mothers.
35
Homoplasmy, in which only one type of mtDNA exists, usually is considered as a
consequence of maternal inheritance of mammalian mtDNA. Therefore, the frequency of
heteroplasmy within individuals will depend on the rates of mutation and rate of transmission
or segregation. A high mutation rate coupled with a rapid segregation could lead to rapid
evolution of mtDNA and the absence of individual heteroplasmy (Koehler el a/., 1991).
Under these conditions, the heteroplasmic state, which must intervene if maternal lineages are
to be differentiated, exists only briefly (Rand and Harrison, 1986).
Phenotypic Effects of mtDNA Variations
Variation of mtDNA sequence can change the quantity or quality of products encoded
by mtDNA genes and then alter the phenotype. The polypeptides encoded by mtDNA are
involved exclusively in mitochondrial membrane electron transport and oxidative
phosphorylation to yield the common energy currency of living cells—ATP. Therefore, any
change in the quantity and quality of the mtDNA gene protein can exert a direct influence on
oxidative phosphorylation and energy production inside mitochondria.
Bunn et ol. (1974) demonstrated that yeast strains with mutations in mitochondrial
genes that encode components of electron transport have altered mitochondrial respiratory
characteristics. Studies carried out with genetically divergent animals have confirmed genetic
influences on mitochondrial enzyme activities and oxidative phosphorylation. For example,
mitochondria with different mtDNA genotypes have different rates of oxidative
phosphorylation in DrosophUa (McDaniel and Grimwood, 1971), rabbits (Dzapo et ai.
36
1973), sheep (Wolanis el al., 1980), chickens (Dziewiecki and Kolataj, 1980), mice (Brown et
ciL, 1987, Lindberg ei ci/., 1989), and swine (Dzapo and Wassmuth, 1983). It has been
reported that a specific change in mtDNA conferred resistance of chloramphenicol in a
mammalian cell line (Blanc cl a/., 1981).
Recently, a variety of human diseases that involve the brain, heart, skeletal muscle,
kidney, and endocrine glands have been attributed to mutations in mtDNA (Holt ef al., 1988;
Holtt'/n/., 1990; Kobayashi c/a/., 1994; Hayashi tV a/., 1994; Pastores £.'/a/., 1994). The
first pathologic mtDNA mutations identified were associated with rare syndromes such as
Leber's optic neuropathy (LHON), myoclonic epilepsy and ragged-red fiber disease, and the
Kearns-Sayre Syndrome (Wallace, 1993)
However, the characteristics of late onset tissue-
specific diseases and progression of these diseases suggest a variety of more common
degenerative disorders also might be caused by mitochondrial mutations. The tissue-specific
diseases also could be explained by a combination of the tissue-specific accumulation of
somatic mtDNA mutations with age and the variation between tissues in the expression of
nuclear genes that encode mitochondrial function (Wallace, 1993).
Different tissues and organs rely on mitochondrial energy to various extents, with the
central nervous system, heart, skeletal muscles, kidney, and endocrine glands being
particularly oxidative and therefore especially dependent on energy produced by the
mitochondria. As the proportion of mutant mtDNAs increases among maternal relatives,
mitochondrial energy output declines until the ATP-generating capacity of the cell falls below
37
the energy threshold necessary for normal tissue function. Then, disease ensues (Wallace,
1992). Thus, it is clear that mutation of mtDNA. can have profound etTects on phenotype.
In mammals, the only known extranuclear genetic material is mtDNA. It has been
documented that cytoplasmic genetic (extranuclear) effects also contribute to differences in
milk production efficiency among dairy cattle. It has been shown that 2% of variation in milk
production and 3.5% of variation in milk fat percentages were explained by cytoplasmic
effects (Bell c/ o/., 1985). Schutz el at. (1992; 1993; 1994) found that the within-herd
variation in milk production traits and health condition were associated with mtDNA
genotypes. Huizinga et al (1986) documented that 10% of the variation in milk economic
returns were the result of cytoplasmic components. Faust et al. (1989) found large
cytoplasmic effects on number of days from calving to first service, conception rate, and
number of services per conception. Therefore, evidently mtDNA genotype of cows can
influence animal production traits significantly.
Mitochondrial DNA Genetics in Cattle
Bovine mtDNA is 16,336 nucleotides in length (Anderson et a!., 1982). The bovine
mtDNA sequence has high homology to that of human mtDNA (Anderson et al., 1981), and
the genes are organized in virtually identical fashion. The protein coding genes of bovine
mtDNA show 63 to 79% homology to their human counterparts, and the nucleotide
differences occur in the third positions of the codons. The bovine and human mitochondrial
tRNA coding regions exhibit more interspecies variation than do their cytoplasmic
:i8
counterparts, whereas DNA sequence in the bovine D-ioop region is only slightly homologous
to the corresponding region in the human mtDNA. This region is also quite variable in length
and accounts tor the bulk of the size ditTerence between human and bovine mtDNAs.
Few studies have been carried out to evaluate the variation of bovine mtDNA
sequences. Hauswirth and Laipis (1982) first demonstrated that two mitochondrial genotypes
coexisted within one Holstein cow maternal lineage. The variation was detected by the
appearance of an extra Hae III recognition site in one genotype, and this variation was caused
by a point mutation within an open reading frame at the third position of a glycine codon. The
mutation did not change the amino acid sequence. They concluded that the shift of mtDNA
genotype took place in no more than 4 years. By sequencing part of the D-loop region of 14
maternally related Holstein cows, Olivo et at. (1983) found that four different D-loop
sequences existed in the mtDNA of cows from the same maternal lineage. They concluded
that the genotypic shifts in the bovine nUDNA D-loop were relatively rapid.
The first case of intra-animal heterogeneous sequences of bovine mtDNA was
reported to be located within an evolutionary conserved C homopolymer sequence near the 5'
end of the D-loop region (Hauswirth et o/., 1984). Laipis et al. (1988) reported that the
relative ratio of the two heteroplasmic molecules varies 3-fold among sibling dairy cows, and
they postulated that the unequal partitioning of bovine mitochondrial genotypes among
siblings was the basis for rapid DNA sequence variation. Ashley ct al (1989) also provided
evidence of rapid segregation of heteroplasmic bovine mitochondria by following the
transmission of a heteroplasmic mtDNA mutation through four generations of Holstein cows,
39
whereas Koehler el al. (1991) observed a complete change of bovine mtDNA genotype within
one generation. There is enough evidence that a new mtDNA genotype could arise and
replace old ones in a relatively short period of time.
Lindberg (1989) has cloned and sequenced mtDNA D-loop region of Holstein cows
from 38 maternal lineages. Forty-eight sites of nucleotide substitutions, one deletion site and
two variable length poly G/C regions have been detected within the 910-bp D-loop region
when compared with the published sequence (Anderson et a/., 1982). The nucleotide
diversity has been calculated to be 3.8x10'' from nucleotide substitution data in the D-loop
region. It is interesting that many nucleotide substitutions found in cows were thought to be
located within the CSB in humans. There were no sequence variations in the central GC-rich
region from 16,142 to 16,202. Phylogenetic trees based on nucleotide substitution data were
constructed and showed two major divisions of mtDNA genotypes present in Holstein cattle.
Johnston et al. (1991) investigated the sequences of a 2735-base pair region of
mtDNA that includes both of the mitochondrial rRNA genes (12S and 16S rRNA) and three
mitochondrial tRNA genes (tRNA* '"', tRNA' '""', and tRNA'"""') from 29 maternal lineages of
Holstein cattle. Ten transitions and one variable length homopolymer region were observed.
All the sequence variants were located in the rRNA genes. The possible effects of those
sequence variants on the predicted secondary structure of the rRNAs and the nucleotide
sequence identity with other rRNAs have been examined. It has been postulated that two
variants would increase the potential number of base pairs in the rRNA, whereas one sequence
variant is in a base-paired structure which would not affect the secondary structure. One
40
sequence variant was thougiit to increase the nucleotide sequence identity with other known
rRNAs. The variable-length homopolymer with either six or seven A residues was located
within 16S rRNA gene. No heteroplasmic state was detected at this site.
References
Alberts, B., Bray, D., Lewis, J., RafF, M., Roberts, K., and Watson, J. D. (1994). Molecular
Biology of the Cell, pp 653-683. Garland Publishing, New York and London.
Albring, M., Griffith, J., and Attardi, G. (1977), Association of a protein structure of
probable membrane derivation with HeLa cell mitochondrial DNA near its origin of
replication. Proc. Natl. Acad. Sci. USA. 74: 1348-1352.
Anderson, S., Bankier, A. T., Barrel, B. G., DeBruijn, M. H. L., Coulson, A. R., Drouin, J.,
Eperon, I. C., Nierlich, D. P., Roe, B. A., Sanger F., Schreier, P. H., Smith, A. J. H.,
Staden, R., and Young L G. (1981). Sequence and organization of the human
mitochondrial genome. Nature 290: 457-465.
Anderson, S., DeBruijn, H. L., Coulson, A. R., Drouin, J., Eperon, I. C., Sanger F., and
Young L G. (1982). Complete sequence of bovine mitochondrial DNA. J. Mol. Biol.
156: 683-717.
Arnason, U., Gullberg, A., and Widegren, B. (1991). The complete nucleotide sequence of
the mitochondrial DNA of the fin whale, Balaeiioptera phsalus. J. Mol. Evol. 33:556568.
Ashley, M. V., Laipis, P. J., and Hauswirth, W. W. (1989). Rapid segregation of
heteroplasmic bovine mitochondria. Nucleic Acids Res. 17:7325-7331.
Attardi, G. (1985). Animal mitochondrial DNA: An extreme example of genetic economy.
Int. Rev, Cytol, 93: 93-145,
Attardi, G, and Schatz, G. (1988), Biogenesis of mitochondria, Annu, Rev, Cell Biol. 4:
289-333.
Attardi, G., Gaines, G,, and Montoya, J, (1983), Nucleo-Mitochondrial Interactions in R, J.
Schweyen, K, Wolf, and F, Kaudewitz, eds. Mitochondria, De Gruyter, Berlin,
Austin, C, R, (1961), The mammalian egg, Blackwell Scientific Publications, Oxford,
41
Avadliani, N. G. (1979). Messenger ribonucleic acid metabolism in mammalian
mitochondria: Relationship between decay of mitochondrial niRNA and their poly(A).
Biochemistry 18: 2673-2678.
Backer, J. M. and Weinstein, 1. B. (1980). Mitochondrial DNA is a major cellular target for a
dihydrodiol-epoxide derivative of benzo[a]pyrene. Science 209: 297-299.
Bahr, G. F. and Engler, W. F. (1970). Considerations of volume, mass, DNA , and
arrangement of mitochondrial in the midpiece of bull spermatozoa. Exp. Cell Res. 60:
338-340.
Barrel, B. G., Bankier, A. T., and Drovin, J. (1979). A different genetic code in human
mitochondria. Nature 282: 189-194.
Barrell, B. G., Anderson, S., Bankier, A. T., De Bruijn M. H. L., Chen, E., Coulson, A. R.,
Drouin, J., Eperon, I. C., Nierlich, D. P., Roe, B. A., Sanger F., Schreier, P. H., Smith,
A. J. H., Staden, R., and Young, I. G. (1980a). In 31st Mosbach Colloquium on
Biological Chemistry of Organelle Formation, pp 11-25. Springer-Verlag, Berlin.
Barrell, B. G., Anderson, S., Bankier, A. T., De Bruijn, M. H. L., Chen, E., Coulson, A. R.,
Drouin, J., Eperon, I. C., Nierlich, D. P., Roe, B. A., Sanger F., Schreier, P. H., Smith,
A. J. H., Staden, R., and Young, I, G. (1980b). Different pattern of codon recognition
by mammalian mitochondrial tRNAs. Proc. Natl. Acad. Sci. USA. 77: 3164-3166.
Battey, J. and Clayton, D. A. (1980). The transcription map of human mitochondrial DNA
implicates transfer RNA excision as a major processing event. J. Biol. Chem. 255:
11599-11606.
Bell, B. R., McDaniel, B. T., and Robinson, O. VV. (1985). EtTects of cytoplasmic inheritance
on production traits of dairy cattle. J. Dairy Sci. 68: 2038-2051.
Bermingham, E., Land, T. E., and Avise, J. C. (1986). Size polymorphism and heteroplasmy
in the mitochondrial DNA of lower vertebrate. J. Hered. 77: 249-252.
Bernardi, G., Carnevali, F., Nicolaieff, A., Piperno, G., and Tecce, G. (1968). Separation and
characterization of a satellite DNA from a yeast cytoplasmic "petite" mutant. J. Mol.
Biol. 37: 493-505.
Bhat, K. S., Bhat, N. K., Kulkaini, G. R., Lyengar, A., and Avadhani, N. G. (1985).
Expression of the cytochrome-b-URF6-URF5 region of the mouse mitochondrial
genome. Biochemistry 24: 5818-5825.
Bhat, N. K., Niranjan, B. G., and Avadhani, N. G. (1981). The complexity of mitochondrial
translation products in mammalian cells. Biochem. Biophys. Res. Comm. 103: 621-628.
42
Bibb, M. J., Van Etten, R. A., Wright, C. T., Walberg, M. W., and Clayton D. A. (1981).
Sequence and gene organization of mouse mitochondrial DNA. Cell 26; 167-180.
Blanc, H., Wright, C. T., Bibb, M J., Wallace, D. C., and Clayton, D. A. (1981).
Mitochondrial DNA of chloramphenicol-resistant mouse cells contains a single nucleotide
change in the region encoding 3' end of large ribosomal RNA. Proc. Natl. Acad. Sci.
USA. 78: 3789-3793.
Bogenhagen, D. F. and Clayton, D. A. (1974). The number of mitochondrial
deoxyribonucleic acid genomes in mouse L and human Hela cells: Quantitative isolation
of mitochondrial deoxyribonucleic acid. J. Biol. Chem. 249: 7991-7995.
Bogenhagen, D. F. and Insdorf, N. F. (1988). Purification of
/at'vv.v mitochondrial
RNA polymerase and identification of a dissociable factor required for specific
transcription. Mol. Cell. Biol. 8: 2910-2916.
Bogenhagen, D. F., Insdorf, N. F., Whitford, T., and Morvillo, M. (1990). Regulation of
nucleic acid synthesis in Xenopii.s /acvis oocytes. Florida Winter Organelle Meetings
Abstracts, page 2.
Borst, P. (1977), Structure and function of mitochondrial DNA. Tr. Biochem. Sci. 2: 31-34.
Boursot, P., Yonekawa, H., and Bonhomme, F. (1987). Heteroplasmy in mice with deletion
of a large coding region of mitochondrial DNA. Mol. Biol. Evol. 4: 46-55.
Brennicke, A., and Clayton, D, A. (1981). Nucleotide assignment of alkali-sensitive sites in
mouse mitochondrial DNA. J. Biol. Chem. 256: 10613-10617,
Brown, D. R,, DeNise, S, K,, and McDaniel, M. F. (1987). Phenotypic variation in
respiratory metabolism and complementation of murine hepatic mitochondria. Theor.
Appl. Genet. 75: 189-193.
Brown, D. R., Koehler, C. M., Lindberg, G. L., Freeman, A. E., Mayfield, J. E., Myers, A.
M., Schutz, M. M., and Beitz, D. C. (1989). Molecular analysis of cytoplasmic variation
in cows. J. Anim. Sci. 67: 1926-1932.
Brown, G. G. and DesRosier, L. J. (1983). Rat mitochondrial DNA polymorphism:
Sequence analysis of a hypervariable site for insertions/deletions. Nucleic Acids Res. 11:
6699-6708.
Brown, W. M. (1981). Mechanisms of evolution in animal mitochondrial DNA. Ann. N. Y.
Acad. Sci. 361: 1 19-134.
Brown, W. M. and Vinograd. (1974). Restriction endonuclease cleavage maps of animal
mitochondrial DNAs. Proc. Natl. Acad. Sci. USA. 71: 4617-4621.
43
Brown, VV. M., George, Jr. M, and Wilson, A. C. (1979). Rapid evolution of animal
mitochondrial DNA. Proc. Natl. Acad. Sci. USA. 76: 1967-1971.
Brown, W. M., Prager, E. M, Wang, A., and Wilson, A. C. (1982). Mitochondrial DNA
sequences of primates: Tempo and mode of evolution. J. Mol. Evol. 18: 225-239.
Bunn, C. L., Wallace, D. C., and Eisenstadt, J. M. (1974). Cytoplasmic inheritance of
chloramphenicol resistance in mouse tissue culture cells. Proc. Natl. Acad. Sci. USA 71:
1681-1685.
Buroker, N. E., Brown, J. R., Gilbert, T A., O'Hara, P. J., Beckenbach, A. T., Thomas, W.
K., and Smith, M. J. (1990). Length heteroplasmy of sturgeon mitochondrial DNA: an
illegitimate elongation model. Genetics 124: 157-163.
Buzzo, K., Pouts, D. C., and Wolstenholme, D. R. (1978). EcoR I cleavage site variants of
mitochondrial DNA molecules from rats. Proc. Natl. Acad. Sci. USA. 75: 909.
Cann, R. L., Stoneking, M., and Wilson, A. C. (1987). Mitochondrial DNA and human
evolution. Nature 325: 31-36.
Cantatore, P. Attardi, G. (1980). Mapping of the nascent light and heavy strand transcripts
on the physical map of Hela cell mitochondrial DNA. Nucleic Acids Res. 8: 2605-2625.
Cantatore, P., Roberti, M., Rainaldi, G., Gadaleta, M. N., and Saccone, C. (1989). The
complete nucleotide sequence, gene organization, and genetic code of the mitochondrial
genome of Paracentrotus lividus. J. Biol. Chem. 264: 10965-10975.
Chang. D. D. and Clayton, D. A. (1984). Precise identification of individual promoters for
each strand of human mitochondrial DNA. Cell 36: 635-643.
Chang. D. D. and Clayton, D. A. (1985). Priming of human mitochondrial DNA replication
occurs at the light-strand promoter. Proc. Natl. Acad. Sci. USA. 82: 351-355.
Chang. D. D. and Clayton, D. A. (1987a). A mammalian mitochondrial RNA processing
activity contains nucleus-encoded RNA. Science 235: 1 178-1 184.
Chang. D. D. and Clayton, D. A. (1987b). A novel endonuclease cleaves at a priming site of
mouse mitochondrial DNA replication. EMBO J. 6: 409-417.
Chomyn, A. and Attardi, G. (1987). Cytochrome Systems: Molecular biology of
bioenergetics. pp 145-152. Plenum Press, New York.
Clary, D. O. and Wolstenholme, D. R. (1985). The mitochondrial DNA molecule of
Drosophila yakuba: nucleotide sequence, gene organization, and genetic code, J. Mol.
Evol. 22: 252-271.
44
Clayton, D. A. (1982). Replication of animal mitochondrial DNA. Cell 28: 693-705.
Clayton, D. A. (1984). Transcription of the mammalian mitochondrial genome. Annu. Rev.
Biochem. 53: 573-594.
Clayton, D. A. (1991a). Replication and transcription of vertebrate mitochondrial DNA.
Annu. Rev. Cell Biol. 7: 453-478.
Clayton, D. A. (1991b). Nuclear gadgets in mitochondrial DNA replication and transcription.
Tr. Biol. Sci. 16: 109-1 11.
Clayton, D. A. and Vinograd, J. (1967). Circular dimer and catenate forms of mitochondrial
DNA in human leukaemic leukocytes. Nature 216: 652-657.
Dams, E., Hendriks, L., Van de Peer, Y., Neefs. J.-M., Smits, G., Vandenbempt, I., and De
Wachter, R. (1988). Compilation of small ribosomal subunit RNA sequences. Nucleic
Acids Res. 16: rS7-rl73.
Dawid, I. B. (1972). Evolution of mitochondrial DNA sequences in Xenopus. Dev. Biol. 29:
139-151.
Denslow, N. D., Anders, J. C., and O'Brien, T. W. (1991). Bovine mitochondrial ribosomes
posses a high affinity binding site for guanine nucleotides, J. Biol. Chem. 266: 95869590.
Denslow, N. D., Michales, G. S., Montoya, J., Attardi, G., and O'Brien, T. W. (1989).
Mechanism of mRNA binding to bovine mitochondrial ribosomes. J. Biol. Chem. 264:
8328-8338.
Densmore, L. D., Wright, J. VV., and Brown, VV. M. (1985). Length variation and
heteroplasmy are frequent in mitochondrial DNA from parthenogenetic and bisexual
lizards (genus, Cnemidophorus). Genetics 110: 689-707.
Desjardins, P. and Morais, R. (1990). Sequence and gene organization of the chicken
mitochondrial genome. A novel gene order in higher vertebrates. J. Mol. Biol. 212: 599634.
Doerson, C.-j., Guerrier-Takada, C., Altman, S., and Attardi, G. (1985). Characterization of
an RNAse P activity from Hela cell mitochondria: comparison with the cytosol RNAse P
activity. J. Biol. Chem. 260: 5942-5949.
Dzapo, v., Reuter, H., and Wassmuth, R. (1973). Heterosis and mitochondrial
complementation. Z. Tierzuchtg. Zuchtgbiol. 90: 169-180.
45
Dzapp, V. and VVassmuth, R. (1983). Mitochondrial metabolism and heterotic effects in pigs.
Results of a reciprocal crossbreeding e.xperiment. II. Activity of oxygen uptake of cells
and oxidative phosphorylation in heart, liver and scrotal mitochondria. Z. Tierzuchtg.
Zuchtgbiol. 100: 280-295.
Dzievviecki, C, and Kolataj, A. (1980). Atmung von lebermitochondrien in anwesenheit von
verschiedener substraten bei reirassinger hiihnern und ihren beiderseitigen kreuzungen. Z.
Tierzuchtg. Zuchtgbiol. 97:50-57.
Eberly, S. L., Locklear, V., and Spremulli, L. L. (1985). Bovine mitochondrial ribosomes:
Elongation factor specificity. J. Biochem. 260: 8721-8725.
Efstratiadis, A., Posakony, J. \V., Naniatis, T., Lawn, R. M., O'Connell, C., Spritz, R. A.,
DeRiel, J. K,, Forget, B. G., Weissman, S. M., Slightom, J. L., Blechl, A. E., Smithies,
O., Baralle, F. E., Shoulders, C. C., and Proudfoot, N. J. (1980). The structure and
evolution of the human (3-globin gene family. Cell 21: 653-668.
Emtage, J. L. T. and Jensen, R. E. (1993). MAS6 encodes an essential inner membrane
component of the yeast mitochondrial protein import pathway. J. Cell. Biol. 122: 10031012.
Epron, I. C., Anderson, S., and Nierlich, D. P. (1980). Distinctive sequence of human
mitochondria! ribosomal RNA genes. Nature 286: 460-467.
Ernster, L. and Schatz, G. (1981). Mitochondria: a historical review. J. Cell Biol. 91: 227255,
Farabaugh, P. J., Schmeissner, U., Hofer, M., and Miller, J. H. (1978). Genetic studies of the
lac repressor. VII. On the molecular nature of the spontaneous hotspots of Escherichia
coli. J. Mol. Biol. 126: 847-863.
Faust, M. A., Robinson, 0. W., and McDaniel, B. T. (1989). The effects of cytoplasm on
reproduction and production in Holsteins. J. Dairy Sci. 72(Suppl. 1): 52 (Abstr.).
Ferril, S. D., Sage, R. D., Prager, E. M., Ritter, U., and Wilson, A. C. (1983), Mitochondrial
DNA evolution in mice. Genetics 105: 681-721.
Fisher, R. P. and Clayton, D. A. (1985). A transcription factor required for promoter
recognition by human mitochondrial RNA polymerase. Accurate initiation at the heavyand light-strand promoters dissected and reconstituted in vitro. J. Biol Chem, 260:
11330-11338,
Fisher, R. P, and Clayton, D. A. (1988). Purification and characterization of human
mitochondrial transcription factor 1. Mol, Cell, Biol, 8: 3496-3509.
46
Fisher, R. P., Lisovvsky, T., Breen, G. A. M,, and Clayton, D. A. (1991). A rapid, efficient
method for purifying DNA-binding proteins: Denaturation-renaturation chromatography
of human and yeast mitochondrial extracts, J. Biol. Chem. 266; 9153-9160,
Fisher, R. P., Parisi, M. A., and Clayton, D. A. (1989). Flexible recognition of rapidly
evolving promoter sequences by mitochondrial transcription factor 1. Genes Dev. 3:
2202-2217.
Fisher, R. P., Topper, J. N., and Clayton, D. A. (1987). Promoter selection in human
mitochondria involves bending of a transcription factor to orientation-independent
upstream regulatory elements. Cell 50: 247-258.
Fukanaga, M. and Yielding, K. L. (1979). Fate during cell growth of yeast mitochondrial and
nuclear DNA after photolytic attachment of the monoazide analog of ethydium.
Biochem. Biophys. Res. Comniun. 90: 582-588.
Gadaleta, G., Pepe, G., De Candia, G., Quagliariello, C., and Sbisa, E. (1989). The complete
nucleotide sequence of the Rains iiorvcgiciis mitochondrial genome: cryptic signals
revealed by comparative analysis between vertebrates. J, Mol. Evol. 28: 497-516.
Gelfand, R. and Attardi, G. (1981). Synthesis and turnover of mitochondrial ribonucleic acid
in Hela cells: The mature ribosomal and messenger ribonucleic acid species are
metabolically unstable. Mol. Cell. Biol. 6: 487-51 1.
Glick, B. C. and Schatz, G. (1991). Import of proteins into mitochondria. Annu. Rev. Genet.
25: 21-44.
Gray, M. VV. (1989). Origin and evolution of mitochondrial DNA. Annu. Rev. Cell Biol. 5:
25-50.
Gresson, R. A. R. (1940). Presence of the sperm middle-piece in the fertilized egg of the
mouse (h'lus niiisciihis). Nature 145: 425
Grivell, L. A. (1989). Nucleo-mitochondrial interactions in yeast mitochondrial biogenesis.
Eur. J. Biochem. 182: 477-493.
Grun, P. (1976). Cytoplasmic Genetics and Evolution. Columbia Univ. Press, New York.
Guteli, R. R. and Fox, G. E. (1988). A compilation of large subunit RNA sequences
presented in a structural format. Nucl. Acids. Res. 16: rl75-r269.
Gyllensten, U., Wharton, D., and Wilson, A. C. (1985). J. Hered. 76: 321-324.
Gyllensten, U., Wharton, D., Josefsson, A., and Wilson, A. C. (1991). Paternal inheritance of
mitochondrial DNA in mice. Nature 352: 255-257.
47
Harrison, R. G., Rand, D. M., and VVeeler, W. C. (1985). Mitochondrial DNA size variations
within individual crickets. Science 228:1446-1448.
Harrison, R. G., Rand, D. M., and Wheeler, VV. C. (1987). Mitochondrial DNA variation in
field crickets across a narrow hybrid zone. Mol. Biol. Evol. 4: 144-158.
Hartl, F. U. and Neupert, W. (1990). Protein sorting to mitochondrial: evolutionary
conservations of folding and assembly. Science 247: 930-938.
Hauswirth, VV. VV. and Laipis, P. J. (1982). Mitochondrial DNA polymorphism in a maternal
lineage of Holstein cows. Proc. Natl. Acad. Sci. USA. 79: 4686-4690.
Hauswirth, VV. VV., Laipis, P. J., Gilman, M. E., O'Brien, T. VV., Michaels, G. S., and
Rayfield, M. A. (1980). Genetic mapping of bovine mitochondrial DNA from a single
animal. Gene 8: 193.
Hauswinh, VV. VV., Van de VValle, M. J., Laipis, P. J., and Olivo, P. D. (1984).
Heterogeneous mitochondrial D-loop sequences in bovine tissue. Cell 37: 1001-1007.
Hayashi, J -I, Yonekavva, H., Gotoh. O., VVatanabe, J., and Tagashira, Y. (1978). Strictly
maternal inheritance of rat mitochondrial DNA. Biochem. Biophys. Res. Commun. 83:
1032-1038.
Hayashi, J.-L, Ohta, S., Kagawa, Y., Takai, D., Miyabayashi, S., Tada, K., Fukushima, H.,
Inui, K., Okada, S., Goto, Y., and Nonaka, L (1994). Functional and morphological
abnormalities of mitochondria in human cell containing mitochondrial DNA with
pathogenic point mutations in tRNA genes. J. Biol. Chem. 269: 19060-19066.
Hayashi, J.-I., Tagashira, Y., and Yoshida, M. C. (1985). Absence of extensive
recombination between inter- and intraspecies mitochondrial DNA in mammalian cell.
Expt. Cell Res. 160: 387-395.
Hixson, J. E. and Brown, VV. M. (1986a). A comparison of the small ribosomal RNA genes
from the mitochondrial DNA of the great apes and human: Sequence, structure, evolution
and phylogenetic implications. Mol. Biol. Evol. 3: 1-8.
Hixson, J. E. and Clayton, D. A. (1985). Initiation of transcription from each of the two
human mitochondrial promoters requires unique nucleotides at the transcriptional start
sites. Proc. Natl. Acad. Sci. USA. 82: 2660-2664.
Hixson, J. E., Wong, T. W., and Clayton, D. A. (1986b). Both the conserved stem-loop and
divergent 5'-flanking sequences are required for initiation at the human mitochondrial
origin of light-strand DNA replication. J. Biol. Chem. 261: 2384-2390.
48
Hoeh, VV. R., Blakley, K. H., and Brown, W. M. (1991). Heteroplasmy suggests limited
biparental inheritance of A/vV/Vz/.v mitochondrial DNA. Science 251: 1488-1490.
Hoffman, R. J., Boore, J. L., and Brown, \V. M. (1992). A novel mitochondrial genome
organization tor the blue mussel Myiiliis ediihs. Genetics 131: 397-412.
Hoke, G. D., Pavco, P. A., Ledwith, B. J., and Van Tuyle, G. C. (1990). Structural and
functional studies of rat mitochondrial single strand DNA binding protein PI 6. Arch.
Biochem. Biophys. 282: 1 16-124.
Holt, 1. J., Harding, A. E., and Morgan-Hughes, J. A. (1988). Deletions of muscle
mitochondrial DNA in patient with mitochondrial myopathies. Nature 331: 717-719.
Holt, 1. J., Harding, A. E., Petty, R. K. H., and Morgan-Hughes, J. A. (1990). A new
mitochondrial disease associated with mitochondrial DNA heteroplasmy. Am. J. Hum.
Genet. 46: 428-433.
Holt, 1. J., Miller, D. H., and Harding, A. E. (1989). Genetic heterogeneity and
mitochondrial DNA heteroplasmy in Leber's hereditary optic neuropathy. J. Med. Genet.
26: 739-743.
Huizinga, H. A., Korver, S., McDaniel, B. T. (1986). Maternal effects due to cytoplasmic
inheritance in dairy cattle. Influence on milk production and reproductive traits. Livest.
Prod. Sci. 15: 11-26.
Hutchison, C. A., Newbold, J. E., Potter, S. S., and Edgell M. H. (1974). Maternal
inheritance of mammalian mitochondrial DNA. Nature 251: 536-538.
Insdorf N. F. and Bogenhagen, D. F. (1989a). DNA polymerase y from
/ac'VAv.I.
The identification of a high molecular weight catalytic subunit by a novel DNA
polymerase photolabeling procedure. J. Biol. Chem. 264: 21491-21497.
Insdorf N. F. and Bogenhagen, D. F. (1989b). DNA polymerase y from Xenopi/s kievis. II.
A 3'^5' e.xonuclease is highly associated with the DNA polymerase activity. J. Biol.
Chem. 264: 21498-21503.
Jacob, S. T. (1974). Expression of purified mitochondrial poly(A) polymerase of hepatomas
by an endogenous primer from liver. Biochim. Biophys. Acta 361: 312-320.
Jacob, S. T., Rose, K. M., and Munro, H. N. (1976). Response of poly(A) polymerase in rat
liver nuclei and mitochondrial to starvation and refeeding with amino acids. Biochem. J.
158: 161-167.
49
Jacobs, H. T., Elliott, D. J., Math, V. B., and Farquharson, A. (1988). Nucleotide sequence
and gene organization of sea urchin mitochondria DNA. J. Mol. Biol. 202: 185-217.
Johnston, S. D. (1991). Sequence heterogeneity of bovine mitochondrial ribosomal RNA
genes. MS. Thesis, Iowa State University. Ames, lA.
Kaguni, L. S. and Olson, M. W. (1989). Mismatch-specific 3'->5' exonuclease associated
with the mitochondrial DNA polymerase from Drosophila embryos. Proc. Natl. Acad.
Sci. USA. 86; 6469-6473.
Kaguni, L. S., Wernette, C. M., Conway, M. C., and Cashman, P. Y. (1988). Structural and
catalytic features of the mitochondrial DNA polymerase from Drosophila niclanogaster
embryos. Cancer Cells 6: 425-432.
Karwan, R., Bennett, J. L., and Clayton, D. A. (1991). Nuclear RNAse MRP processes
RNA at multiple discrete sites: interaction with an upstream G box is required for
subsequent downstream cleavages. Genes. Dev. 5: 1264-1276.
Kiebler, M., Keil, P., Schneider, H., van der Kiei, I., Pfanner, N., and Neupert, W. (1993).
The mitochondrial receptor complex: a central role of MOM22 in mediating transfer of
preproteins from receptors to the general insertion pore. Cell 74: 483-492.
Kiebler, M., Pfaller, R., Sollner, T., Griffith, G., Horstmann, H., Pfanner, N., and Neupert, W.
(1990). Identification of a mitochondrial receptor complex required for recognition and
membrane insertion or precursor proteins. Nature 348: 610-616.
Kobayashi, Y., Sharpe, H., and Brown, N. (1994). Single-cell analysis of intercellular
heteroplasmy of mtDNA in Leber Hereditary Optic Neuropathy. Am. J. Hum. Genet. 55:
206-209.
Koehler, C. M. (1989). Molecular characterization of bovine mitochondrial DNA. M.S.
Thesis, Iowa State University. Ames, lA.
Koehler, C. M., Lindberg, G. L., Brown, D. R., Beitz, D. C., Freeman, A. E., Mayfield, J. E.,
and Myers, A. M. (1991). Replacement of bovine mitochondrial DNA by a sequence
variant within one generation. Genetics 129: 247-255.
Kozac, M. (1983). Comparison of initiation of protein synthesis in prokaryotes, eucaryotes,
and organelles. Microbiol. Rev. 47: 1-45.
Kroon, A. M., de Vos, W. M., and Bakker, H. (1978). The heterogeneity of rat-liver
mitochondrial DNA. Biochim. Biophys. Act. 519: 269-273.
50
Kunkel, T. A. and Mosbaugh, D. \V. (1989). Exoniicleolytic proofreading by a mammalian
DNA polymerase y. Biochemistry 28: 988-995.
Kunkel, T. A. and Soni, A. (1988). E.xonucleolytic proofreading enhances the fidelity of
DNA synthesis by chicken embr\'o DNA polymerase-y. J. Biol. Chem. 263: 4450-4459.
Laipis, P. J., Van de Walle, M J., and Hauswirth, W. \V. (1988). Unequal partitioning of
bovine mitochondrial genotypes among siblings. Proc. Natl. Acad. Sci. USA. 85: 81078110.
Lawrence, J. VV., Raynor, L., Xie, F., Neims, A., and Rowe, T. C. (1990). Florida Winter
Organelle Meetings Abstracts, page 56.
Levvin, B. (1994). Genes V. pp741-748. Oxford University Press, Cambridge.
Liao, H.-X. and Spremulli, L. L. (1989). Interaction of bovine mitochondrial ribosomes with
messenger RNA. J. Biol. Chem. 264: 7518-7522.
Liao, H.-X. and Spremulli, L. L. (1990a). Effects of length and mRNA secondary structure
on the interaction of bovine mitochondrial ribosomes with messenger RNA. J. Biol.
Chem. 265: 11761-11765.
Liao, H.-X. and Spremulli, L. L. (1990b). Identification and initial characterization of
translation initiation factor 2 from bovine mitochondria. J. Biol. Chem. 265: 1361813622.
Liao, H.-X. and Spremulli, L. L. (1991). Initiation of protein synthesis in animal
mitochondria. J. Biol. Chem. 266: 20714-20719.
Lindberg, G. L. (1989). Sequence heterogeneity of bovine mitochondrial DNA. Ph.D.
dissertation. Iowa State University, Ames, lA.
Lindberg, G. L., Shank B. B., Rothschild, M. F., Mayfield, J. E., Freeman, A. E., Koehler, C.
M., and Beitz, D. C. (1989). Characteristics of mammary mitochondrial in lines of mice
genetically divergent from milk production. J. Dairy Sci. 72: 1175-1 191.
Marres, C. A. M., Van Loon, P. G. M., Gudshoorn, P., Van Steeg, H., Grivell, L. A., and
Slater, E. C. (1985). Nucleotide sequence analysis of the nuclear gene coding for
manganese superoxide dismutase of yeast mitochondrial, a gene previously assumed to
code for the Rieske iron-sulphur protein. Eur. J. Biom. 147: 153-161.
Martens, P A, and Clayton, D, A. (1979). Mechanism of mitochondria! DNA. replication in
mouse L-cells: localization and sequence of the light-strand origin of replication. J. Mol.
Biol. 135: 327-351.
51
McDaniel, R. G. and Grimwood, B. G. (1971). Hybrid vigor in drosophila: Respiration and
mitochondrial energy conservation. Comp. Biochem. Physiol. 38B: 309-314.
Moczi<o, M, Dietmeier, K., Soliner, T., Segui, B., Steger, H. F., Neupert, W., and Pflanner,
K. (1992). Identification of the mitochondrial receptor complex in .v. cercvi.siae. FEBS
Lett. 310: 265-268.
Monnerot, M., Mounolou, J. C., and Soiignac, M. (1984). Intra-individuai length
heterogeneity of Ra/ia esciilenla mitochondrial DNA. Biol. Cell 52: 213-218.
Montoya, J., Christianson, T., Levins, D., Ravinowitz, M., and Attardi, G. (1982).
Identification of the initiation sites for heavy-strand and light-strand transcription in
human mitochondrial DNA. Proc. Natl. Acad. Sci. USA. 79: 7195-7199.
Montoya, J., Gaines, G. L., and Attardi, G. (1983). The pattern of transcription of the human
mitochondrial rRNA genes reveals two overlapping transcription units. Cell 34: 151-159.
Morin, G, B. and Cech. T. R. (1988). Phylogenetic relationships and altered genome
structures among Tetrahymena mitochondrial DNAs. Nucleic Acids Res. 16:327-346.
Neefs, J.-M., Van de Peer, Y., Hendriks, L., and De Wachter, R. (1990). Compilation of
small ribosomal subunit RNA sequences. Nucleic Acids Res. 18: 2237-2317.
Nelson, D. (1987). Biogenesis of mammalian mitochondria. Curr. Top. Bioenerg. 15: 221272.
Ojala, D., Crews, S., Montoya, J., Gelfand, R., and Attardi, G. (1981). A small
polyadenylated (7S RNA), containing a putative ribosome attachment site, maps near the
origin of human mitochondrial DNA replication. J. Mol. Biol. 150: 303-314.
Ojala, D., Merkel, .C., Gelfand, R., and Attardi, G. (1980). The tRNA genes punctuate the
reading of genetic information in human mitochondrial DNA. Cell. 22: 393-403.
Olivo, P. 0., Van de Walle, M. J., Laipis, P. J., and Hauswirth, W. W. (1983). Nucleotide
sequence evidence for rapid genotypic shifts in the bovine mitochondrial DNA D-loop.
Nature 306: 400-402.
Pastores, G. M., Santorelli, F. M., Shanske, S., Gelb, B. D., Fyfe, B., Wolfe, D., and Willner,
J. P. (1994). Leigh syndrome and hypertrophic cardiomyopathy in an infant with a
mitochondrial DNA point mutation (T8993G). Am. J. Med. Genet. 50: 265-271.
Pfaller, R., Steger, H. F., Rassow, J., Pfanner, N., and Neupert, W. (1988). Import pathways
of precursor proteins into mitochondria: Multiple receptor sites are followed by a
common membrane insertion site. J. Cell Biol. 107: 2483-2490.
52
Pfanner, N. and Neupert, VV. (1990). The mitochondrial protein import apparatus. Annu.
Rev. Biochem. 59: 331-353.
Ptanner, N., Rassovv, J., van der Klei, 1. J., and Neupert, W. (1992). A dynamic model of the
mitochondrial protein import machinery. Cell 68: 999-1002.
Piko, L. and Matsumoto, L. (1976). Number of mitochondria and some properties of
mitochondrial DNA in the mouse egg. Dev. Biol. 49: 1-10.
Piko, L. and Taylor, K. D (1987). Amounts of mitochondrial DNA and abundance of some
mitochondrial gene transcripts in early mouse embryos. Dev. Biol. 123: 364-74.
Piko, L., Blair, D. G., Tyler, A,, and Vinograd, J., (1968). Cytoplasmic DNA in the
unfertilized sea urchin egg: physical properties of circular mitochondrial DNA and the
occurrence of catenated forms. Proc. Natl. Acad. Sci. USA. 59: 838-845.
Piko, L., Tyler, A., and Vinograd, J. (1967). Amount, location, priming capacity, circularity
and other properties of cytoplasmic DNA in sea urchin eggs. Biol. Bull. 132: 68-90
Polosa, P. L. and Attardi, G. (1991) Distinctive pattern and translational control of
mitochondria protein synthesis in rat brain synaptic endings. J. Biol. Chem. 266: 1001110017.
Potter, S. S., Nevvbold, J. E., Hutchison, C. A., and Edgell, M. H. (1975). Specific cleavage
analysis of mammalian mitochondrial DNA. Proc. Natl. Acad. Sci. USA. 72: 4496.
Proudfoot, N. J. and Brovvnlee, G. G. (1976). 3' Non-coding region sequences in eukaryotic
messenger RNA. Nature 263: 211-214.
Rand, D. M. and Harrison, R. G. (1986). Mitochondrial DNA transmission genetics in
crickets. Genetics 114: 955-970.
Rand, D. M. and Harrison, R. G. (1989). Molecular population genetics of mtDNA size
variation in crickets. Genetics 121:551-569.
Reich, E. and Luck, D. J. L. (1966). Replication and inheritance of mitochondrial DNA.
Proc. Natl. Acad. Sci. USA. 55: 1600-1608.
Robin, E. D. and Wong, R. (1988). Mitochondrial DNA molecules and virtual number of
mitochondria per cell in mammalian cells. J. Cell. Phys. 136: 507-413.
Roe, B. A., Ma, D.-P., Wilson, R. K., and Wong J. F.-H. (1985). The complete nucleotide
sequence of the Xenopi/.s ktevis mitochondrial genome. J, Biol. Chem. 260: 9759-9774.
Sancar, A. and Sancar, G. B. (1988). DNA repair enzymes. Annu. Rev. Biochem. 57: 2967.
Schatz, G. and Biitow, R. A. (1983). How are proteins imported into the mitochondria? Cell
32: 316-318.
Schinkel, A. H., Groot, M. J., and Tabak, H. F. (1988). Mitochondrial RNA polymerase of
SaccaromycL's ccrevisicw. composition and mechanism of promoter recognition. EMBO
J. 7: 3255-3262.
SchotTner, J. M., Lott, M. T., Lezza, A. M. S., Seibel, P., Ballinger, S. W., and Wallace, D. C.
(1990). Myoclonic epilepsy and ragged-red fiber disease (MERRF) is associated with
mitochondrial DNA tRNA' " mutation. Cell 61: 931-937.
Schutz, M. M., Freeman, A. E., and Beitz, D. C., and Mayfield, J. E. (1992). The
importance of maternal lineage on milk production of dair>' cattle. J. Dairy Sci. 75: 13311341.
Schutz, M. M,, Freeman, A. E., Lindberg, G. L., and Beitz, D. C. (1993). Effect of maternal
lineages grouped by mitochondrial genotypes on milk yield and composition. J. Dairy
Sci. 76: 621-629.
Schutz, M. M., Freeman, A. E., Lindberg, G. L., Koehler, C. M., and Beitz, D. C. (1994).
Effect of mitochondrial DNA on milk production and health in dairy cattle. Livest. Prod.
Sci. 37: 283-291.
Segui-Real, B., Stuart, R. A., and Neupert, W. (1993). Transport of proteins into the various
subcompartments of mitochondria. FEBS Lett. 313:2-7.
Shine, J. and Dalgarno, L. (1974). The 3'-terminal sequence of Escherichia coli 16S
ribosomal RNA: Complementarity to nonsense triplets and ribosome binding sites. Proc.
Natl. Acad. Sci. USA. 71: 1342-1346.
Snyder, M., Fraser, A. R., Lakoche, J., Gartner-Kepkay, K. E., and Zouros, E. (1987).
Atypical mitochondrial DNA from the deep-see scallop Placopcctcn magcUanicus. Proc.
Natl. Acad. Sci. USA. 84: 7595-7599.
Solignac, M., Genermot, J., Monnerot, M., and Mounolou, J. C. (1984). Mitochondrial
genetics of Drosophila: mtDNA segregation in heteroplasmic strains ofD. mauhtiam.
Mol. Gen. Genet. 197: 183-188.
Solignac, M., Genermot, J., Monnerot, M., and Mounolou, J. C. (1987). Drosophila
mitochondrial genetics: Evolution of heteroplasmy through germ line cell divisions.
Genetics 117: 687-696.
54
Solignac, M., Monnerot, M., and iVIounoIou, J. C. (1983). Mitochondrial DNA heteroplasmy
'm DrosophUa niaiiriiiaiiu. Proc. Natl. Acad. Sci. USA. 80: 6942-6946.
Seller, T., Griffith, G., Pfaller, R., and Neupert, W. (1989). MOM 19, an import receptor for
mitochondrial precursor proteins Cell 59: 1061-1070.
Seller, T., Pfaller, R., GritTith, G., Pfanner, N., and Neupert, VV. (1990). A mitochondrial
import receptor for the ADP/ATP carrier. Cell 62: 107-115.
Soiler, T., Rassow, J., VViedmann, M., Schlossmann, J., Keil, P., Neupert, W., and Pfanner, N.
(1992). Mapping of the protein import machinery in the mitochondrial outer membrane
by crosslinking of translocation intermediates. Nature 355: 84-87.
Srere, P. A. (1982). The structure of the mitochondrial inner membrane-matrix
compartment. Trends Biochem. Sci. 7: 375-378.
Strisinger, G., Okada, Y., Emrich, J., Newton, J., Tsugita, A., Terzaghi, E. and Inouye, M.
(1966). Frameshift mutations and the genetic code. Cold Spring Harbor Symp. Quant.
Biol. 31: 77-84.
Stryer, L. (1995). Biochemistry, pp 529-556. W. H. Freeman and Company, New York.
Ticho, B. S. and Getz, G. S. (1988). The characterization of yeast mitochondrial RNA
polymerase. J. Biol. Chem. 263: 10096-10103.
Tomkinson, A. E., Bonk, R. T., Kim, J., Bartfeld, N., and Linn, S. (1990). Mammalian
mitochondrial endonuclease activities specific for ultraviolet-irradiated DNA. Nucleic
Acids Res. 18: 929-935.
Topper, J, N., And Clayton, D. A. (1989). Identification of transcriptional regulatory
elements in human mitochondrial DNA by linker substitution analysis, Mol. Cell. Biol. 9:
1200-1211.
Tzagoloff, A. (1988). Mitochondria. Plenum Press, New York.
Upholt, W. B., and Dawid, I, B. (1977). Mapping of mitochondrial DNA of individual sheep
and goats: Rapid evolution in the D-loop region. Cell 1 1: 571-583.
Veltri, K. L., Espiritu, M., and Singh, G. (1990). Distinct genomic copy number in
mitochondria of different mammalian organs. J. Cell. Phys. 143: 160-164.
Walberg, M. W and Clayton, D. A. (1981). Sequence and properties of the human KB cell
and mouse L cell D-loop regions of mitochondrial DNA. Nucleic Acids Res. 9: 54115421.
55
Wallace, D. C. (1992). Mitochondrial genetics. A paradigm for aging and degenerative
disease. Science 256; 628-632.
Wallace, D. C. (1993). Mitochondrial diseases: Genotype versus phenotype. Tr. Genet. 9:
128-133.
Warrior, R. and Gall, J. (1986). The mitochondrial DNA of Hydra alleiiiiaia and Hydra
Uttoralis consists of two linear molecules. Arch. Sc. Genev. 38: 439-445.
Watanabe, T., Hayashi, Y., Semba, R., and Ogasavvara, N. (1985). Bovine mitochondrial
DNA polymorphism in restriction endonuclease cleavage patterns and the location of the
polymorphic sites. Biochem. Genet. 23: 947-957.
Watson. J. D. and Crick, F. H. C. (1953). Molecular structure of nucleic acid. A structure
for deoxyribose nucleic acid. Nature 171: 964-967.
Williams, R. S. (1986). Mitochondrial gene expression in mammalian striated muscle:
Evidence that variation in gene dosage is the major regulatory event. J. Biol. Chem. 261:
12390-12394.
Wilson, A. C., Carlson, S. S., and White, T. J. (1977). Biochemical evolution. Annu. Rev.
Biochem. 46: 573-639.
Wolanis, M., Dzapo, V., and Wassmuth, R. (1980). Determination of biochemical
parameters of energy metabolism and their relationship with vitality, fattening
performance and carcass quality of sheep. II. Respiration and oxidative phosphorylation
of isolated diaphragm mitochondria. Z. Tierzuchtg. Zuchtgbiol. 97: 28-36.
Wolstenholme, D. R., MacFarlane, J. L., Okimoto, R., Clary, D. O., and Wahleithner, J. A.
(1987). Bizarre tRNAs inferred from DNA sequences of mitochondrial genomes of
nematode worms. Proc. Natl. Acad. Sci. USA. 84: 1324-1328.
Wong, T. W. and Clayton, D. A. (1985a). Isolation and characterization of a DNA primase
from human mitochondria. J. Biol. Chem. 260: 11530-11535.
Wong, T. W. and Clayton, D. A. (1985b). In vitro replication of human mitochondrial DNA:
Accurate initiation at the origin of light-strand synthesis. Cell 42: 951-958.
Wong, T. W. and Clayton, D. A. (1986). DNA primase of human mitochondria is associated
with structural RNA that is essential for enzymatic activity. Cell 45: 951-958.
Yaginoma, K., Kobayashi, M., Taira, M., and Koike, K. (1982). A new RNA polymerase
and in vitro transcription from rat mitochondrial DNA. Nucleic Acids Res. 10: 75317542.
56
SEQUENCE HETEROPLASMY OF D-LOOP AND rRNA CODING
REGIONS IN MITOCHONDRIAL DNA FROM HOLSTEIN COWS OF
INDEPENDENT MATERNAL LINEAGES
A paper to be submitted to The Proceedings of the National Academy of Science USA
Jianming Wu, Renotta K. Smith, A. E. Freeman,
Gary L. Lindberg, Ben T. McDaniel, and Donald C. Beitz
Abstract
Mitochondrial DNA (mtDNA) D-loop and rRNA coding regions of two Holstein cows
from each of 18 maternal lineages were cloned and sequenced to determine the presence of
hypervariable sites and the existence of heteroplasmic mtDNA. Seventeen sites of nucleotide
sequence variations were observed within D-loop and rRNA coding regions. The hypervariable
sites in the D-loop and rRNA coding regions were located at nt 169, 216, and 1594 and between nt
352 to 364. Heteroplasmic mtDNA was detected within D-loop and rRNA coding regions of
mtDNA within independent maternal lineages. The presence of heteroplasmic mtDNA in cattle of
the same maternal lineages suggests that mtDNA of one genotype could have been maintained for
at least 11 generations in their respective maternal lineages. Because heteropiasmy was observed
frequently and seemingly is persistent, selected amplification of specific mtDNA may not be a part
of mtDNA inheritance. The mechanism of mtDNA deletions and insertions is proposed.
57
Mutations by transversions, insertions, and deletions invariably occurred at the end or within
nucleotide homopolymers in the D-loop and rRNA coding regions.
Introduction
Bovine mitochondrial DNA (mtDNA) consists of 16338 base pairs and codes for two
rRNAs, 22 tRNAs, and 13 polypeptides. Mitochondria carry multiple copies of double-stranded
circular DNA that is replicated and e.xpressed within the organelle, and it is believed that
mammalian mtDNA is inherited maternally (1,2). The complete sequence of mtDNA has been
determined for cattle, humans, mice, and toads (3-7); however, apart from the mode of maternal
inheritance, segregation and transmission of mtDNA are not well understood. Variation in
nucleotide sequences of mtDNA can affect mitochondrial function. Use of genetically divergent
animals has confirmed genetic influences on mitochondrial enzyme activities and oxidative
phosphorylation. For example, different rates of oxygen consumption have been observed for
mitochondria of different genotypes of Drosophila, rabbits, sheep, chicken, mice, and swine (8-13).
Recent data indicate that 5% of within-herd variation in total amount of milk fat and milk fat
percentage of dairy cattle is associated with maternal lineages as defined by mtDNA genotype (14).
Moreover, maternally inherited diseases such as mitochondrial myopathy, encephalopathy, lactic
acidosis and stroke-like episode, Kearns-Sayre syndrome, Leber's hereditary optic myopathy, and
other mitochondrial myopathies are caused by mtDNA deletions and point mutations (15, 16).
Estimates based upon restriction fragment length polymorphisms (RFLP) in mtDNA of humans
and other mammals indicated that mtDNA mutates at a rate of perhaps 10 times that of nuclear
58
DNA (17). This rate would be an underestimate if mtDNA polymorphisms are manifestations only
of heritable mutations.
Theoretically, any animal that has a mtDNA mutation must be heteroplasmic or possess
more than one type of mtDNA at some point in time. The heteroplasmic state is defined as a
mixture of mtDNA sequence variants that exist within a single mitochondrion, a single cell, or a
single animal. For mutant mtDNA to be predominant in future generations, different types of
mutant mtDNA must separate from the majority of parental mtDNA molecules to become the sole
or dominant mitochondrial genomes in germ cells of successive generations. Despite the great
volume of mammalian mtDNA data, most of the known examples of large scale, within-species
polymorphisms and heteroplasmy of mtDNA occurs in insects, fishes, scallops, toads, lizards, and
humans (18-23). The mechanism of transmission of heteroplasmic mtDNA and the mechanism of
segregation of these genomes are not known. Ashley et al. (24) reported the rapid segregation of
heteroplasmic bovine mitochondria by following the transmission of a single heteroplasmic mtDNA
mutation by using RPLP analysis through four generations of Holstein cows and suggested that a
return to homoplasmy may occur within only two or three generations. By using RFLP analysis,
the replacement of bovine mtDNA by a sequence variation can occur within one generation (25).
It is considered that the evolution of heteroplasmic mtDNA is rapid, based on data obtained fi-om
RFLP analysis.
For over 20 years, it has been assumed that mtDNA has an exclusively maternal mode of
inheritance in animals. However, evidence of paternal inheritance of mammalian mtDNA has
begun to emerge (26).
59
Our hypothesis is tiiat inheritance of mtDNA may be the result of random passing from
ancestor to progeny instead of the result of selection. Therefore, the study was designed to
determine the nucleotide sequence variation sites in D-loop and rRNA coding regions, to
analyze the phenomenon of heteroplasmy (different types of mtDNA exist within an individual
animal), and to investigate the characteristics of bovine mtDNA inheritance.
We report here for the first time that multiple heteroplasmic mtDNA states within the Dloop and rRNA coding regions of mtDNA existed extensively in Holstein cows. Heteroplasmy
was found in independent maternal lineages by determining the mtDNA sequences of different
clones {rom the same cows. One mtDNA genotype observed in some Holstein cows could have
been maintained for more than 11 generations in the maternal lineages. Hypervariable sites in the
D-Ioop and rRNA coding regions are located at nt 169, 216, and 1594 and between nt 352 and
364. Deletions, insertions, and transversions were found within or at the end of nucleotide
homopolymers. Different types of mtDNA from the same cow were found to differ by as many as
three sites within the D-loop and rRNA coding regions. Therefore, it is concluded that the mtDNA
population within an individual animal is a mixture of different mitochondrial genotypes of mtDNA
and that mutations could accumulate on the same mtDNA molecule at many different sites.
Furthermore, because heteroplasmy was observed frequently and seemingly is persistent, selected
amplification of specific mtDNA may not be a part of mtDNA inheritance.
61)
Materials and Methods
Thirty-six Hoistein cows were from 18 maternal lineages (two cows from each maternal
lineage), which were from two research herds owned by the North Carolina Department of
Agriculture (NCDA) and one herd by North Carolina State University (NCSU). One NCDA herd
was established in about 1981 from cows purchased in the northeastern region of the United
States, and the other NCDA herd was started in 1950 with cows from an older herd plus a few
from another herd that has been dispersed since then. The NCSU herd was established in 1922
from cattle purchased in the state of Pennsylvania. Cows were traced by female lineages to
common female ancestors in the Hoistein Herd Book.
Four hundred milliliters of whole blood were taken from each cow via jugular
venipuncture, and the red blood cells were lysed hypotonically with an equal volume of 10 mM
KHCOj, 150 mM NH4CI, and 1 mM EDTA. The treated blood was centrifriged at 1400 xg, and
the resulting leukocyle pellets were transported on dry ice within 24 hours from North Carolina to
Iowa State University. Mitochondrial DNA was isolated from the leukocytes as described by
Brown et al. (27). The 4.3 kilobase (kb) fragment obtained from P.stl-Sacl enzymatic digestion of
mtDNA was cloned into the multiple cloning site of the pUCl 19 phagemid vector, and E. coli
strain TGI was transformed. Out of many recombinant clones obtained from each cow, two
clones were chosen randomly for flirther analysis.
Single-stranded DNA (ssDNA) template was prepared by infecting E. coli containing
recombinant phagemid with M13K07 helper phage and subsequent recovery of phage particles by
precipitation with 20% polyethylene glycol. Pure ssDNA was obtained by phase extraction of
61
phage particles with organic solvents followed by ethanol precipitation. Nucleotide sequencing
was performed by the dideoxy chain termination method with [a-"'S] dATP incorporation (USB
Sequenase Version 2.0 sequence kit, USB, Cleveland, OH). Twelve oligonucleotide primers were
used for the DNA sequencing reactions. The oligonucleotide primers and their locations on bovine
mtDNA are listed in Table 1. DNA fragments were separated by electrophoresis on a 6%
polyacrylamide gel, transferred to blotting paper, dried under vacuum, and exposed to Kodak XOmat AR film for approximately 24 hours at room temperature.
For studies of mutagenesis in bacteria, recombinant clones were inoculated into 10 ml of
LB medium (28) containing 50 |.ig/m! ampicillin and grown to an OD goo of 1.0 (passage 1). A 0.1
Table 1.
5' nt'
Oligonucleotide primers for D-loop and rRNA coding region sequence analysis.
D-loop region
5' nt'
rRNA coding region
496
5' GGGGTGTAGATGCTTGC 3'
694
5' ACTCCTGTTAGCTTGGG3'
355
5' GGGGCCTGCGTTTAT 3'
809
5' CTAGTAGTACTCTGGCG 3'
155
5' CTGGTGCTCAAGATG 3'
1120
5' TCTTCCCATTTCATAGG 3'
16305
5' GACCGTTTTAGATGAGA 3'
1328
5' ACTTGTCTCCTCTCAGT 3'
16151
5' TCTAATGGTAAGGAAT 3'
1536
5' TTAGATTTCTATTCTCC 3'
1760
5' CTTACAAATCTTCTCAC 3'
2755
5' CCTATTGTCGATATGG 3'
"The 5' nucleotide indicates the startin" nucleotide of a primer, which is numbered as by Anderson
etai (4).
62
ml aliquot was inoculated into 10 ml of fresh LB medium (ampicillin 50 |.ig/ml) and grown to an
ODcoo of 1.0 (passage 2); subsequent further "passages" were generated by inoculating 0.1 ml into
10 ml of fresh LB medium. After the eighth passage, ssDNA was prepared, and the nucleic acid
sequence was determined as described previously to determine the stability of recombinant clones.
Results
Seventeen nucleotide sequence variants among 18 maternal lineages were observed within
the D-loop and rRNA coding regions of mtDNA (Table 2). Four types of mutations (insertions,
deletions, transitions, and transversions) were found in D-loop and rRNA coding regions. Among
17 nucleotide variations, transitions (purine to purine or pyrimidine to pyrimidine) were the most
frequent events; 11 instances of substitutions were transitions. These transition substitutions all
occurred in the D-loop region. Two deletion and three insertion sites were observed in the D-loop
and rRNA coding regions. Two transversions (purine to pyrimidine or pyrimidine to purine) were
observed. Among all the variations, transition from adenine to guanine at nt 169, cytosine insertion
at nt 216, transversion from cytosine to guanine at nt 364, length variation of cytosine
homopolymer between nt 352 and 364, and deletion of adenine at nt 1594 were the most common
mutation events and sites.
Mitochondria! DNA heteroplasmy could be defined by at least three criteria: 1) mtDNA
differences among females within a maternal lineage, 2) mtDNA differences among different tissues
within an individual, and 3) mtDNA differences within a tissue of an individual. In this study,
63
Table 2.
Summary of nucleotide variations in the D-loop and rRNA coding regions of
bovine mtDNA.
Sites"
Substitution events''
Numbers of lineages
with the substitution
Numbers of cows
across lineages
364'
C->G transversion
11
17
1677
T->A transversion
1
1
216'
C insertion
17
33
C deletion or insertion
12
18
352-364'
1062
A insertion
2
3
1594'
A deletion
13
20
169'
A-^G transition
12
16
364
C-»T transition
1
1
16022
G—>A transition
2
3
16050
C-^T transition
2
4
16057
G-»A transition
1
1
16135
T->C transition
J
4
16141
T-^C transition
1
1
16196
G—>A transition
2
2
16200
G^A transition
2
2
16231
C->T transition
1
1
16247
C->T transition
3
4
" Nucleotide numbering according to Anderson et al.{A).
'' Nucleotide on left side of arrow is replaced by that on right.
" Hypervariable sites.
64
heteroplasmic cows refer to cows that contain different types of mtDNA in the same tissue.
Multiple clones of mtDNA from individual animals revealed mtDNA heteroplasmy within animals
at eight sites (Table 3). The most frequent heteroplasmic site was polycytosine between nt 352 and
364; sixty-seven percent of cows surveyed were heteroplasmic at this region. The percentage of
cows that were heteroplasmic at other sites ranged from 6% to 50% (Table 3). Although the
nucleotide substitution at nt 169 occurred at high frequently (44%), no evidence ofheteroplasmy
was found at this site.
Table 3.
Sites within mtDNA where heteroplasmy within cows has been observed.
Sites and events
Number of cows with
the substitution'
Heteroplasmic cow
with the nucleotide
substitution
17
Percentage of
heteroplasmic
cows'*
2
12
2
6
18
12
67
1062 A insertion
3
1
33
1594 A deletion
20
5
25
16050 C—>T transition
4
1
25
16135 T->T transition
4
1
25
16200 G—>A transition
2
1
50
364 C-^G transversion
216 C insertion
352-364 C deletion
or insertion
Thirty-six cows in 18 maternal lineages were examined.
''Percentage of the heteroplasmic cows is defined as number of heteroplasmic cows over the total
number of cows with the substitution.
65
The most trequent transversion was cytosine to guanine at nt 364 at the end of a
homopolymer of cytosines in the D-loop region. Mitochondrial DNA of 17 cows from 11
maternal lineages possessed this kind of substitution. Another transversion was located at nt 1677,
which was also at the end of a homopolymer of adenine within the 16S rRNA coding region.
Table 4 shows the common features of the transversions at nt 364 and 1677, the insertions at nt
216 and 1062, the deletion at nt 1594, and the variation of the length of polycytosines between nt
352 and 364. These events occurred either at the end of homopolymers or within the A and C
homopolymers.
Table 4.
Neighboring homopolymer sequences of transversion, deletion, and insertion
mutation sites
Mutation sites (Region)
Event
Neighboring sequence""
(D-loop)
C^G transversion
G-'^"GCCCCCCCCCCCCe®'
(16S rRNA)
T—>A transversion
a'"° acaaaatgaatttta"^^^
(D-loop)
C insertion
A''"TATATCCCCCCTTCA^'^
1062
(12S rRNA)
A insertion
C'"''"TA A A A AGGAAAAAAAGTA'"^*^
1594
(16S rRNA)
A deletion
A'^^AAGAAAAAAACTAAAG'®^
(D-loop)
C insertion or deletion
g''"gccccccccccccc'^
364
1677
216
352-364
" Bold face and underlined letters indicate the nucleotide transversion site or insertion and deletion
regions.
66
The nature and transmission of mtDNA were studied by the analysis of heteroplasmic
mtDNA derived from animals within the same maternal lineages. Two cattle in maternal lineage
10126 were sisters, but they possessed mtDNA with differing nucleotide substitutions (Table 5).
Heteroplasmic cow 4167 had two types of mtDNA: one with substitutions at nt 216, 364, and
1594; another with substitutions at nt 216 and 364. The other cow in the same maternal lineage
had one type of mtDNA with substitutions at nt 169, 1594, and 16200. This observation means
that the dam of two cows might have had a mixture of three types of mtDNA, unless numerous
substitutions occurred in daughter cows.
Both cows in maternal lineage 79171 were heteroplasmic (Table 6), and had three different
types of mtDNA that differed at two sites. Cow 1968 had one type of mtDNA with substitutions
Table 5.
Mitochondrial DNA heteroplasmy within a maternal lineage and within individual
animals.
Cow number^
Clone number
4167
46.4
216
364
46.7
216
364
4239
Substitution sites'*'
1594
_
47.4
169
1594
16200
47.7
169
1594
16200
" Heteroplasmic cow 4167 and cow 4239 are sisters in the maternal lineage (lineage 10126).
'' Substitution sites are the specific nucleotides that were different from the published sequence
by Anderson el al. (4).
Different substitution sites among clones were at nt 216, 364, 169, 1594, and 16200,
67
Table 6.
Mitochondrial DNA heteroplasmy within a maternal lineage and within individual
animals.
Cow number'
Clone number
1968
40.2
169
216
40.6
169
216
1594
41.3
169
216
1594
41.6
169
216
1594
2138
Substitution sites''"
16050
16050
16050
Heteroplasmic cow 1968 and 2138 were two and three generation descendants of the same dam,
respectively (lineage 79171).
Substitution sites are the specific nucleotides that were different from the published sequence
by Anderson et al. (4).
" Different substitution sites among clones were at nt 1594 and 16050.
at nt 169, 216, and 16050. Cov^' 2318 in the same maternal lineage had another type of mtDNA
with substitutions at nt 169, 216, and 1594. Both cows also had one common type of mtDNA in
which all the substitutions (at nt 169, 216, 1594, and 16050) found were exactly the same, but the
two different types of mtDNA in two different cows of the same lineage were not only different
from the common type of mtDNA but also differed from each other at two sites (nt 1594 and
16050).
Table 7 shows that the heteroplasmic cow 1907 in maternal lineage 70080 had two
different types of mtDNA. One type of mtDNA had substitutions at nt 216 and 1594, and the
other had substitutions at nt 216 and 364. Two types of mtDNA differed at two sites (at nt 364
68
Table 7.
Mitochondrial DNA heteroplasmy within a maternal lineage and within individual
animals.
Cow number''
Clone number
1907
49.7
216
49.9
216
50.4
216
1594
50.8
216
1594
2064
Substitution sites'^ ''
1594
364
Cow 2064 and heteroplasinic cow 1907 were four- and five-generation descendants of the same
dam, respectively (lineage 70080).
Substitution sites are the specific nucleotides that were different from the published sequence
by Anderson et al. (4).
Different substitution sites among clones were at nt 364 and 1594.
and 1594). Cow 2064 in the same lineage only had one type of mtDNA with substitutions at nt
216 and 1594. Both cows still had one common type of mtDNA.
In maternal lineage 89109 (Table 8), the heteroplasmic cow 2094 had one type of mtDNA
with substitutions at nt 364 and 16247, and another with substitutions at nt 16247, 1062, and 1594.
Two different types of mtDNA differed at three sites (nt 364, 1062, and 1594) within the same
cow. The other cow in the same maternal lineage had one type of mtDNA with substitutions at nt
1062, 1594, and 16247. Two cows in the same lineage still had one common type of mtDNA after
seven generations, The observations suggest that one type of mtDNA might not change sequence
within the D-loop and rRNA coding regions after seven generation and that the different
substitutions could occur on the other type of mtDNA repeatedly or simultaneously.
69
Table 8.
Mitochondrial DNA iieteroplasmy within a maternal lineage and within individual
animals.
Cow number''
Clone number
2118
43.43
1062
1594
16247
43.44
1062
1594
16247
2094
59.21
59.22
Substitution sites'' "
364
16247
1062
1594
16247
' Cow 2118 and heteroplasmic cow 2094 were seven- and four-generation descendants of the
same dam, respectively (lineage 89109),
'' Substitution sites are the specific nucleotides that were different from the published sequence
by Anderson ct a/. (4).
Different substitution sites among clones were at nt 364, 1062, and 1594.
Table 9 shows that both cows in lineage 59002 were heteroplasmic; they had one type of
mtDNA with substitutions at nt 16022 and 16050 and another type with substitutions at nt 216,
16022, and 16050. The mtDNA of both cows was not different, and two cows were seven- and
11-generation descendants of the same dam, respectively. Even though there were other
substitution sites on mtDNA molecules, exactly the same two types of mtDNA still existed in cows
after seven and 11 generations, which suggests that the heteroplasmic mtDNA were inherited from
a common ancestor of the two cows. Alternatively, the same mutations could have arisen at
different points in the lineage. It is unlikely, however, that the same nucleotide substitutions could
occur in the same way 11 generations later.
In the maternal lineage 59500 (Table 10), two cows were nine- and 11-generation
descendants of the same dam and still had a common type of mtDNA with substitutions at nt
70
Table 9.
Mitochondrial DNA heteroplasmy within a maternal lineage and within individual
animals.
Cow number'
Clone number
Substitution sites'' '^
2888
11.13
16022
16050
16022
16050
16022
16050
16022
16050
11.18
3240
216
12.14
12.19
216
Heteroplasmic cows 2888 and 3240 were seven- and 11-generation descendants of the same
dam, respectively (lineage 59002).
Substitution sites are the specific nucleotides that were different from the published sequence
by Anderson et a/. (4),
Different substitution sites among clones were at nt 216.
Table 10.
Mitochondrial DNA heteroplasmy within a maternal lineage and within individual
animals.
Cow number'
Clone number
1972
29.50
216
29.58
216
55.6
216
1594
55.10
216
1594
3451
Substitution sites'"'""
1594
16135
16135
16200
16135
Heteroplasmic cows 1972 and 3451 were nine- and 11-generation descendants of the same dam,
respectively (lineage 59500).
'' Substitution sites are the specific nucleotides that were different from the published sequence
by Anderson ei ciL (4).
"Different substitution sites among clones were at nt 1594, 16135, 16200.
71
216, 1594, and 16135. Cow 1972 had another type of mtDNA with substitutions at nt 216 and
16135. Cow 3451 had the other copy of mtDNA with substitutions at nt 216, 1594, and 16200.
There were three different sites between two different types of mtDNA from two cows in the same
maternal lineage (nt 1594, 16135, and 16200).
Table 11 shows that cow 4324 in maternal lineage 10177 was heteroplasmic; it had one
type of mtDNA with substitutions at nt 216 and 364 and another type with substitution at nt 216,
364, and 1594. The other cow in the same lineage had only one type of mtDNA with substitutions
at nt 216 and 364. Two cows were 10- and 11-generation descendants of the same dam; and they
still had one type of mtDNA with substitutions at nt 216 and 364 in common.
Table 11.
Mitochondrial DNA heteroplasmy within a maternal lineage and within individual
animals.
Cow number'
Clone number
4324
53.6
216
364
53.9
216
364
54.6
216
364
54.9
216
364
4307
Substitution sites'' '"
1594
' Cow 4307 and heteroplasmic cow 4324 were 10- and 11-generation descendants of the same
dam, respectively (lineage 10177).
'' Substitution sites are the specific nucleotides that were different from the published sequence
by Anderson et al. (4).
Different substitution sites among clones were at nt 1594.
72
Within all the maternal lineages in which the heteroplasmic cows have been found, except
for maternal lineage 10126, cows in the same maternal lineage had one common type of mtDNA
even after three, five, seven, nine, 10, and 11 generations.
To confirm that the indication of heteroplasmy is not artifactual, 10 recombinant clones
were passaged in LB medium for eight generations. No changes were found in nucleotide
sequences of the D-loop and rRNA coding regions of mtDNA in these recombinant clones.
Discussion
In mammals, mitochondrial heredity is predominantly maternal, and heteroplasmy can be
generated only by mutations affecting the female mtDNA. After the occurrence of a mutation in a
mtDNA molecule, a heteroplasmic state must exist for at least some time if the mutant mtDNA
molecule is maintained through subsequent generations. Very often, RFLP analysis fails to detect
this intra-individual heterogeneity. The heteroplasmic state depends on mutation frequency and
whether the mutation remains in the mtDNA as opposed to the mutant type not remaining in the
organism. Because it has been detected rarely, the heteroplasmic state has been thought to be
fugacious. The inheritance of heteroplasmy has been studied for Drosophila and crickets (29, 30).
For crickets, no substantial variation in the level of heteroplasmy was noted in 10 single-generation
offspring from heteroplasmic individuals. In a more extensive study of Drosophila, the distribution
of mtDNA genotypes among individuals was consistent with an unbiased stochastic partitioning of
heteroplasmic genotypes at each maternal generation (31). Despite the high mtDNA mutation rate.
73
which implies a need for heteroplasmy during the transition from one genotype to another, very
few examples of such a state have been reported in higher animals.
Hauswirth ct a/. (32) first reported heterogeneous length of a polycytosine run between nt
352 and 364 within the nitDNA D-loop sequence in bovine tissue. It has been found that 67% of
cows surveyed in this study were heteroplasmic at the polyc>losine region between nt 352 and 364
of the mtDNA D-Ioop. Therefore, this polycytosine region of mtDNA variation between nt 352
and 364 is not a useflil genetic marker. It has been reported that a substantial shift in the
percentage of heteroplasmy at nt 364 could occur within a single generation, and it has been
suggested that a return to homoplasmy may occur in only two or three generations (24). Koehler
et al. (25) reported replacement of bovine mtDNA by a sequence variant at the same site (nt 364)
within one generation, but they only used the RFLP analysis to detect homoplasmic states. In the
latter instance, these authors failed to find heteroplasmic cattle as intermediates in the genetic
fixation process.
A significant amplification both in number of mitochondrial genotypes and in mtDNA
content occurs during follicular development of a specific oocyte. For example, Piko and
Matsumoto (33) calculated that the mature mouse oocyte contains 100-1000 times more mtDNA
than is found in somatic cells. Hauswirth and Laipis (34) also found 100-fold more in mtDNA in
mature bovine oocytes than in undeveloped ones. Also, a limited number of genotypes of mtDNA
may be used as templates for DNA amplification during oocyte development, and certain types of
mtDNA may be amplified more than others. But, the heteroplasmic state still should exist
persistently in the fijily developed embryo, even though the profile of mtDNA genotypes is
74
changed. It is a reasonable assumption that the mtDNA with the C to G transversion at nt 364
already has existed in the cattle gemi line for a long time because the majority (11 out of 18)
maternal lineages surveyed contained mtDNA with this variation. Therefore, it is possible that the
either one of two types of mtDNA with variations at nt 364 could be amplified to a predominant
level so that the other type of mtDNA could not be detected easily by insensitive methods like
RFLP analysis. This observation might explain the phenomenon of replacement of one type of
mtDNA genotype with another within one generation, which was reported by Koehler el al. (25).
Persistent heteroplasmy also has been found in humans where mtDNA deletions or point
mutations are associated with maternal inherited disorders (35-38). It has been argued that
selection may exist for one of the two variants because, in most instances, the severity of disease
positively or negatively correlates with the degree of heteroplasmy. Thus, one sequence variant is
likely to result in nonfijnctional or partly functional mitochondria, providing selection for the fijlly
fijnctional alternative sequence.
If more clones from each individual animal were chosen and longer mtDNA regions were
sequenced, it seems reasonable that more heteroplasmic sites and animals could have been found.
Therefore, the absolute percentage of heteroplasmic dairy cattle could be greater than what we
observed. Furthermore, the absolute homoplasmic state may exist rarely in dairy cattle. In one
instance, two clones from the same cow differed at three sites (cow 2094 in maternal lineage
89109). To accumulate three substitutions on a specific mtDNA molecule in successive
generations, heteroplasmic states of certain types of mtDNA might be maintained for a long period
of time. No mechanism seems to exist to eliminate the once dominant mtDNA genotypes
75
completely from mtDNA populations because cows in the same maternal lineage had one common
type of mtDNA even after three, five, seven, nine, 10, and 11 generations. Therefore, the mtDNA
population in a specific animal would be a mixture of different genotypes if more genetic markers
are used because random passing of mtDNA from mother to progeny seems to be the primary
mechanism of mtDNA inheritance. This explanation also could explain why persistent
heteroplasmy exists in a human pedigree that manifests mtDNA disorders.
We suggest that heteroplasmy exists extensively in individual dairy cattle, but the
percentage of a specific type of mtDNA genome in the total population of mtDNA may be so
variable that it is difficult to detect all genotypes or that the detection of different individual animals
with different mtDNA genotypes in successive generations could be missed easily. This difficulty
will result in an underestimation of heteroplasmy and an overestimation of mtDNA segregation
rates. Moreover, hypervariable sites within D-loop and rRNA coding regions are located at nt 169,
216, 364, and 1594 and between nt 352 and 364. If substitutions at these sites are easily reversible
in the maternal lineage, another question that should be answered is whether all these hypervariable
sites are suitable as genetic markers in studying the genetics of mtDNA alone. Up to now, all the
published papers related to the mtDNA segregation transmission of heteroplasmic cows have not
used the nt 364 cytosine-to-guanine transversion as a genetic marker. Therefore, it is questionable
that a single hypervariable marker could be used to estimate the segregation rate of different types
of mtDNA, even though almost all the heteroplasmic cows we surveyed had one identical copy of
mtDNA to that of the other cows in the same maternal lineages even after 11 generations, and the
mtDNA seemed fairly stable at these hypervariable sites. We strongly suggest, therefore, that
76
multiple genetic markers should be used to calculate the rate of segregation and transmission of
mtDNA.
All transversions, insertions, and deletions that we found in D-loop and rRNA coding
regions occurred in the homopolymer regions of mtDNA (Table 4). One instance of transition
from cytosine to thymine also occurred at nt 364. The reference sequence (4) contains six
sequential cytosines around nt 216, 12 cytosines around nt 364, five adenines around nt 1062,
seven adenines around nt 1594, and four adenines around nt 1677. This finding suggests that the
origin of sequence variation could have a common mechanism. The occurrence of small deletion
or insertion mutations usually correlates with the presence of repeated bases in the DNA sequence.
Streisringer et a/. (39) suggested that runs of repeated nucleotides can promote mutations by
allowing relatively stable heteroduplexes to form when complementary DNA strands are
misaligned. In this instance, such misalignment on the variable regions of D-loop and rRNA coding
regions could occur via DNA strand slippage during the replication of the run of different
nucleotides. Relatively stable duplexes resulting from such events would be generated if slippage
occurred only within the run of homopolymeric nucleotides or if the misalignment extended into
the nearby runs of other nucleotides. Following a subsequent cycle of DNA replication, a mutated
mtDNA molecule with insertion, deletion, or transversion would be generated. Actually, Brown
and DesRosier (40) found the variation of thymine runs in Rattus norvegiciis. In this study, the
most common sites of deletions, insertions, and transversions in D-loop and rRNA coding regions
are exclusively either within or at the end of homopolymer regions. Therefore, our data provide
77
additional evidence that replication slippage could be the mechanism to cause some of bovine
mtDNA mutations.
This research was supponed in part by BARD Research Project No. US-1519-88 of the
United States - Israel Binational Agricultural Research and Development Fund of the United States
Department of Agriculture and by 21st Century Genetics Cooperation. Journal Paper No. J-16072
of the Iowa Agriculture and Home Economics Experiment Station, Ames, lA, Project No. 3020.
References
1.
Hutchison, C. A., Newbold, J. E., Potter, S. S. & Edgell M. H. (1974) Nature
(London) 251, 536-538.
2.
Gray, M, W. (1989) Annu. Rev. Cell Biol. 5, 25-50.
3.
Anderson, S., Bankier, A. T., Barrel, B. G., DeBruijn, M. H. L., Couison, A. R.,
Drouin, J., Eperon, I. C., Nierlich, D. P., Roe, B. A., Sanger F., Schreier, P. H.,
Smith, A. J. H., Staden, R. & Young, I. G. { 1 9 S \ ) N a t u r e ( L o n d o n ) 290, 457-465.
4.
Anderson, S., DeBruijn, H. L., Couison, A. R., Drouin, J., Eperon, I. C., Sanger F. &
Young I. G. (1982)./. Mol. Biol 156, 683-717.
5.
Bibb, M. J., Van Etten, R. A., Wright, C. T., Walberg, M. W. & Clayton D. A. (1981)
Cell 26, 167-180.
6.
Roe, B. A., Ma, D.-P., Wilson, R. K. & Wong J. F.-H. (1985),/. Biol. Chem. 260,
9759-9774.
7.
McDaniel, R. G. & Grimwood, B. G. (1971) Comp. Biochem. Physiol. 38B, 309-314.
8.
Dzapo,
v., Reuter, H. & Wassmuth, R. (1973) Z
Tierzuchtg. Ztichtghiol. 90, 169-
180.
9.
Dziewiecki, C. & Kolataj, A. (1980) Z Tierzuchtg. Zuchtgbiol. 97, 50-57.
78
10.
Wolanis, M., Dzapo, V & Wassnuith, R. (1980) Z. Tierziichl^. Zuvht^hiol. 97, 28-36.
11.
Brown, D. R., DeNise, S. K. & McDaniel, M. F. (1987) Thcor. Appl. Genet. 75, 189193.
12.
Lindbery, G. L., Shank B. B., Rothschild M F., Maytleld, J. E., Freeman, A. E.,
Koehler, C. . & Beitz, D. C. (1989)./ Dairy Sci. 12, 1175-1191.
13.
Dzapp, V. & VVassmuth, R. (1983) Z Tierzuchtg. ZuchtghioL 100, 280-295
14.
Schutz, M. M., Freeman, A. E., Lindberg, G. L. & Beitz, D. C. (1993) J. Dairy Sci.
76,621-629.
15.
Wallace, D. C. (1992) Science 256, 628-632.
16.
Wallace, D. C. (1993) 7'r. Genet. 9, 128-133.
17.
Brown, VV. M., George, Jr. M. & Wilson, A. C. (1979) Proc. Nail. Acad Sci. USA 76,
1967-1971.
18.
Harrison, R. G., Rand, D. M. & Weeler, W. C. (1985) Science 228, 1446-1448.
19.
Bermingham, E., Land, T. E. & Avise, J. C. (1986) J. Hered. 77, 249-252.
20.
Snyder, M, Fraser, A. R., Lakoche, J., Gartner-Kepkay, K. E. & Zouros, E. (1987)
Froc. Nail. Acad. Sci. [ISA 84, 7595-7599.
21.
Monnerot, M., Mounolou, J. C. & Solignac, M. (1984) Bio/. Cell 52, 213-218.
22.
Densmore, L. D., Wright, J. W. & Brown, W. M (1985) Genetic.s 110, 689-707.
23.
Holts, I. J., Harding, A. E. & Morgan-Hughs, J. A. ( 1 9 8 S ) N a t u r e ( L o n d o n ) 331, 717719.
24.
Ashley, M. V., Laipis, P. J. & Hauswirth, W. W. (1989) Nucleic Acid.s Res. 17, 73257331.
25.
Koehler, C. M., Lindberg, G. L., Brown, D. R., Beitz, D. C., Freeman, A. E.,
Mayfield, J. E., & Myers, A. M. (1991) Genetic.n 129, 247-255.
26.
Gyllensten, U., Warton, D., Josefsson, A., & Wilson, A. C. (1991) A'i7///re (London)
352, 255-257.
27.
Brown, D. R., Koehler, C. M., Lindberg, G. L., Freeman, A. E., Mayfield, J. E.,
Myers, A. M., Schutz, M. M. & Beitz, D. C. (1989) J. Anini. Sci. 67, 1926-1932.
7')
28.
Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) in Molecular (lo/iing: A
laboratory niamial (New York: Cold Spring Harbor Laboratory Press), p. A. 1.
29.
Solignac, M, Monnerot, M. & iVIounolou, J. C. (1983) Proc. Nail. Acad Sci. USA
80, 6942-6946.
30.
Harrison, R. G., Rand, D. M. & Wheeler, W. C. { \ 9 S 1 ) M o l . B i o l . K v o l . 4, 144-158.
3 1.
Solignac, M., Genermot, J., Monnerot, M & Mounolou, J. C. (1984)/V/o/. Gen.
Genet. 197, 183-188.
32.
Hausvvirth, VV. W., Van de Walie, M. J., Laipis, P. J. & Olive, P. D. (1984) Cell 31,
1001-1007.
33.
Piko, L. & Matsumoto, L. (1976) Dev. Bid. 49, 1-10.
34.
Hausvvirth, VV. VV. & Laipis, P. J. (1982) Proc. Nail. Acad. Sci. USA 79, 4686-4690.
35.
Holt, L J., Harding, A. E. & Morgan-Hughes, J. A. (1988) Nature (Lottdon) 331, 717719.
36.
Holt, L J., Harding, A. E., Petty, R. K. H. & Morgan-Hughes, J. A. (1990)/I/??. J.
Hum. Genet. 46, 428- 433.
37.
Holt,
38.
Schoffner, J. M., Lott, M. T., Lezza, A. M. S., Seibel, P., Ballinger S. W. & Wallace,
D. C. (1990) Cell 61, 931-937.
39.
Strisinger, G., Okada, Y., Emrich, J., Newton, J., Tsugita, A., Terzaghi, E. & Inouye,
M. (1966). Cold Sprii!}^ Harbor Symp. Oiiant. Biol. 31, 77-84.
40.
Brown, G. G. & DesRosier, L. J. (1983). Nucleic Acid.s Res. 11, 6699-6708.
J., Miller, D. H. & Harding, A. E. (1989) J. Med. Genet. 26, 739-743.
8(»
SEQUENCE VARIATIONS IN tRNA AND PROTEIN
CODING GENES OF BOVINE mtDNA
A paper to be submitted to Genetics
Jianming Wu, A. Eugene Freeman, Gary L. Lindberg, and Donald C. Beitz
Abstract
The tRNA and protein coding regions of bovine mtDNA, which includes genes of COIII,
tRNA'^'^ ND3, tRNA '^s, ND4L, ND4, tRNA'"", tRNA'^^ and tRNA'"' and portion of ND5 and
ATPase subunit 6 from 13 cows were cloned and sequenced. Four different nucleotide
substitutions were detected in these regions. The first substitution was a transition from G to A at
nt 12023 within the T-loop of the tRNA''^ coding region. Only one cow had a substitution at this
site. The second substitution occurred at nt 8916 within the ATPase 6 gene; two cows had a C to
T transition at this site. The third substitution was located at nt 10349 of ND4L gene where G was
substituted by A. Two cows had this type of transition. The last substitution was a transversion at
nt 9682 where G was substituted by C within the COIII gene. All 13 cows showed exact the same
variation at nt 9682. The frequency of nucleotide substitutions in tRNA and protein coding region
was much less than that in D-loop and rRNA coding regions that was reported previously. The
transition substitution was the major type of mutation events in these tRNA and protein coding
regions. The transitions occurred at the third nucleotide of the codon or in the T-loop region of
81
tRNA and thus will not change the amino acid encoded by the codon or the overall structure of
tRNA. The transversion at nt 9682 from G to C is an exception because the conservative amino
acid is alanine in other animal species. Therefore, the "true" sequence of bovine mtDNA in cattle
population could be C at nt 9682, and the originally published sequence could have contained a
rare substitution in that cow; alternatively, there could have been a sequence divergence between
mtDNA of cows in this study and the originally published sequence. No deletions or insertions
were observed in this study. No significant difference of fijnction would be expected from all
different gene types of mtDNA within the tRNA and protein coding regions.
Introduction
The mammalian cell contains several thousand copies of a species-specific, circular
mitochondrial genome that is replicated autonomously, transcribed within the organelle, and
inherited maternally (Hutchison ct a/., 1974; Gray, 1989). Mitochondria maintain a complete
protein-synthesizing system that is physically and genetically distinct fi'om the remainder of the
c>1oplasmic system. Several components of the system, including rRNA, tRNA and mRNA, are
encoded by mitochondrial DNA (mtDNA), whereas others are nuclear gene products and must be
imported into the organelle. The majority of proteins present in mitochondria are encoded by
nuclear genes, but a small number of proteins are encoded by mtDNA and translated on
mitochondrial ribosomes (Chomyn el al., 1985; 1986). The mtDNA codes for seven subunits
(NDl, 2, 3, 4L, 4, 5, and 6) of the respiratory complex I (NADH : ubiquinone oxido reductase),
three subunits (COI, II, and III) of complex IV (cytochrome c oxidase), two subunits (ATPase 6
82
and 8) of complex V (ATP synthase), and one subunit (cyt b ) of complex III (ubiquinol:
cytochrome c oxido reductase). In addition, the nitDNA encodes large and small rRNAs and a set
of 22 tRNAs. Those mitochondrial translation products that have been identified are components
of the inner mitochondrial membrane that functions in electron transport and oxidative
phosphorylation.
Bovine mtDNA is heterogeneous in the population of dairy cattle, with many differences
being point mutations within the D-loop (Hauswirth and Laipis, 1982; Laipis et a/., 1982; Olivo et
al., 1983; Watanabe cva/., 1985; Koehler, 1989; Lindberg, 1989; Smith 1993) and rRNA coding
regions (Johnston, 1992; Wu t'/a/., 1995). This conclusion is derived from RFLP analysis and
from sequencing of mtDNA with comparison to the published bovine mtDNA sequence (Anderson
et al., 1982). This information allowed assignment of point mutations to the D-loop and rRNA
coding regions. Mutations in the D-loop may affect the abundance of mtDNA gene transcripts
subserving the ATP synthetic capacity or the size of the mtDNA population in the cell because the
origins of replication for the H-strand and L-strand of mtDNA and the transcription start site for
the H-strand are located in the D-loop region (Chang and Clayton, 1984).
Mitochondrial fijnction can be affected also by small changes in the protein coding
sequences of mtDNA. For example, yeast strains with mutations in mitochondrial genes that
encode the components of electron transport have altered mitochondrial respiratory characteristics
(Bunn et al., 1974). Studies carried out with genetically divergent animals have confirmed
genetic influences on mitochondrial enzyme activities and oxidative phosphorylation. For
example, the mitochondria with different mtDNA genotypes have different rates of oxidative
83
phosphorylation in Drosophila (McDaniel and Grimwood, 1971), rabbits (Dzapo el a/., 1973),
sheep (Wolanis et al., 1980), chickens (Dzievviecki and Kolataj, 1980), mice (Brown et al.,
1987; Lindberg et al., 1989), and swine (Dzapo and Wassmuth, 1983). It has been reported
that a specific change in mtDNA conferred resistance to chloramphenicol in a mammalian cell
line (Blanc et al., 1981).
Recently, a variety of human diseases that involve the brain, heart, skeletal muscle,
kidney, and endocrine glands have been attributed to mutations in mtDNA (Holt et al., 1988;
Holt et al., 1990; Kobayashi et al., 1994; Hayashi et al., 1994; Pastores et al., 1994). The
first pathologic mtDNA mutations identified were associated with rare human diseases such as
Leber's optic neuropathy, myoclonic epilepsy and ragged-red fiber disease, and the KearnsSayre syndrome (Wallace, 1993). Therefore, nucleotide sequence differences in tRNA and
protein coding genes of cattle could exert some effects on gene products and thus on production,
reproduction, and health traits of animals. Hiendleder er a/. (1991) found three polymorphisms
within the genes for NADH dehydrogenase subunit 5 and cytochrome b in sheep. Watanabe ei al.
(1985) found seven polymorphic restriction sites in protein and tRNA coding regions of mtDNA
from nine native Philippine cattle, but the effects of these polymorphisms are not clear. As for
dairy cattle, the extent and the types of substitutions for tRNA and protein coding regions of
mtDNA have not been documented at the nucleotide sequence level. Therefore, the purpose of
this study was to investigate the extent and type of sequence variation of bovine mtDNA including
certain tRNA and protein coding regions and to predict the effects of these nucleotide substitutions
on gene fijnction and expression of mtDNA of dairy cows.
84
Materials and Methods
Cows used in this experiment were from the Iowa State University breeding research herd
that was established in 1968 from foundation cows that were purchased from 38 sources. Most
cows were registered with the Holstein Association, and pedigree information was traceable to
1885. All cattle were traced to their earliest origins in the Holstein Herd book through maternal
lineage pedigrees (Chenery, 1885).
Approximately 400 ml of blood per animal was collected from selected cattle by jugular
venipuncture and mixed with 4 ml of 0.5 M EDTA to prevent coagulation. Erythrocytes were
lysed hypotonically with an equal volume of 10 mM KHCOj, 150 mM NH4CI, and 1 mM EDTA
solution, and Ieukoc\tes were sedimented by centrifugation (Brown et ai, 1989). The leukocytes
or white blood ceils were resuspended and lysed by the addition of Triton X-100. Nuclei were
pelleted by centriftigation, and the remaining nucleic acids in the supernatant were purified by
extraction once with chloroform ; isoamyl alcohol (24 ; 1; v : v) and twice with phenol :
chloroform : isoamyl alcohol (25 : 24 : 1; v : v : v). Total nucleic acids were precipitated in two
volumes of ethanol (Linderberg, 1989).
Mitochondrial DNA was cut by Psil and EcoRl into five fragments (1.1 Kb, 3.3 Kb, 3.6
Kb, 3.9 Kb, and 4.3 Kb), and the 3.6 Kb fragment was isolated by preparative agarose gel
electrophoresis. The 3.6 Kb fragment then was cloned into a phagemid vector (pBS SK+), which
was used to transform XLl blue E. coli cells (Sambrook et al., 1989).
Mitochondrial DNA was cut by restriction enzyme EcoRl into three fragments, and the
digested mtDNA was separated by electrophoresis in 1% agarose gel overnight at 5 V/cm. The gel
85
slice containing the 4.8 Kb fragment was excised from the agarose gel, and mtDNA was recovered
from the gel slice by using the QIAGEN DNA gel extraction protocol (QIAGEN Inc., Chatsworth,
CA). The 4.8 Kb fragment then was cloned into the EcoRl cloning site within the
cWoramphenicol-resistance gene of vector pACYC184 (ATCC 37033). E. coli DH5a was
transformed, and transformants were selected on LB media containing 10 ug/ml chloramphenicol
(Sambrook el ai, 1989). A 2.2 Kb mtDNA fragment was recovered from the recombinant
plasmid by digestion with /'.v/1 and BaniHl. The 2.2 Kb fragment was purified from agarose gel by
QIAGEN DNA extraction Kit (QIAGEN Inc., Chatsworth, CA) and subcloned into the multiple
cloning site of pUC119 in E. coli strain TGI. The recombinant clones were screened first by
white^lue selection on LB media that contained X-gal. Positive clones were confirmed by
restriction enzyme digestion, and positive clones were analyzed fijrther by production of singlestranded DNA (ssDNA) and by DNA sequencing (Sambrook el al., 1989).
Single-stranded DNA template was prepared by growth and coinfection of E. coli cells
contairting recombinant phagemid with helper phage M13K07 according to the supplier's
specification (Promega, Madison, \V1). The recombinant phage in the supernatant was precipitated
by 20% polyethylene glycol. The ssDNA was purified from the phage pellet by two phenol
extractions, two chloroform extractions, and precipitation with two volumes of ethanol. Singlestranded DNA template was annealed to the primers in the dideoxy chain-termination sequencing
reaction by using [a-'^S] dATP (USB Sequenase Version 2.0 sequence kit, USB, Cleveland, OH).
Fourteen oligonucleotide primers (primers 1 to 14) were used to obtain the DNA sequence of the
first group of four cows, and eight primers (primers 7 to 14) were used to obtain DNA sequence of
86
the other nine cows. The sequences and locations of the primers on bovine mtDNA are listed in
Table 1. Figure 1 shows the bovine mtDNA genetic map and the regions that have been sequenced
in this experiment. Sequencing reactions were applied to 6% polyacrylamide gels of
SEQUAGEL"" (National Diagnostics, Atlanta, GA). The gels were run for 4 to 6 hours at 1000
Table 1.
H-strand sequencing primers used for sequencing the tRNA and protein coding region
of bovine mtDNA.
Primer
Nucleotide number at 5' end"
Sequence of primer
1
8996
5' ATGATAAGCATGAGTTTGGT 3'
2
9399
5' TAGAAACTCCGGAAGCCAAT 3'
3
9795
5' AGCTGATTGGAAGTCAGCTG 3'
4
10198
5' CATTTATTTTATTTTAAACT 3'
5
10399
5' GTAAAATGTGAGTTGAGGAT 3'
6
10599
5' CAAATTATATTATTTTTTGA3'
7
10798
5' GTTAGGTTTTCTTTTGATAG 3'
8
10996
5' GCCAGCTAGTGTATAGAATA 3'
9
11196
5' GCTTCTACGTGAGCTTTAGG 3'
10
11400
5' ACAGAGGAGTATGCGATGAG 3'
11
11609
5' GTAGTCATCAGGTGGCTATT 3'
12
11809
5' CGAGATATTATTAATGTGGT 3'
13
12008
5' GCATAGAATTAGCAGTTCTT 3'
14
12208
5' GTGGGTAGTTGGAAGGTTT 3'
^Nucleotide numbering according to Anderson et al. (1982).
87
D-loop
V.
Bovine mtDNA
Figure 1.
00
Genetic map of bovine mitochondrial DNA. tRNA genes are represented by
the single-letter amino acid code; NDl, ND2, ND3, ND4, ND4L, ND5, and
ND6: subunits of NADH dehydrogenase; CO I, COII, and COIII: subunits of
cytochrome c oxidase; ATPase 6 and ATPase 8: subunits of H^-ATPase. The
DNA sequence betv/een nt 8783 to 12412 (numbering according to Anderson
el ai, 1982) were sequenced in this study.
88
volts. Gels were fixed in water: acetic acid : methanol (18 : 1 : 1; v : v : v) for 15 minutes, dried,
and exposed to X-ray film (Kodak X Omat AR) for 24 hours at room temperature. Ail sequences
were determined once from reactions that were run in one direction.
Results
The cloned 3.6 Kb fragment includes cytochrome c oxidase subunit III (COIII), tRNA*^"''',
NADH dehydrogenase subunit 3 (ND3), tRNA ''^ ND4L, ND4, tRNA' '", tRNA''" and tRNA'""
and part of ND5 and ATPase subunit 6 (Figure 1). Four nucleotide substitutions were found
within this 3.6 Kb mtDNA fragment. Figure 2 shows a G-to-A transition at nt 12023 within the
tRNA'^" gene as compared with the reference sequence (L-strand sequence numbering according
to Anderson ef al., 1982), which was present in one out of four cows surveyed. Figure 3 shows
the C-to-T transition at nt 8916 within ATPase subunit 6 and the C-to-T transition at nt 8916 was
found in two of 13 cows. All 13 cows varied from the reference sequence by a C transition at nt
9682 within the COIII gene (Figure 4). Two of 13 cows had a G-to-A transition at nt 10349
within the ND4L gene (Figure 5)
Overall, four substitutions were found in the 3 .6 Kb region of mtDNA from this study.
Three of them were within the protein coding region, and one was within the tRNA^" gene. Three
substitutions were transitions, and one was a transversion. No insertions and deletions were found
in tRNA and protein coding genes in this study.
89
12023A
Figure 2.
Variation at nt 12023 within tRNA'^'"^ gene of mtDNA from dairy cattle. The sequence
of L-strand is read from top to bottom with one set of G, A, T, and C lanes
representing mtDNA sequence of one cow. G at nt 12023 is substituted by A within
the tRNA'^"' gene of mtDNA from a cow indicated on the left side of the figure.
90
G A T C
Figure 3.
G A T C
Variation at nt 8916 within ATPase subunit 6 gene of mtDNA from dairy cattle. The
sequence of L-strand is read from top to bottom with one set of G, A, T, and C lanes
representing mtDNA sequence of one cow. C at nt 8916 was replaced by T on the
mtDNA from a cow indicated on the left side of the figure.
91
Figure 4.
Variation at nt 9682 within COIII gene of mtDNA from dairy cattle. The sequence of
L-strand is read from top to bottom with one set of G, A, T, and C lanes representing
mtDNA sequence of one cow. Ail 13 cows surveyed had C instead of G at nt 9682,
which is at the second base of amino acid codon where glycine was replaced by alanine
in 13 cows. The figure shows that two cows had C at nt 9682, which is different from
the published sequence by Anderson d al. (1982).
'J 2
G A T C G A T C G A T C
10349 A
Figure 5.
Variation at nt 10349 within ND4L gene of mtDNA from dairy cattle. The sequence
of L-strand is read from top to bottom with one set of G, A, T, and C lanes
representing mtDNA sequence of one cow. The G at nt 10349 is substituted by A
within the ND4L gene of mtDNA from two cows indicated on the left side of the
figure. The sequence of mtDNA from one cow, indicated on the right side of the
figure, is the same as the reference sequence (Anderson et ai, 1982).
93
Discussion
There are two types of tRNA^'"'' on the mtDNA genome. One type of tRNA^" contains a
5'-UGA-3' anticodon and recognizes the 5'-UCN-3' codon on mRNA (N represents A, U, C, or
G). The other contains a 5'-GCU-3' anticodon recognizing the 5'-AGY-3' codon (Y represents U
or C). The transition of tiie G to A occurred in the tRNA^" with the 5'-AGY-3' anticodon and
was at the T-loop of the tRNA secondary structure. When comparing the sequence of the tRNA''"
of bovine mtDNA with the corresponding one in humans, mice, and toads (Anderson et ai, 1981;
Bibb ctaL, 1981; Roe e/o/., 1985), the corresponding site is occupied by an A in human and
mouse and a C in toad (Table 2). Therefore, the G-to-A substitution in cattle conferred an
evolutionary conservative base at this site. This comparison suggests that no effect would be
Table 2.
Comparison of T-loop sequences of tRNA^" gene of cattle and other vertebrate
mitochondrial genomes.
Source^
T-loop sequence of mitochondrial tRNA^'""' gene""
Human
TCTAACAA
Cattle
TCTAATAG
Mouse
TTTAATAA
Toad
TTCAATTC
" Based on the published sequences by Anderson etal. (1981), Anderson etal. (1982), Bibb etal.
(1981), and Roe e/a/. (1985).
'' The bold and underlined nucleotide stands for the comparative location where the nucleotide
substitution was found in dairy cattle.
94
caused by this transition in cattle. Furthermore, no secondary structure changes could be expected
because this nucleotide substitution was in the T-loop. Therefore, no immediate phenotypic effect
could be expected trom this G-to-A substitution.
The C-to-T substitution at nt 8916 of ATPase subunit 6 gene caused no change in the
amino acid sequence. Isoleucine is coded by ATC, and C is at third position of the isoleucine
codon in the reference sequence (Anderson ct a/., 1982). After the C is substituted by T, the
resulting ATT still encodes for isoleucine. The isoleucine is within the conserved amino acid
sequence of the carboxyl end of ATPase 6. This specific isoleucine is encoded by ATC in humans,
toads, and cattle but by ATT in mice (Table 3). For many organisms, the pattern of codon usage in
a gene may reflect the availability of the tRNAs that are used to decode the message for different
Table 3.
Conserved amino acid sequence at C-terminus of ATPase 6 among diflFerent animal
species and codon for isoleucine within the region.
Source'
Amino acid sequence''
Codon mutation site''
Human
AVAUQAYVFTLLVS
ATC
Cattle
AVAMIQAYVFTLLVS
ATC
Mouse
AVAUQAYVFTLLVS
ATT
Toad
AVAMIQAYVFTLLVS
ATC
' Based on the published sequences by Anderson ef al. (1981), Anderson et al. (1982), Bibb etal.
(1981), and Roe el al. (1985).
'' The bold and underlined amino acid stands for the comparative location where the nucleotide
substitution has been found in dairy cattle.
' The bold and italicized letter represents where the nucleotide substitution that occurred in cattle is
located.
95
genes; hence, the relative concentrations of the different tRNA species for the same amino acid
could determine the basal level of expression of any given gene. Indeed, codon usage patterns for
the same amino acid have been found to correlate with gene product abundance in bacteria
(Grantham et a!., 1980). It is unlikely, however, that the expression of ATPase 6 relative to other
mitochondrial genes is governed by codon usage and specifically of this isoleucine codon change,
because in mammalian mitochondria only a single tRNA species is used to decode each codon
family (Barrell et a!., 1980). Therefore, no change in the function and expression of the ATPase
subunit 6 could be expected from this base substitution.
In the mitochondrial system, methionine is encoded by two codons; one is ATG, the other
is ATA, and there is no codon preference in the recognition and translation of mRNA by tRNA and
other translational components. In this study, two cows had the substitution in the methionine
codon at nt 10349 in the ND4L gene where G is replaced by A. The substitution of G by A at nt
10349 did not change the amino acid sequence, because the G is at the third base of the codon.
Table 4 shows pan of the amino acid sequence in ND4L among different animal species and their
respective codons at this site. For many animal species, the third nucleotide of the codon is A {e.g.,
humans, mice, and toads), but it is a G in Holstein cattle. The majority of the Holstein cattle (11
out of 13) retained a G at position 10349, which is the same sequence as published (Anderson et
al., 1982). Only two cows had the substitution of A for G at this codon. The amino acid at this
site could be highly divergent as long as they are nonpolar amino acids such as methionine in
humans and cattle, valine in mice, and leucine in toads (Table 4). Therefore, the fijnction or the
translation efficiency of the ND4L mRNA probably will be unaffected. This specific nucleotide
96
Table 4.
The amino acid sequence within ND4L among different animal species and codon for
the specific amino acid within the region.
Source'
Amino acid sequence*"
Codon mutation site"
Human
LLCLEGMMLSLF
AJA
Cattle
LLCLEGMMLSLF
ATC;
Mouse
LLCLEGMVLSLF
GTA
Toad
LLCLEGMLLMSM
CIA
Based on the published sequences by Anderson et at. (1981), Anderson e/ al. (1982), Bibb et al.
(1981), and Roe et al. (1985).
'' The bold and underlined amino acid stands for the comparative location where the nucleotide
substitution has been found in dairy cattle.
The bold and italicized letter represents where the nucleotide substitution (nt 10349) occurred in
dairy cattle is located.
is very conservative according to the sequence data from humans, mice, and toads. The mtDNA
with substitution of G by A seems to be an old genotype in the view of evolution because the
humans, mice, and toads all have an A at this specific site (Table 4).
The mtDNA of all cattle in this study had C instead of G at nt 9682, Table 5 shows the
conservative amino acid sequence of different animal species and their codons used for this site
within the COIII gene. Except for cattle, the second nucleotide of the codon is C in humans, mice,
and toads. In the published sequence (Anderson et a/., 1982), however, bovine mtDNA at nt 9682
(the second nucleotide of the codon) is G instead of C. This change from G to C is a transversion.
According to data from 36 cows in another herd, transversions occurred invariably at the end or
within homopolymer regions of mtDNA in the D-loop region and the rRNA coding regions (Wu
97
Table 5.
The amino acid sequence within COIII among different species of animals and the
codon for the specific amino acid within the region.
Source""
Amino acid sequence''
Codon at mutation site''
Amino acid
Human
FGFEAAAWYWH
GCC
Ala
Cattle
FGFEAGAWWH
GGT
Gly
Cattle''
FGFEAAAWYWH
GCT
Ala
Mouse
FGFEAAAWYWH
GCA
Ala
Toad
FGFEAA-WYWH
GCA
Ala
Based on the published sequences by Anderson cf al. (1981), Anderson et al. (1982), Bibb et al.
(1981), and Roe et al. (1985).
The bold and underlined amino acid stands for the comparative location where the nucleotide
substitution has been found in dairy cattle.
" The bold and italicized letter represents where the nucleotide substitution (nt 9682) occurred in
dairy cattle is located.
Cattle in this study.
e t a l , 1995). It is uncommon for a transversion to occur at the second nucleotide of the codon in
the reading frame of a polypeptide and at the same time change the amino acid encoded (Anderson
etai, 1981; 1982). Furthermore, the specific amino acid is occupied by alanine in humans, mice,
and toads but glycine for cattle (Table 5). It seems that glycine in cattle is an unusual amino acid
change on the basis of the amino acid sequences of other animal species (Table 5). The
substitution of C for G in all the cows will revert the codon from one for glycine to one for alanine,
and alanine is highly conserved among other animal species. Therefore, it is reasonable to consider
that the "true" nucleotide occupied at this specific site should be a C instead of a G so that the
ys
amino acid can remain as alanine, vviiich is conserved highly among other animal species.
Moreover, it is possible that Anderson c/ al. (1982) could have sequenced a cow with a rare
mutation at this site; alternatively, there could have been a sequence divergence between mtDNA
of the cows in this study and the originally published sequence.
Several phagemid vectors (pGEM, pBluscript, and pUCl 19) were used for the cloning of
the 3.6 Kb /^.v/I-Aa;RI fragment of bovine mtDNA, but cloning with these vectors was not very
successful. Therefore, a lower copy number plasmid, pACYC 184, was used instead, and the 4.8
Kb /x'oRl fragment of mtDNA was cloned successfully into pACYC184. In this study, all the
recombinant clones obtained with vector pACYC184 contained only one orientation of the £coRI
insert. The opposite orientation might have resulted in toxic products killing the bacterial host or,
alternatively, it might interfere with plasmid replication. Bacteria also could delete or rearrange the
inserted harmflil foreign DNA.
Others have reported similar problems with cloning of specific regions of mtDNA,
especially protein coding regions. Drouin (1980) reported that several regions of human mtDNA
were refractory to cloning in E. coli. Three of 23 Mhol fragments of human mtDNA were
strikingly underrepresented in a collection of human mtDNA-pBR322 recombinant clones. One of
these three fi'agments was detected only once among 705 recombinant clones. In another study.
Tapper al al. (1983) reported that a 2.8 Kb 'fagl fragment could not be isolated as a stable insert in
either of two Ml 3 vectors. Futterer el al. (1988) also reported that a region of the cauliflower
mosaic virus genome was found to direct the expression of a nucleic acid-binding protein in E. coli.
99
but the protein was toxic and led to the destabilization of plasmids containing that region (Futterer
eta!.^ 1988).
Any substitution affecting tRNA secondary structure or anticodon flinction could affect
protein translation of mtDNA genes that, in turn, will affect the chance of the organism for
survival. Therefore, the neutral nucleotide substitution would occur normally at the loop regions of
tRNA. Because of anticodon wobble during translation, most base changes that occur at the third
position of a codon will not change the amino acid that it encodes. Therefore, more substitutions
could be expected in protein coding regions than within those for tRNAs. In the conserved amino
acid sequence of mitochondrially synthesized proteins, any critical amino acid change will affect the
fijnction or activity of the enz\'me, but, in those nonconserved amino acid sequences, an amino acid
change may have only a small effect on flinction. Two of the nucleotide substitutions occurred in
conserved amino acid sequence regions; an amino acid change, however, did not occur because the
nucleotide change occurred at the wobble position of the codon.
In summary, four different nucleotide substitutions were found in the 3.6 Kb Rv/I-iTcoRI
mtDNA fragment that includes COIII. tRNA°'- , ND3, tRNA'^-", ND4L, ND4, tRNA^'", tRNA^'"
tRNA"'\ part of ND5, and part of ATPase subunit 6. One substitution was located in tRNA^" and
the other three were located at ATPase 6, COIII, and ND4L, respectively. It is concluded that the
frequency of nucleotide substitutions in tRNA and protein coding regions was much less than that
observed in the D-loop region and rRNA coding regions (Lindberg, 1989; Wu el a/., 1995). The
transition substitution was the major type of mutation in the tRNA and protein coding regions.
Usually transitions occurred at the third nucleotide of the codon of mRNA, and therefore a change
100
in the amino acid did not occur. Tiie transversion at nt 96S2 from G to C was considered to be
rare because the "true" sequence of bovine mtDNA in the germ line should be C when based on
data from other animal species. No significant physiological differences among animals could be
e.xpected from the different genotypes of mtDNA found in this study, and no insertions or deletions
were observed in tRNA and protein coding regions of bovine mtDNA.
References
Anderson, S., Bankier, A. T., Barrel, B. G., DeBruijn, M. H. L., Coulson, A. R., Drouin, J.,
Eperon, I. C , Nierlich, D. P , Roe, B. A., Sanger F., Schreier, P. H., Smith, A. J. H.,
Staden, R., and Young I. G. (1981) Sequence and organization of the human
mitochondrial genome. Nature 290: 457-465.
Anderson, S., DeBruijn, H. L., Coulson, A. R., Drouin, J., Eperon, I. C,, Sanger F., and
Young I. G. (1982). Complete sequence of bovine mitochondrial DNA. J. Mol. Biol.
156: 683-717.
Barren, B. G., Anderson, S., Bankier, A. T., De Bruijn M. H. L., Chen, E,, Coulson, A. R.,
Drouin, J., Eperon, I. C., Nierlich, D. P., Roe, B. A., Sanger F,, Schreier, P. H., Smith,
A, J. H., Staden, R., and Young 1. G. (1980). Different pattern of codon recognition by
mammalian mitochondrial tRNAs. Proc. Natl. Acad. Sci. USA. 77: 3164-3166.
Bibb, M. J., Van Etten, R. A., Wright, C. T., VValberg, M W., and Clayton D. A. (1981).
Sequence and gene organization of mouse mitochondrial DNA. Cell 26:167-180.
Blanc, H., Wright, C. T., Bibb, M. J., Wallace, D. C., and Clayton, D. A. (1981).
Mitochondrial DNA of chloramphenicol-resistant mouse cells contains a single nucleotide
change in the region encoding 3' end of large ribosomal RNA. Proc. Natl. Acad. Sci.
USA. 78: 3789-3793.
Brown, D. R., DeNise, S. K., and McDaniel, M. F. (1987). Phenotypic variation in
respiratory metabolism and complementation of murine hepatic mitochondria. Theor.
Appl. Genet. 75: 189-193.
Brown, D. R., Koehler, C. iVI., Lindberg, G. L., Freeman, A. E., Mayfield, J. E., Myers, A.
M., Schutz, M., and Beitz, D. C. (1989). Molecular analysis of cytoplasmic genetic
variation in cows. J. Anim. Sci. 67: 1926-1932.
101
Bunn, C. L., Wallace, D. C., and Eisenstadt, J. M. (1974). Cytoplasmic inheritance of
chloramphenicol resistance in mouse tissue culture cells. Proc. Natl. Acad. Sci. USA 71:
1681-1685.
Chang. D. D., and Clayton, D. A. (1984). Precise identification of individual promoters for
each strand of human mitochondrial DNA. Cell 36: 635-643.
Chenery, W. W. (1885). Holstein cattle. Holstein Herd Book. 1:9-43.
Chomyn, A., Cleeter, M. W. J., Ragan, C. I., Riley, M, Doolittle, R. F., and Attardi, G.
(1986), URF6, last unidentified reading frame of human mtDNA, codes for an NADH
dehydrogenase subunit. Science 234: 614-618.
Chomyn, A., Mariottini, P., Cleeter, M. W. J., Ragan, C, I., Matsuno-Yagi, A., Hatefi, Y.,
Doolittle, R. P., and Attardi, G. (1985). Six unidentified reading frames of human
mitochondrial DNA encode components of the respiratory chain NADH dehydrogenase.
Nature 314: 592-597.
Drouin, J. (1980). Cloning of human mitochondrial DNA in Escherichia coh. J. Mol. Biol.
140: 15-34.
Dzapo, v., Reuter, H., and Wassmuth, R. (1973). Heterosis and mitochondrial
complementation. Z. Tierzuchtg. Zuchtgbiol. 90: 169-180.
Dzapp, v., and Wassmuth, R. (1983). Mitochondrial metabolism and heterotic effects in
pigs. Results of a reciprocal crossbreeding experiment. 11. Activity of oxygen uptake of
cells and oxidative phosphorylation in heart, liver and scrotal mitochondria, Z.
Tierzuchtg. Zuchtgbiol. 100: 280-295.
Dziewiecki, C. and Kolataj, A. (1980). Atmung von lebermitochondrien in anwesenheit von
verschiedener substraten bei reirassinger hiihnern und ihren beiderseitigen kreuzungen. Z.
Tierzuchtg. Zuchtgbiol. 97: 50-57.
Futterer, J., Gordon, K., Pfeiffer, P., and Hohn, T. (1988). The instability of a recombinant
plasmid, caused by a prokaryotic-like promoter within the eukaryotic insert, can be
alleviated by expression of antisense RNA. Gene 67: 141-145.
Grantham, R., Cautier, C., and Gouy, M. (1980). Codon frequencies in 119 individual genes
confirm consistent choices of degenerate bases according to genome type. Nucl. Acids
Res. 8: 1893-1912.
Gray, ivl. W. (1989). Origin and evolution of mitochondrial DNA. Annu. Rev. Cell Biol. 5:
25-50.
102
Hausvvirth, W. VV., and Laipis, P. J. (1982). Mitochondrial DNA polymorphism in a maternal
lineage of Holstein cows. Proc. Natl. Acad. Sci. USA. 79: 4686-4690.
Hayashi, J.-l., Ohta, S., Kagavva, Y., Takai, D., Miyabayashi, S., Tada, K., Fukushima, H.,
Inui, K., Okada, S., Goto, Y., and Nonaka, 1. (1994). Functional and morphological
abnormalities of mitochondria in human cell containing mitochondrial DNA with
pathogenic point mutations in tRNA genes. J. Biol. Chem. 269: 19060-19066.
Hiendleder, S., Hecht, \V , and Wassmuth, R. (1991). Restriction enzyme analysis of
cytoplasmic genetic variation in sheep. J. Anim. Breeding Gen. 108: 290-298.
Holt, I. J., Harding, A. E., and Morgan-Hughes, J. A. (1988). Deletions of muscle
mitochondrial DNA in patient with mitochondrial myopathies. Nature 331: 717-719.
Holt, I. J., Harding, A E., Petty, R. K. H., and Morgan-Hughes, J. A. (1990). A new
mitochondrial disease associated with mitochondrial DNA heteroplasmy. Am. J. Human
Genet. 46: 428-433.
Hutchison, C. A., Newbold, J. E., Potter, S. S., and Edgell M. H. (1974). Maternal
inheritance of mammalian mitochondrial DNA. Nature 251: 536-538.
Johnston, S. D. (1991). Sequence heterogeneity of bovine mitochondrial ribosomal RNA
genes. M.S. Thesis, Iowa State University. Ames, lA.
Kobayashi, Y., Sharpe, H., and Brown, N. (1994). Single-cell analysis of intercellular
heteroplasmy of mtDNA in Leber hereditary optic neuropathy. Am. J. Human Genet. 55:
206-209.
Koehler, C. M. (1989). Molecular characterization of bovine mitochondrial DNA. M.S.
Thesis, Iowa State University. Ames, lA.
Laipis, P. J., Van de Walle, M. J., and Hauswirth, VV. W. (1988). Unequal partitioning of
bovine mitochondrial genotypes among siblings. Proc. Natl. Acad. Sci. USA. 85: 81078110.
Lindberg, G. L. (1989). Sequence heterogeneity of bovine mitochondrial DNA. Ph.D.
dissertation, Iowa State University, Ames, lA.
Lindberg, G. L., Shank B. B., Rothschild M. P., Mayfield, J. E., Freeman, A. E., Koehler, C.
M., and Beitz, D. C. (1989). Characteristics of mammary mitochondrial in lines of mice
genetically divergent from milk production. J. Dairy Sci. 72: 1175-1191.
McDaniel, R. G. and Grimwood, B. G. (1971). Hybrid vigor in drosophila: Respiration and
mitochondrial energy conservation. Comp. Biochem. Physiol. 38B: 309-314.
103
Olivo, P. 0., Van cie Walle, M. J., Laipis, P. J., and Hauswirth, W. VV. (1983). Nucleotide
sequence evidence for rapid genotypic shifts in the bovine mitochondrial DNA D-loop.
Nature 306: 400-402.
Pastores, G. M., Santorelli, F. M, Shanske, S., Gelb, B. D., Fyfe, B., Wolfe, D., and Willner,
J. P. (1994). Leigh syndrome and hypertrophic cardiomyopathy in an infant with a
mitochondrial DNA point mutation (T8993G). Am. J. Med. Genet. 50: 265-271.
Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989). Molecular Cloning: A laboratory
manual. 2nd ed. New York: Cold Spring Harbor Laboratory Press.
Tapper, D. P., Van Etten, R. A., and Clayton, D. A. (1983). Isolation of mammalian
mitochondrial DNA and RNA and cloning of the mitochondrial genome. Meth. Enzymol.
97: 426-434.
Wallace, D. C. (1993). Mitochondrial diseases: Genotype versus phenotype. Tr. Genet. 9:
128-133.
Watanabe, T., Hayashi, Y., Semba, R., Ogasawara, N. (1985). Bovine mitochondrial DNA
polymorphism in restriction endonuclease cleavage patterns and the location of the
polymorphic sites. Biochem. Genet. 23: 947-957.
Wu, J., Smith, R. K., Freeman, A, E., Lindberg, G. L., McDaniel, B. T., and Beitz, D. C. (1995).
Sequence heteroplasmy of D-loop and rRNA coding regions in mitochondrial DNA from
Holstein cows of independent maternal lineages. FASEB J. 9: A1041.
104
GENERAL SUMMARY
Mammalian mitochondria carry multiple copies of double-stranded circular DNA
(mtDNA) that is replicated and expressed within the organelles, and it is believed to be
inherited maternally. The complete sequence of mtDNA has been determined in dairy cattle,
humans, mice, and other species, and sequence variations have been detected within most of
these species. Beyond its maternal inheritance and its rapid evolution, the segregation and
transmission of different types of mtDNA in mammals are not clear. Furthermore, the extent
and types of sequence variations in tRNA and protein coding regions of mtDNA are not
documented in dairy cattle. The study of the genetics of bovine mtDNA and the effect and
types of nucleotide variations in tRNA and protein coding regions will allow us to assess
accurately the presence and evolution of different types of mtDNA in animal germ lines, the
effects of different types of mtDNA on animal production traits, and the genetic basis of
human mitochondrial diseases.
Thirty-six Holstein cows from 18 maternal lineages (two cows from each maternal
lineage) were used for the study of heteroplasmy and sequence variations in the D-loop and
rRNA coding regions. By cloning and sequencing the mtDNA of cows from different
maternal lineages, multiple heteroplasmic mtDNA states within the D-loop and rRNA coding
regions of mtDNA were found to exist extensively in Holstein cows. By analyzing
heteroplasmic cows in the same maternal lineages, the nature and transmission of mtDNA
were investigated. The mtDNA population in a specific animal was found to be a mixture of
105
different genotypes. Because heteroplasmy was observed frequently and seemingly is
persistent, selected amplification of specific mtDNA may not be a part of mtDNA inheritance.
The random passage of different types of mtDNA from mother to progeny could account for
the presence of multiple mtDNA heteroplasmy. At same time, four hypervariable sites were
located at nt 169, 216, and 1594 and between nt 352 to 364, and over half of the cows studied
possessed nucleotide substitutions at these sites. All transversions, insertions and deletions in
the D-loop region and rRNA coding regions occurred at the end or within the homopolymer
regions of mtDNA The data suggest that replication slippage could be a common cause of
the transversion, insertion, and deletion.
In another study, a 3.6 Kb fragment of mtDNA from 13 Holstein cows was cloned and
sequenced. This fragment contained the tRNA and protein coding regions which includes genes of
com, tRNA^'^ ND3, tRNA'"^, ND4L, ND4, tRNA^'^", tRNA^", and tRNA"'' and portions of
ND5 and ATPase subunit 6. Four different nucleotide substitutions were detected in these regions.
One substitution was a transition from G to A at nt 12023 within the T-loop of the tRNA^" coding
region. Only one out of four cows had a substitution at this site. The second substitution occurred
at nt 8916 within the ATPase 6 gene; two out of 13 cows had a C-to-T transition at this site. The
third substitution was located at nt 10349 of the ND4L gene where G was substituted by A; two
out of 13 cows had this type of transition. The last substitution was a transversion at nt 9682
where G was substituted by C within the COIII gene. All 13 cows showed exactly the same
variation at this site. The frequency of nucleotide substitutions in tRNA and protein coding regions
was found to be much less than that in the D-loop and rRNA coding regions. Transitions were the
106
major t^'pe of mutations in tRNA and protein coding regions. All transitions occurred at the third
nucleotide of the codon or the T-loop region of tRNA, and thereby did not change the amino acid
encoded by the codon or the general structure of the tRNA. The transversion at nt 9682 from G to
C was considered to be an exception because the conservative amino acid is alanine as based on the
data from other animal species. Therefore, the "true" sequence of bovine mtDNA in the germ line
could be cytosine at nt 9682, and the original published sequence might be a rare substitution in
that cow; alternatively, there could have been a sequence divergence between mtDNA of the cows
in this study and the originally published sequence. No deletions or insertions were observed in
tRNA and protein coding regions. No significant physiological differences could be expected from
all the different genotypes of mtDNA. Some regions of mtDNA were refractory to cloning and the
problem was solved by using a low copy number plasmid and bidirectionally cloning techniques.
107
ACKNOWLEDGMENTS
I am greatly indebted to Dr. Don Beitz who gave me the chance to reunite with my wife
and to study in the Nutritional Physiology Group. I really appreciate his help and guidance, and I
am blessed to have him as my major professor.
Dr. Gary Lindberg, my co-major professor, and Dr. Gene Freeman, my POS committee
member, who have advised, counseled, supported, and encouraged me in doing the research with
the bovine mtDN.^ I thank them very much for their efforts and kindness.
I also want to express my thanks to Dr. Chris Minion and Dr. Alan Myers who served as
my POS committee members; I have learned a lot from them.
Thanks also go to Renotta Smith, Andrea Falk, Jenny Puis, and Betsy Swanson who
worked with me. Thank them for their technical assistance.
Finally, I would like to thank the whole Nutritional Physiology Group, which is a fun
group of people to work with. I have enjoyed staying with them and learned a lot from them.
My dear wife, Ling, deserves a separate paragraph of my thanks. I thank her very
much for her bed-time suggestions, arguments, and encouragement. Without her support and
encouragement, I don't know where I would be now.