Download Chapter 15 Review Questions

Chapter 15 Review Questions
1. List the 4 types of life molecules we discussed in class and give characteristics of
each.
2. List 3 types of carbohydrates, 4 types of fats, and 2 types of nucleic acids.
3. Draw a simple nucleotide, label each part and list at least 2 characteristics of each
part.
4. Describe the steps of DNA replication.
5. Describe the process of protein synthesis.
6. Take the DNA strand below and write the amino acid chain it would encode.
a. TACCGTAAAAGTCCTGCATACACT
7. Using the above amino acid chain, describe how a finished protein is folded.
8. List 3 differences between DNA and RNA.
9. What is the difference between starch and cellulose?
10. Describe what an enzyme is, what it does, how it works and an example of an
enzyme we discussed in class.
11. Name and describe 2 ways in which scientists can use DNA.
Key
1.
4 life molecules:
a. Carbohydrates: made of carbon, hydrogen & oxygen; sugars are
monosaccharides and have names that end in –ose; starches are
polysaccharides, plant starch (amylose) is stored in large granules and
animal starch (glycogen) is stored in small granules; cellulose is a
polysaccharide, but with different linkages than starch
b. Fats: insoluble in water, classified by degree of saturation, most less dense
than water
c. Proteins: made of amino acids, can be folded into many shapes, contain
amine groups
d. Nucleic acids: polymers made of phosphate group, sugar and amine base
monomers (nucleotides); DNA has deoxyribose (one less oxygen) and
RNA has ribose
2. Types:
a. Carbohydrates: sugars (monosaccharides), starches (polysaccharides),
cellulose (polysaccharide)
b. Fats: fatty acids, steroids (cholesterol, sex hormones), waxes, fat-soluble
vitamins
c. Nucleic acids: DNA, RNA
3.
P
S
B
P = Phosphate group; polyatomic ion, formula = PO43-; bonds to the sugar, part of the
backbone
S = sugar; in DNA = deoxyribose (one less oxygen on the #2 carbon in the ring), in RNA
= ribose; 5-carbon pentose; bonds to phosphate to make up the backbone, and bonds to
base
B = amine base; contains several amine groups (--NH2); could be purine (adenine,
guanine, contain 2 heterocyclic rings), or pyrimidine (cytosine, thymine, contain 1
heterocyclic ring); purines must bond with pyrimidines in order to keep the DNA a
uniform width and to orient the bases correctly for bonding; bases bond together by
hydrogen bonding (2 bonds between A and T, 3 bonds between C and G)
4.
See the steps as covered in class on the notes
5. See the steps as covered in class on the notes
6. Met – Ala – Phe – Ser – Gly – Arg – Met (stop)
7. Proteins are folded according to 4 levels of organization. The primary structure of
a protein is its amino acid chain, bonded together with peptide bonds (amide
linkages). The secondary structure of a protein begins to shape the amino acid
chain using hydrogen bonding, forming alpha-helix and beta-pleated sheet
structures. The tertiary structure of a protein gives it 3 dimensions. The amino
acid chain is folded using salt bridges (ionic bonds involving a negatively-charged
part and a positively charged one), disulfide linkages (covalent bonds involving 2
sulfurs), and dispersion forces (temporary bonds between non-polar side-chains).
The quaternary structure of a protein takes multiple tertiary structures and bonds
them together (i.e. several amino acid chains, folded in tertiary shapes). All this is
accomplished with the help of enzymes.
8. RNA contains ribose and DNA contains deoxyribose (one less oxygen on the
sugar); DNA stays in the nucleus, RNA travels back and forth between the
nucleus and the cytoplasm; DNA is double-stranded, RNA is single-stranded;
DNA is helical, RNA is straight or folded in some other shape
9. They are both carbohydrates, but cellulose has different linkages between the
monosaccharides which yields the cellulose indigestible by humans
10. An enzyme is a special type of protein. It catalyzes (speeds up) reactions by
lowering the activation energy needed for a reaction to take place. It
accomplishes this by bringing the reactants into precise orientation and close
proximity. Enzymes are very specific to the job they do. Examples: lactase,
helicase, DNA polymerase, amylase
11. DNA is used in paternity testing, DNA fingerprinting (crime scenes), and
recombinant genetics (genetically modified crops, animals, drug production)