Download Protein Synthesis and the Central Dogma

Protein Synthesis and the Central Dogma
Go to http://learn.genetics.utah.edu/
Click on the box “Molecules of Inheritance” under the “Genetics” section
Under the “RNA” category, click on “RNA’s Role in the Central Dogma”
•
•
•
•
What does the central dogma of molecular biology explain?
•
Why are proteins important?
•
What contains the instruction for building proteins?
•
Looking at the image, compare DNA and the three types of RNA. What are
some of the differences between DNA and RNA? (Hint: look at the size,
whether it leaves the nucleus, if it is single or double stranded)
Now, explore the 4 key players of protein synthesis by clicking on them in the
picture
•
DNA:
• What does DNA contains instruction for?
•
______________________ are built in the nucleus then
transported to the cytoplasm
•
What directs the assembly of RNA molecules?
mRNA:
• What does the m in mRNA stand for?
•
How many types of protein does each mRNA molecule contain the
instruction for?
•
What are codons and what do they code for?
tRNA:
• What does the t in tRNA stand for?
•
What does tRNA carry?
•
What are amino acids?
•
Based on what you read, are tRNA specific about the molecules they carry?
•
How does tRNA recognize codons on mRNA?
rRNA:
• What does the r in rRNA stand for?
•
What are ribosomes?
•
How are proteins made? List the steps.
1.
2.
3.
•
•
•
•
Go to http://learn.genetics.utah.edu/
Click on “Molecules of Inheritance” to enter the page.
Click on “Transcribe and Translate a Gene”
Scroll down until you see the heading “Transcription and Translation”
•
What happens during transcription?
•
What happens during translation?
•
Which codons code for protein synthesis to start and stop?
Start
Stop
Now, scroll back up to the top and “transcribe a DNA sequence and translate it
into a protein” by clicking the blue “Click here to begin” button. Pay close
attention to what is being done so that you can repeat the process in later
questions. Take notes in this section if it will help you remember.
First, transcribe the following DNA sequence. Then translate the mRNA sequence
you get, making sure you start at the ‘start’ amino acid. Use the Universal Genetic
Code to help you.
ATACATCGAAGCCTAGGCAATCCA
Using an online dictionary such as http://dictionary.reference.com/, look up the word
transcribe and translate. Formulate an explanation for why scientists may have
chosen to use the words transcription and translation for these two processes.
Think of what you change and what you get in the processes.
Go to http://evolution.berkeley.edu/evolibrary/article/evo_18. Read about mutations
and summarize what a mutation is and what it does.
Predict what would happen to the amino acid sequence if a mutation (a change in the
DNA sequence) occurred in the original DNA sequence. What would happen to the
RNA? What would happen to the protein?