Download Welcome! 3/21/14

Welcome! 3/21/14
n  Objective: Students will act out protein synthesis and complete
the guided notes in order to demonstrate how mutations effect
traits.
n  Catalyst:
1) Which of these best describes the correct sequence in the
expression of a trait?
A) trait → gene → enzyme
B) gene → protein → trait
C) protein → gene → trait
D) gene → trait → DNA
2) What does tRNA carry to the ribosome?
3) If the mRNA strand AAA-UUU-CCC codes for Lys-Phe-Pro, which
amino acid does AAA code for?
Catalyst
1) Which of these best describes the correct
sequence in the expression of a trait?
A) trait → gene → enzyme
B) gene → protein → trait
C) protein → gene → trait
D) gene → trait → DNA
2) What does tRNA carry to the ribosome?
3) If the mRNA strand AAA-UUU-CCC codes for LysPhe-Pro, which amino acid does AAA code for?
Focus Activity Review
n  DNAàmRNAàProteinsàTraits
n  A change in the DNA may cause a change in
the RNA which can change the traits
n  Anticodon = CGA Amino Acid = Alanine
Protein Synthesis Review
n  Follow the instructions on the front of your
half sheet in order to act out protein synthesis
n  This is to help review the concepts and steps
involved in protein synthesis
n  It is important that we understand how we
express our traits
MUTATIONS
Genetic mutations and
Chromosomal Mutations
From Earlier in Class
n  Review: How is a genetic trait determined by
the code in a DNA molecule?
n  DNA-> RNA-> Protein-> Trait
n  If
RNA is involved it has to be undergoing
PROTEIN SYNTHESIS
n  A genetic mutation is a change in the nitrogen
base sequence of a gene.
Types of Mutations
n  There are several types of mutation:
n  DELETION (a base is lost)
n 
INSERTION (an extra base is inserted)
n 
Deletion and insertion may cause what’s called a FRAMESHIFT,
meaning the reading “frame” changes, changing the amino acid
sequence
n  SUBSTITUTION
(one base is substituted for
another)
n 
n 
n 
If a substitution changes the amino acid, it’s called a MISSENSE
mutation.
If a substitution does not change the amino acid, it’s
called a SILENT mutation.
If a substitution changes the amino acid to a “stop,”
it’s called a NONSENSE mutation.
Sickle Cell Anemia
n  Sickle Cell Anemia
n  Sickel cell anemia is the result of a type of
mutation in the gene that codes for part of the
hemoglobin molecule. Recall that
hemoglobin carries oxygen in your red bloods
cells. The mutation causes the red blood
cells to become stiff and sickle-shaped when
they release their oxygen. The sickled cells
tend to get stuck in blood vessels, causing
pain and increased risk of stroke, blindness,
damage to the heart and lungs, and other
conditions.
Analyzing DNA
n  Analyze the DNA strands below to determine
what amino acid is changed and what type of
mutation occurred.
n  Normal hemoglobin DNA
CACGTGGACTGAGGACTCCTC
n  TRANSCRIBE Normal hemoglobin mRNA
n  TRANSLATE normal hemoglobin mRNA
Analyzing DNA
n  Sickle cell hemoglobin DNA
CACGTGGACTGAGGACACCTC
n  TRANSCRIBE Sickle cell hemoglobin mRNA
n  TRANSLATE Sickle cell hemoglobin Amino
acids
What that tells us
n  Even
though a mutation occurs in the DNA, it
does not always result in a visible change.
n  Mutations may change the DNA but not the
amino acid
n  That mutations MAY result in a change in the
PHENOTYPE of an organism, but not always.
n  Think-Pair-Share
n  WHY
IS IT AN ADVANTAGE TO HAVE
DIFFERENT CODONS CODE FOR THE SAME
AMINO ACIDS?
Review
n Sickle cell anemia can be passed
from parent to offspring. It is an
autosomal recessive trait.
n If it can be passed to the offspring,
this mutation MUST occur in the
gamete cells of the parents. WHY?
(Answer on your notesheet)
Think-Pair-Share
n  Can you think of a mutation that is not passed
from parent to offspring?
n  Write
your answers on your paper
n  In
30 seconds we will discuss with our
partners
n  Share
out
Mutations Summary!
n  Mutations DO NOT occur often in a population
n  If they do,
n 
n 
n 
Some may be harmful.
n  Sickle cell anemia
Some may have NO EFFECT
n  Like the mutations that do not change the amino acid
sequence
Some may even be beneficial!
n  Like a bear that lives in alaska having white fur instead
of brown
Mutations
n  Mutations can occur spontaneously or as a
result of radiation or other chemicals.
n  Mutations that occur in GAMETES are the
only mutations that can be passed to
offspring.
n  Mutations that occur in any other type of
somatic cell will effect only that individual.
n  The
most common we can think of is Cancer
Mutations
n  Chromosomal mutations result when an
organism has an abnormal amount of
chromosomes.
n  An
example being trisomy 21 or Down’s
Syndrome in humans
n  These can be determined by looking at an
organism’s karyotype
Mutations Practice
n  Complete the practice to review mutations.
n  Use your notes
n  If you get stuck:
n  Re-read
the question
n  Underline key words
n  Ask a partner a good question
n  THEN Ask Mrs. Reigel
Exit Summary
n  1. Which of these mutations could be passed
on to the organism’s offspring?
n  A.
a mutation in a skin cell resulting in freckles
n  B. a mutation in nerve cell resulting in green
eyes
n  C. a mutation in a sperm cell resulting in
attached earlobes
n  D. a mutation in a muscle cell resulting in
shortened limbs
n  2. Mutations are changes in the________ of
an organism
n  3. Mutations may cause a change in an
organism’s _____________.