Download POB3 Is Required for Both Transcription and Replication

Copyright  2000 by the Genetics Society of America
POB3 Is Required for Both Transcription and Replication in the
Yeast Saccharomyces cerevisiae
Mylynda B. Schlesinger and Tim Formosa
Department of Biochemistry, University of Utah School of Medicine, Salt Lake City, Utah 84132
Manuscript received December 21, 1999
Accepted for publication April 17, 2000
ABSTRACT
Spt16 and Pob3 form stable heterodimers in Saccharomyces cerevisiae, and homologous proteins have also
been purified as complexes from diverse eukaryotes. This conserved factor has been implicated in both
transcription and replication and may affect both by altering the characteristics of chromatin. Here we
describe the isolation and properties of a set of pob3 mutants and confirm that they have defects in both
replication and transcription. Mutation of POB3 caused the Spt⫺ phenotype, spt16 and pob3 alleles displayed
severe synthetic defects, and elevated levels of Pob3 suppressed some spt16 phenotypes. These results are
consistent with previous reports that Spt16 and Pob3 act in a complex that modulates transcription.
Additional genetic interactions were observed between pob3 mutations and the genes encoding several
DNA replication factors, including POL1, CTF4, DNA2, and CHL12. pob3 alleles caused sensitivity to the
ribonucleotide reductase inhibitor hydroxyurea, indicating a defect in a process requiring rapid dNTP
synthesis. Mutation of the S phase checkpoint gene MEC1 caused pob3 mutants to lose viability rapidly
under restrictive conditions, revealing defects in a process monitored by Mec1. Direct examination of
DNA contents by flow cytometry showed that S phase onset and progression were delayed when POB3
was mutated. We conclude that Pob3 is required for normal replication as well as for transcription.
P
OB3 and Spt16/Cdc68 form an abundant, nuclear
heterodimer that binds specifically to DNA polymerase ␣ in the yeast Saccharomyces cerevisiae (Wittmeyer
and Formosa 1995, 1997; Brewster et al. 1998; Wittmeyer et al. 1999). SPT16/CDC68 has been implicated
genetically in the global regulation of transcription
(Prendergast et al. 1990; Malone et al. 1991; Rowley
et al. 1991; Xu et al. 1993, 1995; Lycan et al. 1994;
Brewster et al. 1998; Evans et al. 1998). Both elevated
Spt16 levels and an spt16 mutation increase the production of some transcripts, notably the aberrant messages
from transposon-disrupted alleles of HIS4 and LYS2 that
lead to the Spt⫺ phenotype (Prendergast et al. 1990;
Malone et al. 1991; Rowley et al. 1991; Lycan et al.
1994). However, the levels of other, normal transcripts
such as those for cyclins decrease in spt16 mutants
(Prendergast et al. 1990; Malone et al. 1991; Rowley
et al. 1991; Lycan et al. 1994) indicating that diminished
Spt16 function can either increase or reduce transcription. Due to the global nature of these effects, the similarity of the phenotypes with those caused by mutations
in histone genes (Malone et al. 1991; Winston and
Carlson 1992), and genetic interactions with the putative chromatin factor San1 (Schnell et al. 1989; Xu et
al. 1993), Spt16 has been proposed to affect transcription by altering the properties of chromatin. Consistent
Corresponding author: Tim Formosa, Department of Biochemistry,
University of Utah School of Medicine, 50 N. Medical Dr., Salt Lake
City, UT 84132. E-mail: [email protected]
Genetics 155: 1593–1606 (August 2000)
with this, a portion of the total Spt16-Pob3 complex was
found to be stably associated with chromatin (Wittmeyer et al. 1999).
Spt16-Pob3 bound to affinity matrices containing the
catalytic subunit of DNA polymerase ␣ (Pol1) as the
ligand (Wittmeyer and Formosa 1995, 1997) and also
partially copurified with the four subunit Pol ␣/primase
complex (Wittmeyer et al. 1999). A variety of additional
physical and genetic tests indicates that the interaction
between Spt16-Pob3 and Pol ␣ is important in vivo
(Wittmeyer and Formosa 1995, 1997; Formosa and
Nittis 1999; Wittmeyer et al. 1999), suggesting that
Spt16-Pob3 acts in DNA replication. These results do
not contradict studies that infer a role for Spt16-Pob3 in
transcription, but instead suggest a similar or additional
role for this factor in DNA replication. Since chromatin
is the substrate for both replication and transcription,
a factor that alters the properties of chromatin could
easily affect both processes.
Both SPT16 (Malone et al. 1991) and POB3 (Wittmeyer and Formosa 1997) are essential genes that are
highly conserved among eukaryotes (Wittmeyer and
Formosa 1997; Evans et al. 1998). Heterodimers of
Spt16 and Pob3 homologs have been purified from human and frog cells (Okuhara et al. 1999; Orphanides
et al. 1999). One of these, the human FACT complex,
allows RNA polymerase II to elongate transcripts on
templates that contain nucleosomes, which otherwise
block elongation of transcription (Orphanides et al.
1998, 1999). The mechanism has not been determined,
but Orphanides et al. (1999) have proposed that FACT
1594
M. B. Schlesinger and T. Formosa
might make intranucleosomal histone contacts more
flexible as RNA pol II approaches. The frog DUF complex is also composed of Spt16 and Pob3 homologs
(Okuhara et al. 1999), and depletion of DUF from egg
extracts caused loss of replication competence (Okuhara et al. 1999). Since replication in this system is
independent of transcription (but dependent on chromatin formation; Newport 1987), this indicates a direct
role for DUF in DNA replication. The activities of the
human and frog Spt16-Pob3 homologs therefore support roles in both transcription and replication, possibly
by mediating interactions with nucleosomes for both
DNA and RNA polymerases.
While spt16 mutations were identified in several
screens for transcription factors, mutations in pob3 have
been described only briefly (Wittmeyer et al. 1999). To
further dissect the role of Spt16-Pob3, we have isolated a
set of mutations in POB3 and tested the mutant strains
for defects in both transcription and replication. Our
results support the model that both replication and
transcription depend on the function of POB3.
MATERIALS AND METHODS
Yeast methods: Selective and rich media were prepared as
described (Hartwell 1967; Rose et al. 1990). Strains used
are listed in Table 1. For maximal permissive temperature
(MPT) determinations, strains were grown to stationary phase
in rich medium and 2-␮l aliquots were placed on several rich
agar plates and spread to a portion of each plate with a wire
loop. The plates were incubated for 3 days at various temperatures, including either 22⬚ or 26⬚ and a set at 1⬚ intervals from
28⬚ to 37⬚ with the range depending on the strains being
tested. The MPT was judged to be the highest temperature
that permitted ⵑ10% of the growth observed at the lowest
temperature. The breadth of the transition varied with the
mutation, but typically viability dropped by at least 10,000fold within 2⬚ of the MPT. For arrest and release experiments,
cells were treated with 4 ␮g/ml of ␣-factor (Sigma, St. Louis)
in rich media and then were collected by centrifugation and
suspended in rich media containing 0.1 mg/ml protease type
XIV (Sigma) at 22⬚ or 37⬚, as described previously (Paulovich
and Hartwell 1995).
Mutagenesis: pJW4 (YCp, POB3, URA3) and pJW11 (YCp,
POB3, LEU2) contain the 3924-bp KpnI-SphI fragment including POB3 in YCplac33 and YCplac111 (Gietz and Sugino
1988). pJW11 was treated with 0.1 m hydroxylamine for various
amounts of time at 75⬚, essentially as described (Sikorski
and Boeke 1991; Formosa and Nittis 1999), and then was
introduced into strain 7697 (pob3-⌬) carrying pJW4. This led
to the identification of the alleles pob3-10, -11, and -12. POB3
was also amplified from yeast genomic DNA using the primers
5 ⬘ - CUACUACUACUAGGATCCTTGTAAGTACTTGGCTCA
and 5⬘-CAUCAUCAUCAUGAATTCTGTCTTACACTCACCA
TGTC under several mutagenic conditions (Zhou et al. 1991;
Cadwell and Joyce 1992; Zhang et al. 1998). The resulting
2043-bp PCR product includes 278 bp upstream through 96 bp
downstream of the POB3 open reading frame (ORF) flanked
by added BamHI and EcoRI sites on a fragment that can be
efficiently recovered using the CloneAmp system (Life Technologies). YCplac111 (Gietz and Sugino 1988) and the PCR
products were digested with EcoRI and BamHI, ligated to form
pTF139 derivatives, and the ligation mixtures were used directly to transform strain 7697 pJW4. In each screen, Leu⫹
transformants were transferred to media containing 5-fluoroorotic acid (5-FOA; Boeke et al. 1987) to select for loss of
pJW4 and then were tested for growth at 13⬚ and 37⬚. Plasmids
were recovered from candidate mutants and retransformed
to establish linkage of the mutant phenotype with the plasmid.
The POB3 ORF from each mutant was then sequenced to
identify alterations. Reconstruction of some mutations (see
Table 2) was performed by mutagenizing pTF139 with pairs
of primers using the QuikChange method (Stratagene, La
Jolla, CA). To delete the 3⬘ end of POB3, the same upstream
primer above was used with 5⬘-CAUCAUCAUCAU
GAATTCCTACTCTTCCTTACTGATGTTGG, which converts
residue Q458 (CAG) to a nonsense codon (TAG) and also
removes the coding sequence for the remaining 94 residues
of Pob3. This product was inserted into YCplac111 (Gietz
and Sugino 1988) to form pTF139-CT⌬95.
Analysis of Pob3 and Spt16 proteins: Cultures in log phase
were harvested, suspended in SDS sample buffer, and boiled.
Extract representing 1–5 ⫻ 106 cells (the same number of
cells was used for each sample in a given experiment) was
separated by SDS-PAGE, and proteins were transferred to nitrocellulose (Harlow and Lane 1988). Pob3 and Spt16 were
detected using polyclonal antisera (Wittmeyer et al. 1999)
and either insoluble product (Harlow and Lane 1988) or
TABLE 1
Strains used
Name
7697
7782-4
7787-4-4
7788-4-4
7790-5-2
7791-8-2
7792-2-2
7792-4-2
7799-1-4
7805-1-4
Background
A364a
A364a
Hybrid
A364a
A364a
A364a
A364a
A364a
A364a
A364a
Genotype
MATa
MATa
MATa
MATa
MATa
MATa
MATa
MATa
MATa
MATa
leu2
leu2
leu2
leu2
leu2
leu2
leu2
leu2
leu2
leu2
trp1
trp1
trp1
trp1
trp1
trp1
trp1
trp1
trp1
trp1
ura3
ura3
ura3
ura3
ura3
ura3
ura3
ura3
ura3
ura3
his7 pob3-⌬5::TRP1
his7 spt16-4
his4-912␦ lys2-128␦ pob3-⌬5::TRP1
his3 mec1-1(::HIS3) pob3-⌬5::TRP1
his3 ctf4-⌬7::HIS3 pob3-⌬5::TRP1
his7 cyh2 cdc17-1 pob3-⌬5::TRP1
his7 spt16-G132⌬ pob3-⌬5::TRP1
his3 spt16-4 pob3-⌬5::TRP1
his7 dna2-2 pob3-⌬5::TRP1
his3 pob3-⌬5::TRP1 chl12-⌬4::HIS3
Strains with a deletion of POB3 are only viable when carrying a POB3 plasmid, which is identified in each
experiment.
Pob3 Acts in Transcription and Replication
1595
TABLE 2
Mutations in pob3 alleles
POB3 allele
-1
-2
-3
-4
-5
-6
-7
-8
-9, -12, -13
-10
-11
-20
-21
Amino acid sequence changes
L78R, M419K, S489T
N72Y, I89N, D92V, D159V
Y9D, G63D, Q73K, D159V, H279Q, R284K,
L288I
Q12L, R18K, Y137D, I242T, E456D, K473E
Q77P, Y396S*, Q458-stop
Y9H, I21S, M172T
W28R, T50I, N69K, D204G, N518K
V55A, W57R, C61G, K202R, F249L, T434M
Q458-stop
G35S, A37T, E51K, V75I, G110D*, G114S*,
A119T, E134K*
R20H, R109C
K548-stop
K547M
DNA sequencing revealed changes in the amino acid sequence of the POB3 locus in mutants. Additional silent
changes were observed but are not shown. Asterisks denote
mutations in residues that were absolutely conserved among
all 12 homologs found in GenBank (Altschul et al. 1997).
Underlined mutations were reconstructed by site-directed mutagenesis. Boldface type indicates that the mutation(s) indicated caused the Ts⫺ phenotype. In the case of pob3-7, W28R
N69K caused both the Ts⫺ and Spt⫺ phenotypes; W28R T50I
also caused the Spt⫺ phenotype but was not Ts⫺.
chemiluminescent (Amersham-Pharmacia Biotech, Piscataway, NJ) staining.
Flow cytometry: Cells were fixed in 70% ethanol, washed,
stained with propidium iodide, and their DNA contents were
measured as previously described (Wittmeyer and Formosa
1997).
RESULTS
Isolation of pob3 mutations: POB3 was mutagenized
with hydroxylamine (Sikorski and Boeke 1991) or by
PCR amplification under mutagenic conditions (Zhou
et al. 1991; Cadwell and Joyce 1992; Zhang et al. 1998).
Clones were screened for Ts⫺, Cs⫺, and slow growth
phenotypes using a standard plasmid shuffle (Sikorski
and Boeke 1991). A total of 13 Ts⫺, 0 Cs⫺, and 2 slowgrowing mutants were obtained. The Ts⫺ mutants carry
conditionally functional versions of Pob3 that act adequately at low temperatures but fail at elevated temperatures. We used these strains to analyze the behavior of
transcription and replication in cells with minimal Pob3
function, or upon the removal of Pob3 function by shifting growing cultures to a nonpermissive temperature.
The DNA sequences of the mutated genes were determined and revealed the changes in amino acid sequence
listed in Table 2. In some cases where multiple mutations were identified, subsets were reconstructed by sitedirected mutagenesis and retested. A single L78R mutation was found to be responsible for the Ts⫺ phenotype
Figure 1.—pob3 alleles cause Ts⫺ and Spt⫺ phenotypes. The
A364a/S288C hybrid strain 7787-4-4 (his4-912 ␦ lys2-128 ␦ pob3⌬5) with different versions of POB3 supplied on plasmids was
grown to saturation and aliquots of 10-fold dilutions were
placed on complete synthetic medium (C), or media lacking
histidine or lysine and incubated at the temperatures indicated. The identical alleles pob3-9, -12, and -13 produced slow
growth at 37⬚ in an A364a strain (not shown), but not in this
hybrid background. Conversely, alleles pob3-20 and pob3-21
promoted slow growth at all temperatures in an A364a strain
(for example, see Figure 6), but caused a Ts⫺ phenotype in
the hybrid background shown here. The Spt⫺ phenotype of
these latter two alleles is more apparent upon longer incubations due to the slow growth phenotype, with both strains
eventually producing colonies on both ⫺His and ⫺Lys plates
while the POB3 strain did not. The L78R mutation was reconstructed by site-directed mutagenesis and found to cause both
Ts⫺ and Spt⫺ phenotypes indistinguishable from pob3-1 (see
Table 2).
(and for all other phenotypes; see below) caused by
pob3-1, while two mutations were required for the Ts⫺
phenotypes of pob3-7 and pob3-11. Single point mutations can therefore produce conditional lethality in
POB3, but other alleles are more complex.
Two alleles, pob3-20 and pob3-21, caused a serious defect in the rate of growth at all temperatures in the
A364a background (and strong temperature sensitivity
in an S288C/A364a hybrid shown in Figure 1). Both
mutations were found to alter the extreme C terminus
of Pob3, either deleting the final five residues or substituting the sixth residue from the C terminus. The
growth defects of pob3-20 and pob3-21 strains are not due
to the formation of unstable or dominant interfering
proteins, since the Pob3 levels are at least as high as
wild type in these strains (Figure 2B) and the growth
rate of strains containing both the mutant and wild-type
alleles on low copy plasmids is normal. However, the
levels of Spt16 protein are diminished in these mutants
(Figure 2D; data not shown), suggesting that the C terminus of Pob3 plays a role in stabilizing Spt16.
1596
M. B. Schlesinger and T. Formosa
Figure 2.—Pob3 protein is unstable in pob3 mutants. Total
protein was isolated from strain 7697 (pob3-⌬5) with different
versions of POB3 on plasmids (derivatives of pTF139) and
then was separated by SDS-PAGE and transferred to nitrocellulose. The positions of intact Pob3 and Spt16 are indicated, as
well as the 55-kD truncated fragment of Pob3 where present.
(A) 106 log phase cells growing at 22⬚ with normal POB3 or
pob3-1 plasmids were shifted to 37⬚ for the time shown (in
minutes), and then Pob3 was detected by immunostaining.
(B) 106 log phase cells growing at 30⬚ with the pob3 alleles
indicated were harvested and the Pob3 protein was detected.
Intact Pob3 can be detected in pob3-9 strains growing at 30⬚
with longer exposures. (C) 5 ⫻ 106 cells of strain 7697 with
wild-type or pob3-12 plasmids growing at 22⬚ or shifted for 3 hr
to 37⬚ were analyzed as in A. (D) Blots were prepared as in
C (the samples for the left panel represent 106 cells while
those for the right panel are 5 ⫻ 106 cells) using the POB3
alleles indicated, and then Spt16 was detected by immunostaining. A wild-type sample examined simultaneously produced signals similar to the 22⬚ samples shown for pob3-7 and
pob3-12, and pob3-21 produced results indistinguishable from
pob3-20.
Three independent alleles (pob3-9, -12, and -13, from
two different PCR reactions and a hydroxylamine-mutagenized plasmid) were found to be identical, changing
residue Q458 to a stop codon, which appears to delete
the final 95 residues of the 552-amino acid Pob3 protein
(a fourth allele, pob3-5, also had this mutation along with
two additional changes). The Ts⫺ phenotype caused
by the Q458-stop mutation varied with different strain
backgrounds; very slow growth at 37⬚ was observed in
the original A364a background, but the hybrid A364a/
S288C strain used in Figure 1 grew normally at this
temperature. These results suggested that the C-terminal 95 amino acids of Pob3 are not essential for viability.
However, examination of the Pob3 protein in these
Figure 3.—SPT16 and POB3 alleles display synthetic defects. Strain 7697 (pob3-⌬5) or 7792-4-2 (pob3-⌬5 spt16-4) carrying pJW4 (YCp, POB3, URA3) and the pTF139 (YCp, POB3,
LEU2) derivative with the POB3 allele shown were grown to
saturation and aliquots of the dilutions indicated were placed
on complete medium (C) or medium containing 5-FOA
(Sikorski and Boeke 1991) at 26⬚. In the top panel, vector
is YCplac111 (Gietz and Sugino 1988), POB3-WT is pTF139
with the wild-type POB3 gene, and pob3-CT⌬95 is pTF139 with
a deletion of the C-terminal 95 residues of Pob3. In the bottom
panel, WT is pTF139 with wild-type POB3, ⌬ is the vector
YCplac111, and -1, -7, and -11 represent these alleles of POB3.
Failure to observe growth indicates inability of the strain to
survive loss of pJW4, either due to lack of a functional copy of
the essential POB3 gene in the case of vector or the C-terminal
deletion, or due to the synthetic lethality of the pob3 mutation
with spt16-4.
strains consistently revealed the presence of some fulllength Pob3 protein along with the expected truncated
form (Figure 2C). The truncated form was observed
even under nonpermissive conditions, whereas the fulllength form was not (Figure 2C). We constructed a
deletion of the C-terminal domain of Pob3 in which
Q458 was mutated to a stop codon but the remaining
Pob3 sequence was removed (creating pob3-CT⌬95).
This allele was unable to complement the lethality of a
pob3 deletion (Figure 3). We conclude that the C-terminal domain of POB3 is essential and that the Q458-stop
mutation is viable due to translational read-through that
is temperature sensitive in a strain-dependent manner,
not because of the production of a temperature-sensitive
protein. Consistent with this interpretation, the Q458stop nonsense mutation creates a poor termination context in yeast (Bonetti et al. 1995). It is not clear why
this mutation is recovered at such a high frequency.
The remaining pob3 alleles have mutations distributed
throughout the gene. Comparing the positions of these
mutations to the degree of conservation among 12 Pob3
homologs from GenBank (Altschul et al. 1997) indicates that many residues that are absolutely conserved
Pob3 Acts in Transcription and Replication
can be altered without loss of viability. For example,
pob3-10 has eight amino acid changes, three of which
affect residues that are invariant in all 12 Pob3 homologs. While viable, these strains display slower growth
than wild type. The complexity of these alleles prevents
us from inferring structure-function relationships, but
we note that POB3 is able to tolerate substitution of
some highly conserved residues.
Pob3 protein is rapidly lost in Ts⫺ pob3 mutants: Different pob3 alleles caused arrest of growth at different
temperatures, but even the tightest alleles allowed two
to three divisions to occur after a shift to 37⬚ (although
the number of viable cells does not increase; see below).
This is likely to be the null phenotype for pob3 mutants
since we observed a similar accumulation of cells after
germination of haploids carrying a deletion of POB3
(Wittmeyer and Formosa 1997). In addition, all of
the alleles that cause a Ts⫺ phenotype also cause the
disappearance of intact Pob3 protein as assayed by immunodetection after SDS-PAGE (Figure 2A; data not
shown). The levels of Pob3 protein were reproducibly
diminished in pob3 Ts⫺ mutants relative to wild-type
cells even under conditions permissive for growth, and
no Pob3 protein was detected within 30 min after a
shift to 37⬚. Since Pob3 is associated with Spt16, we also
determined the stability of Spt16 in pob3 mutants. As
shown in Figure 2D, we found that Spt16 levels dropped
reproducibly by about twofold upon shifting cells with
a wild-type POB3 gene to 37⬚ for 3 hr and disappeared
completely in pob3 Ts⫺ mutants under the same conditions. We conclude that pob3 mutations inhibit growth
by diminishing the level of essential Spt16-Pob3 heterodimers.
Pob3 defects cause the Spt⫺ phenotype: High copy expression and mutation of SPT16 were found previously
to produce the Spt⫺ phenotype (Clark-Adams et al.
1988; Malone et al. 1991), which results from changes
in the selection of transcription initiation sites for a
promoter found in the Ty1 ␦-element. This relieves the
auxotrophy for histidine and lysine normally caused by
the his4-912␦ and lys2-128␦ ␦-insertion alleles (ClarkAdams et al. 1988; Malone et al. 1991). We screened
the pob3 mutations to see if they also cause this phenotype. As shown in Figure 1, all of the mutations in POB3
identified for either conditional growth or slow growth
also allowed some expression of both his4-912␦ and lys2128␦. The different alleles displayed different levels of
Spt⫺ phenotype, as indicated by the different amounts
of growth on ⫺His and ⫺Lys media at different temperatures. The strength of the Spt⫺ phenotype did not correlate well with the positions of the mutations within the
gene or with the MPT (Table 3). For example, pob3-10
has a higher MPT than pob3-1, but both have a strong
Spt⫺ phenotype (both grew well on media lacking lysine). Since the Spt⫺ phenotype has been associated
previously with alterations of transcription initiation
(Winston et al. 1984; Hirschman et al. 1988; Malone
1597
et al. 1991; Winston and Carlson 1992), we infer that
pob3 mutations cause a defect in transcription. Since all
of the POB3 alleles caused the Spt⫺ phenotype even
at temperatures completely permissive for growth, we
conclude that normal transcription requires full Pob3
activity levels.
pob3 mutations interact genetically with spt16 mutations: Spt16 and Pob3 are members of the same complex
(Wittmeyer and Formosa 1997; Brewster et al. 1998).
We therefore expected the SPT16 and POB3 genes to
interact in genetic tests and reported previously that
pob3-10, -11, and -12 display a decreased MPT relative
to single mutants when combined with the spt16-G132D
mutation (Wittmeyer et al. 1999). The spt16-G132D
allele was isolated in three independent screens (Prendergast et al. 1990; Malone et al. 1991; Lycan et al.
1994; Evans et al. 1998) but this residue has been shown
to be in a region of SPT16 that can be deleted and
still produce viable cells (Evans et al. 1998). We have
identified additional conditional alleles of SPT16, including mutations in the essential region of the gene
(T. Formosa, unpublished results). We used one of
these, spt16-4 (P565S P570L), to assess the effect of a
different allele of SPT16 on pob3 mutations. To facilitate
rapid screening of large numbers of combinations of
mutations, strains were constructed with genomic mutations of SPT16, deletions of POB3, and POB3 plasmids
marked with URA3. The set of pob3 alleles on LEU2marked plasmids was then transformed into these
strains, and transformants were screened for the ability
to lose the POB3 URA3 plasmid by selecting on media
containing 5-FOA (Boeke et al. 1987). Viable double
mutants were then tested for growth at various temperatures (as described in materials and methods) to determine whether the MPT was different from the single
mutants. While spt16-G132D has a lower MPT than
spt16-4, the severity of the synthetic defects with pob3
mutations was much greater with spt16-4. As shown in
Figure 3 and Table 3, all pob3 mutations tested were
viable in combination with spt16-G132D, but displayed
very strong synthetic defects, lowering the MPT as much
as 5⬚. In contrast, 10 of the 13 combinations tested were
lethal at all temperatures when spt16-4 was used, and
the remainder also had strong synthetic defects. The
combinations of pob3 and spt16 mutations available previously (Wittmeyer et al. 1999) were therefore among
the weakest effects we have noted. These strong allelespecific defects further support the conclusion that
Spt16 and Pob3 act in a complex in vivo. Loss of function
in one protein in this case causes a requirement for the
optimal function of the other partner.
We also found that elevated levels of POB3 could
suppress some spt16 defects. A strain with a genomic
spt16-4 mutation is unable to grow at 36⬚ (Figure 4),
but providing extra copies of POB3 either on high or
low copy vectors partially suppressed this temperature
sensitivity. This suppression of the Ts⫺ phenotype was
1598
M. B. Schlesinger and T. Formosa
TABLE 3
Synthetic defects between pob3 mutations and candidate genes
MPT, or change in MPT when combined with:
POB3
allele
MPT
spt16-G132D
spt16-4
cdc17-1
ctf4-⌬
dna2-2
chl12-⌬
mec1-1
POB3
-1
-L78R
-2
-3
-4
-5
-6
-7
-8
-9
-10
-11
-20
-21
(⬎37⬚)
31⬚
31⬚
34⬚
30.5⬚
34⬚
35⬚
35.5⬚
31⬚
34.5⬚
36⬚
34⬚
34⬚
⬎37⬚
⬎37⬚
(33⬚)
⫺3⬚
⫺3⬚
⫺3⬚
⫺2.5⬚
⫺4⬚
⫺4⬚
⫺3⬚
⫺3⬚
⫺3⬚
⫺3⬚
⫺5⬚
⫺3⬚
⫺5⬚
⫺5⬚
(35⬚)
SL
SL
SL
SL
SL
SL
SL
SL
SL
⫺3⬚
SL
⫺4⬚
⫺3⬚
⫺3⬚
(33⬚)
⫺1⬚
⫺1⬚
⫺1⬚
0⬚
0⬚
0⬚
0⬚
0⬚
0⬚
0⬚
⫺1⬚
⫺1⬚
0⬚
0⬚
(⬎37⬚)
0⬚
(⬎37⬚)
⫺1⬚
⫺1⬚
0⬚
0⬚
0⬚
⫺4⬚
⫺1.5⬚
0⬚
0⬚
⫺2⬚
0⬚
0⬚
⫺8⬚
⫺8⬚
(⬎37⬚)
⫺2⬚
⫺2⬚
0⬚
⫹1⬚
0⬚
⫺1⬚
0⬚
⫹1⬚
0⬚
⫺1⬚
⫺3⬚
⫺2⬚
⫺5⬚
⫺6⬚
(37⬚)
⫹3⬚
⫹3⬚
0⬚
⫹2.5⬚
⫹3⬚
⫹2⬚
⫹1⬚
⫹5⬚
⫹1.5⬚
⫹1⬚
0⬚
⫺2.5⬚
⫺1.5⬚
⫺2⬚
0⬚
⫹1⬚
⫹1⬚
0⬚
0⬚
⫹1.5⬚
0⬚
⫺1⬚
⫺1.5⬚
⫺1.5⬚
⫺4⬚
⫺4⬚
Congenic A364a strains with a deletion of POB3 and a second genomic mutation as indicated and carrying
the POB3 allele listed on a plasmid were grown to stationary phase and incubated on rich medium at various
temperatures to determine the maximal permissive temperature (MPT). Changes in MPT are shown, relative
to the MPT of the more restrictive single mutant. Negative numbers indicate a synthetic defect, while positive
numbers denote suppression. SL indicates synthetic lethality, determined as failure to obtain growth at 26⬚.
allele specific, since it was not observed with three other
spt16 alleles, including the spt16-G132D allele (not
shown). Therefore, in a case where two proteins are
known to form a strong physical interaction, we observe
dramatic evidence for extensive, allele-specific genetic
interactions.
pob3 mutants display allele-specific synthetic defects
with several DNA replication factors: We previously
Figure 4.—An spt16 defect is suppressed by extra copies of
POB3. Strain 7782-4 (spt16-4) was transformed with pTF128
(YCp-SPT16, a functional SPT16 gene cloned into YCplac111;
Gietz and Sugino 1988), YCplac111 (YCp-vector), pTF139
(YCp-POB3), pTF138 (YEp-POB3, a plasmid with the same PCR
product found in pTF139 inserted into YEplac195; Gietz and
Sugino 1988), and YEplac195 (YEp-vector). Transformants
were grown to saturation in liquid under selection for the
plasmid, and aliquots of 10-fold dilutions were placed on rich
medium and incubated at 26⬚ or 36⬚.
found that spt16-G132D mutations display synthetic defects with several DNA replication factors, but not with
an unrelated set of Ts⫺ mutations (Wittmeyer and
Formosa 1997; Formosa and Nittis 1999). We
screened the pob3 alleles to test for similar effects and
again found several allele-specific synthetic defects consistent with a role for POB3 in DNA replication. As for
the spt16 pob3 double mutants, strains were constructed
with a deletion of POB3 covered by a URA3-marked
plasmid containing the normal POB3 gene and genomic
mutations in candidate genes. The MPT of double mutants was then tested; the difference between this value
and the MPT of the most stringent single mutant is
listed in Table 3. Representative examples of the data
are shown in Figure 5 to show the severity of these
synthetic defects.
Spt16-Pob3 binds to the Pol1 subunit of DNA polymerase ␣ (Wittmeyer and Formosa 1995, 1997), so
double mutants with the POL1 allele cdc17-1 were constructed. Relatively small but reproducible effects were
noted with four of the pob3 alleles (Figure 5 and Table
3; pob3-L78R is a derivative of pob3-1, so this pair is
counted once), similar to the effects noted with spt16G132D (Wittmeyer and Formosa 1997). POB3 therefore interacts genetically with DNA polymerase ␣. Ctf4
protein appears to compete with Spt16-Pob3 for binding
to Pol1 (Miles and Formosa 1992b; Wittmeyer and
Formosa 1995, 1997), so a ctf4 deletion might be expected to rescue some pob3 mutations since it might
reduce the competition for Pol1 binding. In fact, the
temperature sensitivity caused by several pob3 alleles was
Pob3 Acts in Transcription and Replication
1599
Figure 5.—pob3 mutations display synthetic defects with several
DNA replication factors. (A) Cultures of congenic A364a strains
with the pob3-⌬5 deletion, a plasmid with the POB3 allele indicated
to the left of each panel, and either normal or mutated genomic
versions of POL1 (cdc17-1; 7791-82), DNA2 (dna2-2; 7799-1-4), CTF4
(ctf4-⌬; 7790-5-2), or MEC1 (mec11; 7788-4-4) as indicated at the top
of each panel were grown to saturation. Aliquots of 10-fold dilutions were placed on rich media
and incubated at the temperatures shown to the right of each
panel. Identical aliquots placed at
26⬚ gave numbers of viable cells
similar to the POB3 control in
each case and so are not shown.
(B) As in A, except both 22⬚ and
30⬚ plates are shown since the
growth of the strains varied. Row
1 is 7697, rows 2 and 3 are 78051-4 (chl12-⌬), and rows 4 and 5 are
7799-1-4 (dna2-2). Rows 2 and 4
show pTF139 (wild-type POB3),
and rows 1, 3, and 5 show pTF139L78R (pob3-L78R ; identical results
were obtained with pob3-1).
observed to be suppressed by the ctf4 mutation (Table
3). However, as previously noted (Wittmeyer et al.
1999) some pob3 alleles display a synthetic defect with
the ctf4 mutation (Table 3 and Figure 5). The alleles
pob3-20 and -21 that alter the extreme C terminus of
Pob3 (Table 3) are particularly affected. The observation of both suppression and enhancement of the Ts⫺
phenotypes of pob3 mutants upon deletion of CTF4 suggests that the interactions among Pol ␣, Spt16-Pob3,
and Ctf4 are more complicated than predicted by a
simple binding-competition model.
DNA2 encodes an essential nuclease/helicase that has
been implicated in Okazaki fragment maturation (Budd
et al. 1995; Budd and Campbell 1997; Fiorentino and
Crabtree 1997; Bae et al. 1998; Formosa and Nittis
1999). The dna2-2 allele alters a residue expected to
destroy helicase function (Formosa and Nittis 1999)
and causes synthetic lethality with a ctf4 deletion as well
as sensitivity to the DNA-damaging agent methyl methanesulfonate (Formosa and Nittis 1999), but does not
affect growth at elevated temperatures. An spt16-G132D
mutation displayed a strong synthetic defect when combined with dna2-2 (Wittmeyer and Formosa 1997;
Formosa and Nittis 1999), so we screened the effect
of pob3 mutants in combination with dna2-2. Strong
interactions were found, particularly with the pob3 alleles that altered or removed portions of the C terminus
of Pob3 (Figure 5 and Table 3).
Deletion of CHL12 is lethal when combined with mutations in either DNA2 or CTF4 (Formosa and Nittis
1999). This gene has strong sequence similarity to the
five RFC genes that encode the DNA polymerase processivity clamp loading factor RFC (Kouprina et al.
1994; Cullmann et al. 1995) and has been implicated
in DNA metabolism (Kouprina et al. 1994). Several
pob3 alleles also displayed strong synthetic effects with
a deletion of CHL12 (Table 3 and Figure 5). As with
ctf4, both suppression and enhancement were noted,
with a similar pattern of allele specificity. Taken together, the allele-specific synthetic effects observed with
these replication factors provide further evidence of a
role for Pob3 in DNA replication.
POB3 deficiencies cause sensitivity to hydroxyurea:
Hydroxyurea inhibits ribonucleotide reductase, leading
to decreased rates of synthesis of the dNTPs required
for DNA replication. If yeast Spt16-Pob3 functions in
DNA replication in a manner analogous to the activity
displayed by the human FACT complex in transcription
(Orphanides et al. 1998, 1999), then DNA replication
elongation should be inhibited in pob3 mutants due
to difficulty progressing through nucleosomes. If two
factors independently impair replication elongation,
they should produce a stronger defect when they are
combined than when they are applied separately. We
therefore examined the set of pob3 mutants for the ability to grow on media containing hydroxyurea (HU).
1600
M. B. Schlesinger and T. Formosa
Figure 6.—Mutating POB3 can cause hydroxyurea sensitivity. Strain 7697 (pob3-⌬5) with pTF139 containing wild-type
POB3 or the allele shown at the left of each panel was grown
to saturation and aliquots of 10-fold dilutions were placed on
rich media (⫺HU) or rich media with 120 mm hydroxyurea
(⫹HU) and incubated at 26⬚ or 32⬚.
The pob3-7 allele caused sensitivity to HU even at low
temperatures (Figure 6). The Ts⫺ phenotype caused
by pob3-7 was separable from the HU sensitivity, since
reconstructed alleles with only W28R and N69K mutations displayed the full Ts⫺ phenotype but were not HU
sensitive at 26⬚ (not shown). Since pob3-7 is one of the
most stringent Ts⫺ alleles, we tested to see whether other
alleles cause HU sensitivity at temperatures nearer to
their MPT. In all cases, we found that pob3 mutants were
sensitive to HU at some temperature compared to wildtype POB3 strains (Figure 6). In some cases the effect
was small (addition of HU to a pob3-L78R strain caused
a ⬎1000-fold decrease in viability at 32⬚, but at this
temperature the viability of this strain in the absence
of HU is diminished by ⵑ100-fold relative to 26⬚, so it
is already severely stressed), but in other cases it was
robust (addition of HU to a pob3-2 strain caused at least
a 10,000-fold effect at 32⬚, which is well below the MPT
of 34⬚ for this strain). Since all pob3 alleles caused HU
sensitivity under some conditions, HU enhances the
defect caused by pob3 mutations, and this effect is severe
with some alleles. Since partial loss of Pob3 function
and inhibition of dNTP synthesis have additive effects,
we conclude that HU and Pob3 both function in the
same essential process. Since the rapid dNTP synthesis
inhibited by HU is required only for DNA replication,
this common process is likely to be DNA replication.
pob3 mutants depend on a DNA replication checkpoint to maintain viability: As a further test for a role in
DNA replication, we determined the effect of disabling
DNA damage checkpoints in pob3 mutants. If pob3 mutants fail to perform DNA replication normally, replication checkpoints such as the one promoted by MEC1
should be important for maintaining the viability of
pob3 mutants (Elledge 1996; Paulovich et al. 1997;
Longhese et al. 1998; Weinert 1998). Strains with
Figure 7.—The Mec1 checkpoint protects the viability of
pob3 mutants. Congenic strains 7697 (pob3-⌬5) and 7788-4-4
(pob3-⌬5 mec1-1) with either POB3 or pob3-1 plasmids were
grown to log phase and shifted to 37⬚ in rich liquid medium.
At the times shown, aliquots were removed and sonicated,
and dilutions were placed on rich medium at 26⬚. The total
number of cells and the number of cells giving rise to colonies
were determined by microscopic examination of the plates
and by counting colonies. The number of colony-forming
units is shown, normalized for each strain to the value at the
time of the shift. Filled squares, POB3; open squares, mec1-1;
filled circles, pob3-1; open circles, pob3-1 mec1-1.
mec1-1 and pob3 mutations were therefore examined for
changes in viability after inactivating Pob3 function by
shifting to a nonpermissive temperature.
Figure 7 shows that cells with a wild-type POB3 gene
continue to grow at 37⬚ whether MEC1 is intact or mutated (although the mec1-1 strain initially loses some
viability and then grows slowly). While the pob3-1 MEC1
strain failed to grow at 37⬚ as expected, it retained full
viability for ⵑ12 hr and then lost ⵑ90% of its viability
during the subsequent 12 hr. In contrast, the pob3-1
mec1-1 double mutant began losing viability immediately
upon shifting to 37⬚, and this loss continued throughout
the course of the incubation, resulting in an ⵑ1000fold drop in viability after 24 hr. Therefore, the pob3-1
allele caused a strong dependence on the MEC1 checkpoint for surviving at 37⬚, such that after 24 hr at this
restrictive temperature pob3-1 mec1-1 double mutants
had 100-fold less viability than pob3-1 MEC1 single mutants. The timing and total loss of viability for MEC1
and mec1 strains varied in different experiments but was
20- to 100-fold lower for the mec1 strain after 24 hr
in several independent trials with both pob3-1 and the
reconstructed pob3-L78R. Similar results were obtained
with pob3-7 (not shown). Ts⫺ pob3 mutants therefore
depend on the MEC1 checkpoint to retain viability under nonpermissive conditions. This is a strong indication that pob3 deficiency causes a defect in DNA replication. This effect is at least somewhat checkpoint specific
since similar experiments with a deletion of the G2
Pob3 Acts in Transcription and Replication
Figure 8.—The mec1-1 mutation prevents arrest of pob3-1
mutants as single-nucleated cells. The same strains shown in
Figure 7 were examined before and after a 3-hr shift to 37⬚.
Cells were fixed in formaldehyde, washed with methanol and
then acetone, and stained with 4⬘,6-diamidino-2-phenylindole
(DAPI), as described (Miles and Formosa 1992a). The percentage of cells (at least 300 counted for each condition) that
were unbudded, small-budded, or large-budded is shown in
the top panel. The percentage of the large-budded cells with
one or two nuclei is shown in the bottom panel.
checkpoint gene RAD9 (Weinert and Hartwell 1988)
did not show a similar response (data not shown).
As noted earlier, pob3 Ts⫺ mutants placed on agar
plates at 37⬚ double two to three times to produce four
to eight cell bodies. However, pob3-1 mec1-1 cells placed
at 37⬚ appeared to arrest immediately. We determined
the concentration of cells in the liquid cultures from
the experiment shown in Figure 7 by direct examination
in a hemacytometer (after sonication). The cultures of
POB3 MEC1 and POB3 mec1-1 strains each increased
their total cell number by 52-fold in 24 hr, the pob3-1
MEC1 strain increased by 5.2-fold, and the pob3-1 mec1-1
strain increased by 1.4-fold. Since the pob3-1 cells continued to increase in cell number during a period when
the number of viable cells was constant or dropping,
the increase must be due to the production of inviable
cells, and this was observed as an increase in the number
of cells that failed to form colonies after being placed
at 26⬚ (not shown). We expected the loss of a checkpoint
to result in decreased viability as observed, but we also
expected the loss of a monitor to be accompanied by
increased cell cycle progression (Weinert and Hartwell 1988). Instead, we find that pob3 mec1 double mutants arrest more rapidly than pob3 MEC1 strains. Examination of the nuclear morphology of the cells provides
a potential explanation. As shown in Figure 8, pob3-1
cells accumulated an abnormally high level of singlenucleated large-budded cells after a shift to 37⬚ (59% of
the large-budded cells had a single nucleus after a 3 hr
shift vs. 26% for WT), but pob3-1 mec1-1 double mutants
did not (14% of the large-budded cells had a single
nucleus). Since the double mutants do not progress
significantly into S phase under these conditions (see
below), but produce binucleated large-budded cells, it
1601
appears that these strains have a “cut” phenotype in
which a 1C DNA content is segregated into two nuclei.
This could cause both the inviability and the rapid cessation of growth that were observed in the absence of the
MEC1 checkpoint.
Loss of the MEC1 checkpoint was found to alter the
MPT of pob3 mutants (Table 3 and Figure 5). In some
cases (notably pob3-11) combination with the mec1-1 mutation caused a drop in the MPT, indicating that at
elevated temperatures these strains were capable of
growth only because of the action of the checkpoint,
presumably due to the presence of levels of DNA damage that would be lethal if mitosis were permitted. Surprisingly, however, most pob3 alleles displayed an increase in the MPT when combined with the mec1-1
mutation. In several cases the suppression of temperature sensitivity was dramatic (pob3-1 and -7, for example), even though these same alleles caused dependence
on the MEC1 checkpoint for retaining viability at 37⬚
(Figure 7; data not shown). These alleles therefore allow
growth at higher temperatures when MEC1 is mutated
than when it is intact, but cause more rapid death at
37⬚ when MEC1 is mutated. Examination of the cells
rescued by the loss of the checkpoint (pob3-1 mec1-1 cells
growing at 32⬚ as in Figure 5, for example) reveals that
they are abnormal in both cell and colony morphology
and that they have reduced plating efficiency. Apparently these cells sustain enough damage at intermediate
temperatures like 32⬚ to cause cell cycle arrest through
the MEC1 checkpoint pathway, but not enough damage
to lead to cell death in every case if this arrest does not
occur (see discussion).
pob3 mutants progress slowly through S phase: As a
more direct test for proficiency of S phase progression,
we examined the DNA content of cells with pob3 mutations by flow cytometry. Rapidly growing cultures shifted
to 37⬚ for up to 24 hr did not display dramatic changes
in the distribution of DNA contents, although some
alleles caused a small shift towards 1C, indicating a slight
tendency to arrest in G1 (not shown). This differs from
the spt16-G132D allele, which causes ⵑ80% arrest in G1
(Prendergast et al. 1990; Rowley et al. 1991; Wittmeyer and Formosa 1997), although this is not a property of all spt16 alleles (T. Formosa, unpublished observations). pob3 mutations therefore do not cause a
uniform arrest at a unique point in the cell cycle, consistent with the data in Figure 8.
To examine populations synchronously traversing S
phase, cells were arrested with the mating pheromone
␣-factor and then were released from this block into
media at permissive or restrictive temperatures. POB3
cells entered S phase at either 22⬚ or 37⬚ after 50–60
min and completed replication by ⵑ80 min (Figure 9,
top). The pob3-1 mutants also traversed S phase at 22⬚
with about the same timing as wild type, although fewer
cells ultimately released from the block, suggesting a
delay at the G1/S boundary. When pob3-1 cells were
1602
M. B. Schlesinger and T. Formosa
tive temperature, even after several hours of release
from ␣-factor. Since 86% of these cells are binucleate
(Figure 8), most of these cells must contain nuclei with
less than a 1C DNA content.
DISCUSSION
Figure 9.—A pob3 mutation causes a delayed, slow S phase.
Strains 7697 (pob3-⌬5, top) and 7788-4-4 (pob3-⌬5 mec1-1, bottom) containing a POB3 or pob3-1 plasmid were grown to log
phase in rich media, arrested with ␣-factor (4 ␮g/ml) for 3 hr
(7697) or 4.5 hr (7788-4-4; mec1-1 strains grow slowly and
require a longer incubation to achieve similar arrest), and
released from the arrest by resuspending in fresh media containing protease at either 22⬚ or 37⬚. Samples were taken at
10-min intervals and examined by flow cytometry to determine
the distribution of DNA contents. The 1C and 2C positions
are indicated by the initial and final profiles for the wild-type
POB3 cultures.
released to 37⬚, this G1/S delay was even more pronounced, with only about half of the cells released by
90 min. This shows that pob3-1 cells are less likely to
traverse the G1/S boundary under restrictive conditions, reminiscent of the arrest of spt16 mutants that
are unable to synthesize sufficient cyclin proteins to
surmount this step (Rowley et al. 1991). The pob3-1
cells that did enter S phase at 37⬚ did so later than wild
type and appeared to delay in S phase. Comparing the
wild type at 60 and 70 min to pob3-1 at 70 and 80 min
at 37⬚, it appears that the wild-type cells rapidly traverse
S phase and accumulate as 2C cells soon after they
release from G1, but the pob3-1 cells accumulate as cells
with an intermediate DNA content indicating slow progression through S phase. The shape of the profile
shown with pob3-1 cells released at 37⬚ for 80 min shows
that many cells have entered S phase but have not progressed efficiently. This shape was reproducible in several experiments, and was also observed using the pob3-7
allele (not shown). We conclude that Ts⫺ pob3 mutants
have difficulty entering S phase at a restrictive temperature and also progress slowly through S phase.
Since S phase progression is monitored by MEC1 and
loss of this checkpoint altered the viability of pob3 mutants, we also tested the progression of replication in
pob3 mec1 double mutants (Figure 9, bottom). The double mutants failed to progress significantly at the restric-
Spt16 and Pob3 form a stable heterodimer in S. cerevisiae, and complexes of homologous proteins have also
been found in human and frog cells (Okuhara et al.
1999; Orphanides et al. 1999). The human version of
this factor (FACT) has been shown to promote elongation of RNA polymerase II on nucleosomal templates
(Orphanides et al. 1998, 1999), and the frog version
(DUF) has been implicated in DNA replication (Okuhara et al. 1999). Genetic evidence from yeast revealed
a role for Spt16 in transcription (Prendergast et al.
1990; Malone et al. 1991; Rowley et al. 1991; Xu et al.
1993, 1995; Lycan et al. 1994; Brewster et al. 1998;
Evans et al. 1998), and physical and genetic evidence
showed that Spt16-Pob3 interacts with DNA polymerase
␣ (Wittmeyer and Formosa 1995, 1997; Formosa and
Nittis 1999; Wittmeyer et al. 1999). We have proposed
that Spt16-Pob3 acts both in transcription and replication, possibly by affecting the properties of the chromatin that is the common substrate for both processes.
Here we have shown that conditional mutations in POB3
display transcription defects similar to those caused by
mutations in SPT16, interact extensively with SPT16 as
well as with several replication factors, and cause defects
in DNA replication. These results strengthen the proposal that Spt16 and Pob3 act together in both transcription and replication.
Spt16 and Pob3 form a complex required for normal
transcription: Both elevated SPT16 copy number and
the spt16-G132D mutation cause altered transcription
initiation site selection (Clark-Adams et al. 1988;
Malone et al. 1991; Rowley et al. 1991), which can lead
to either increased or decreased expression at different
loci (Rowley et al. 1991; Lycan et al. 1994). While
elevated levels of POB3 were also found to cause some
transcription defects, this did not include the Spt⫺ phenotype (Brewster et al. 1998). We isolated a set of pob3
mutants and found that all display the Spt⫺ phenotype,
indicating that full Pob3 function is required to produce
normal patterns of transcription.
Spt16 and Pob3 were detected in whole cell lysates
only in a complex with one another (Brewster et al.
1998; Wittmeyer et al. 1999), so we expected them to
function together. Consistent with this, we previously
found that three alleles of POB3 all caused synthetic
defects with the spt16-G132D mutation (Wittmeyer et
al. 1999). While this allele causes the most stringent Ts⫺
phenotype of any of the spt16 mutations we have isolated
(T. Formosa, unpublished observations) and was isolated in four independent genetic screens (see Evans
et al. 1998; T. Formosa, unpublished observations), we
Pob3 Acts in Transcription and Replication
show here that its genetic interactions with POB3 are
mild compared with another allele, spt16-4. While spt16G132D significantly reduced the MPT when combined
with any pob3 mutation, spt16-4 was lethal in 10 of 13
combinations tested. Further, while spt16-G132D was not
noticeably affected by increased levels of POB3 copy
number, the Ts⫺ phenotype of spt16-4 was strongly suppressed by elevated POB3. SPT16 and POB3 therefore
displayed the extensive allele-specific genetic interactions expected for members of a common complex.
Interactions with replication factors: Ctf4 and Spt16Pob3 each bind to Pol1 (Miles and Formosa 1992a,b;
Wittmeyer and Formosa 1997), and CTF4 mutations
display synthetic lethality with mutations in the
nuclease/helicase encoded by DNA2 and with mutations
in a potential effector of polymerase processivity clamp
loading encoded by CHL12 (Formosa and Nittis
1999). We found previously that the Ts⫺ phenotypes
of some pob3 and spt16 mutations were enhanced by
deletion of CTF4 (Wittmeyer and Formosa 1997;
Wittmeyer et al. 1999), although the apparent competition between Ctf4 and Spt16-Pob3 for binding to Pol1
might predict that the loss of Ctf4 should suppress the
defects in SPT16 or POB3. We now find that the Ts⫺
phenotype caused by some alleles of pob3 is suppressed
by loss of Ctf4, indicating a complex relationship among
these gene products. A similar pattern of allele-specific
suppression or enhancement of temperature sensitivity
was found with a chl12 deletion, suggesting that this
potential PCNA clamp loading or unloading protein
interacts with Spt16-Pob3 in a way similar to Ctf4. Synthetic defects with POL1 itself and with the nuclease/
helicase encoded by DNA2 further strengthen ties between POB3 and members of the eukaryotic replication
complex.
Ts⫺ mutants result from partially impaired gene products that either become less functional at elevated temperatures or are unable to meet an increased requirement for their function at elevated temperatures. The
Ts⫺ pob3 mutations lead to decreased Pob3 protein levels under permissive conditions and undetectable levels
at 37⬚. The effect of these mutations is therefore likely
to be the same as complete deletion of the POB3 gene
at 37⬚, but the interpretation of the phenotypes at semipermissive tempteratures is less obvious. The genetic
interactions observed could be due to changes in Pob3
protein stability or changes in either Pob3 function or
the level of Pob3 function required. These genetic interactions could therefore reflect physical interactions, as
suspected in the POB3-SPT16 case, or they could be due
to indirect effects. Therefore, the observation that pob3
mutations interact genetically with many replication factors suggests that Pob3 function is needed for normal
DNA replication, but we cannot conclude that this is
related to the direct Spt16-Pob3:Pol1 interaction detected in vitro. It is noteworthy that mutations in CTF4,
DNA2, and CHL12, a set of genes that show mutual
1603
synthetic lethality, affected the same pob3 alleles most
severely and that these mutations produce stable Pob3
proteins with defective C termini. The physical basis for
these allele-specific interactions remains to be determined through further investigation.
HU inhibits dNTP synthesis and can be particularly
toxic to cells lacking S phase checkpoints (since they
fail to respond to slow progression of replication) and
to cells with impaired replication (since two mechanisms that partially inhibit the same process independently cause a more severe defect when combined).
pob3-7 caused sensitivity to HU at all temperatures, and
other alleles caused HU sensitivity at elevated temperatures. Since all pob3 alleles tested caused the Spt⫺ phenotype, reflecting a defect in transcription at temperatures
permissive for growth, but only one allele caused HU
sensitivity at low temperatures, HU sensitivity is unlikely
to be a secondary effect of a transcription deficiency.
Diminished Pob3 function therefore appears to affect
the same process as HU, suggesting that Pob3 is required for normal DNA replication.
Detecting errors in replication: Alterations in transcription can be readily detected since a broad range
of transcription rates can be tolerated for many genes.
DNA replication is not so flexible: all sequences must be
accurately copied once per cell cycle. Serious replication
errors are therefore lethal, and detecting more subtle
defects is difficult. Since many mutations in known replication factors lead to arrest as large-budded cells with
a single nucleus and a 2C DNA content, this morphology
has been inferred to suggest that replication errors
might be present and could reflect the intervention of
checkpoints that prevent mitosis until repair can occur
(Elledge 1996; Paulovich et al. 1997; Longhese et al.
1998; Weinert 1998). Because of the various forms of
repair and the limited capacity of each repair pathway,
damaged DNA can lead to increased levels of recombination, increased chromosome loss, and sensitivity to
further DNA damage. These phenotypes can therefore
reveal some replication errors, but if replication fork
progression is simply impeded, the DNA itself would
not be considered damaged and these repair-mediated
phenotypes would not be expressed even though replication was abnormal. pob3 mutants accumulated increased numbers of large-budded single-nucleated cells,
which could reflect a replication defect, but neither
spt16-G132D nor any of the pob3 alleles described here
caused dramatic plasmid or chromosome fragment loss
phenotypes, nor did they lead to sensitivity to DNA
damage using MMS or UV (Wittmeyer and Formosa
1997; data not shown). These results suggest that spt16
and pob3 mutants do not require elevated levels of DNA
repair, but do not rule out the possibility that progression of replication forks is impaired.
Checkpoints monitor the status of cell cycle events,
acting to slow or prevent cell cycle progression when
the genome or critical cellular structures like the mitotic
1604
M. B. Schlesinger and T. Formosa
spindle are flawed (Elledge 1996; Paulovich et al.
1997; Longhese et al. 1998; Weinert 1998; Amon 1999).
The signals detected by the checkpoints are not known,
but different genes appear to be required to monitor
different aspects of DNA integrity. The MEC1 checkpoint is particularly important for monitoring S phase
progression (Paulovich and Hartwell 1995; Desany
et al. 1998). Cells lacking MEC1 are sensitive to hydroxyurea (Desany et al. 1998) and die rapidly in the presence
of mutations in replication factors (Weinert et al. 1994).
MEC1 has an essential role aside from its checkpoint
function, which is related to deoxynucleotide production (Zhao et al. 1998). While its precise mechanism is
not clear, MEC1 seems to both monitor and participate
in DNA replication, but has not been implicated in
global regulation of transcription (although it does participate in the signal transduction pathway that induces
some genes in response to DNA damage; Elledge 1996;
Desany et al. 1998; Weinert 1998). We therefore used
a mec1-1 mutation to determine whether POB3 functions
in DNA replication as well as in transcription, reasoning
that even subtle errors that prevent normal progression
of replication would lead to increased dependence on
this checkpoint.
Double pob3 mec1 mutants were found to die more
rapidly at 37⬚ than either single mutant, leading to a
20- to 100-fold decrease in the number of viable cells
after a 24-hr incubation at 37⬚ when the checkpoint
was inactive. The DNA content of these cells and their
nuclear morphology were also examined and indicated
that loss of the MEC1 checkpoint caused premature
mitosis, since most pob3 mec1 cells had two nuclei but
only a 1C DNA content. Loss of Pob3 function therefore
causes a defect that signals a delay in cell cycle progression through the MEC1 checkpoint, and failure of the
checkpoint causes inappropriate progression into mitosis and rapid death. Since MEC1 monitors S phase, the
dependence on MEC1 strongly indicates that pob3 mutants cause a defect in DNA replication.
Since pob3 mutants depend on MEC1 function to remain viable at a restrictive temperature, we expected
double pob3 mec1 mutants to display a synthetic defect
and die at lower temperatures. This was the case for
at least one allele, but, in general, inactivation of the
checkpoint caused an increase in the maximal permissive temperature. We infer two conclusions from this
observation. First, this means that the Ts⫺ pob3 mutants
arrest growth at elevated temperatures because of a
problem with DNA replication rather than with transcription. Since, for example, pob3-1 strains grow at 32⬚
only if the MEC1 checkpoint is inactive, this checkpoint
is part of the mechanism that prevents growth of pob3-1
mutants at 32⬚. If pob3-1 mutants arrested growth at 32⬚
due to a lethal deficiency in transcription, this should
not be affected by loss of an S phase checkpoint. Therefore, since MEC1 monitors DNA replication and detects
the pob3 mutant defect, the lethal defect in pob3 mutants
is inferred to be in the replication pathway. Second, the
MEC1-dependent checkpoint must be able to detect
sublethal amounts of damage. As the temperature rises,
a pob3-1 mutant encounters increasing amounts of damage until at 31⬚ the signal through the MEC1 pathway
is sufficient to prevent further growth. However, if the
checkpoint is inactive at least some of the cells continue
to progress. Between 31⬚ and 34⬚, this is often lethal,
but enough cells survive to produce significant growth.
Above 34⬚, the amount of damage is always lethal so the
checkpoint is needed to survive incubations under these
conditions. The checkpoint is therefore able to detect
a dangerous situation before it is actually lethal, indicating a prudent but not an essential course of action.
The role of Spt16-Pob3: Chromatin must be altered
both to allow assembly of polymerase complexes at initiation sites and to allow passage of polymerases during
elongation, so factors that mediate interactions between
polymerases and chromatin could affect either initation
or elongation. The Spt⫺ phenotype in yeast is most
readily explained by altered initiation site selection,
while the activity of human FACT indicates a role in
elongation. These conclusions appear contradictory,
but altering chromatin could affect both phases of transcription.
The results reported with the frog DUF complex and
those presented here are also ambiguous concerning
the role of Spt16-Pob3 in DNA replication initiation or
elongation. Depletion of DUF from extracts blocked
replication as assayed both by nucleotide incorporation
and by examination of replication intermediates (Okuhara et al. 1999). This could indicate either failure to
initiate or a very early block to elongation. Using flow
cytometry we found that at 37⬚, pob3-1 cells entered S
phase inefficiently (not all cells participated) and traversed S phase slowly (cells accumulated with less than
a 2C DNA content for longer than normal). The failure
to release from G1 into S phase efficiently could be due
to a transcription defect as observed for spt16-G132D
(Rowley et al. 1991), or it could be due to inefficient
initiation at replication origins. Slow progression of S
phase could also be caused by inefficient initiation,
which would require each active replication fork to copy
a larger portion of the genome and lead to a longer S
phase, or it could be due to slow progression by individual replication complexes as expected if chromatin
structures impeded replication to an abnormal extent.
The sensitivity of pob3 mutants to hydroxyurea suggests
a role in elongation, but might instead reflect an inability to initiate efficiently in the absence of normal dNTP
concentrations. Further analysis of replication intermediates will therefore be needed to determine the role
of Spt16-Pob3 in replication. The availability of the set
of pob3 mutants described here will be useful for pursuing this approach.
Pob3 Acts in Transcription and Replication
We thank Jacqui Wittmeyer for providing strains, plasmids, and
other materials used in initiating this project, and Jennifer Ginn
for excellent technical assistance. We thank Jacqui Wittmeyer, David
Stillman, and Brad Cairns for valuable discussions and improvements
to this manuscript. This work was supported by a grant from the
National Science Foundation to T.F.
LITERATURE CITED
Altschul, S. F., T. L. Madden, A. A. Schaffer, J. Zhang, Z. Zhang
et al., 1997 Gapped BLAST and PSI-BLAST: a new generation
of protein database search programs. Nucleic Acids Res. 25: 3389–
3402.
Amon, A., 1999 The spindle checkpoint. Curr. Opin. Genet. Dev.
9: 69–75.
Bae, S. H., E. Choi, K. H. Lee, J. S. Park, S. H. Lee et al., 1998 Dna2
of Saccharomyces cerevisiae possesses a single-stranded DNAspecific endonuclease activity that is able to act on doublestranded DNA in the presence of ATP. J. Biol. Chem. 273: 26880–
26890.
Boeke, J. D., J. Trueheart, G. Natsoulis and G. R. Fink, 1987
5-fluoroorotic acid as a selective agent in yeast molecular genetics.
Methods Enzymol. 154: 164–175.
Bonetti, B., L. Fu, J. Moon and D. M. Bedwell, 1995 The efficiency
of translation termination is determined by a synergistic interplay
between upstream and downstream sequences in Saccharomyces
cerevisiae. J. Mol. Biol. 251: 334–345.
Brewster, N. K., G. C. Johnston and R. A. Singer, 1998 Characterization of the CP complex, an abundant dimer of Cdc68 and
Pob3 proteins that regulates yeast transcriptional activation and
chromatin repression. J. Biol. Chem. 273: 21972–21979.
Budd, M. E., and J. L. Campbell, 1997 A yeast replicative helicase,
Dna2 helicase, interacts with yeast FEN-1 nuclease in carrying
out its essential function. Mol. Cell. Biol. 17: 2136–2142.
Budd, M. E., W.-C. Choe and J. L. Campbell, 1995 DNA2 encodes
a DNA helicase essential for replication of eukaryotic chromosomes. J. Biol. Chem. 270: 26766–26769.
Cadwell, R. C., and G. F. Joyce, 1992 Randomization of genes by
PCR mutagenesis. PCR Methods Appl. 2: 28–33.
Clark-Adams, C. D., D. Norris, M. A. Osley, J. S. Fassler and F.
Winston, 1988 Changes in histone gene dosage alter transcription in yeast. Genes Dev. 2: 150–159.
Cullmann, G., K. Fien, R. Kobayashi and B. Stillman, 1995 Characterization of the five replication factor C genes of Saccharomyces
cerevisiae. Mol. Cell. Biol. 15: 4661–4671.
Desany, B. A., A. A. Alcasabas, J. B. Bachant and S. J. Elledge,
1998 Recovery from DNA replicational stress is the essential
function of the S-phase checkpoint pathway. Genes Dev. 12: 2956–
2970.
Elledge, S. J., 1996 Cell cycle checkpoints: preventing an identity
crisis. Science 274: 1664–1672.
Evans, D. R., N. K. Brewster, Q. Xu, A. Rowley, B. A. Altheim et
al., 1998 The yeast protein complex containing cdc68 and pob3
mediates core-promoter repression through the cdc68 N-terminal
domain. Genetics 150: 1393–1405.
Fiorentino, D. F., and G. R. Crabtree, 1997 Characterization of
Saccharomyces cerevisiae dna2 mutants suggests a role for the helicase late in S phase. Mol. Biol. Cell 8: 2519–2537.
Formosa, T., and T. Nittis, 1999 Dna2 mutants reveal interactions
with DNA polymerase ␣ and Ctf4, a Pol ␣ accessory factor, and
show that full DNA2 helicase activity is not essential for growth.
Genetics 151: 1459–1470.
Gietz, R. D., and A. Sugino, 1988 New yeast-Escherichia coli shuttle
vectors constructed with in vitro mutagenized yeast genes lacking
six-base pair restriction sites. Gene 74: 527–534.
Harlow, E., and D. Lane, 1988 Antibodies, A Laboratory Manual.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
Hartwell, L. H., 1967 Macromolecule synthesis in temperaturesensitive mutants of yeast. J. Bacteriol. 93: 1662–1670.
Hirschman, J. E., K. J. Durbin and F. Winston, 1988 Genetic evidence for promoter competition in Saccharomyces cerevisiae.
Mol. Cell. Biol. 8: 4608–4615.
Kouprina, N., E. Kroll, A. Kirillov, V. Bannikov, V. Zakharyev et
1605
al., 1994 CHL12, a gene essential for the fidelity of chromosome
transmission in the yeast Saccharomyces cerevisiae. Genetics 138:
1067–1079.
Longhese, M. P., M. Foiani, M. Muzi-Falconi, G. Lucchini and
P. Plevani, 1998 DNA damage checkpoint in budding yeast.
EMBO J. 17: 5525–5528.
Lycan, D., G. Mikesell, M. Bunger and L. Breeden, 1994 Differential effects of Cdc68 on cell cycle-regulated promoters in Saccharomyces cerevisiae. Mol. Cell. Biol. 14: 7455–7465.
Malone, E. A., C. D. Clark, A. Chiang and F. Winston, 1991 Mutation in SPT16/CDC68 suppress cis- and trans-acting mutations
that affect promoter function in Saccharomyces cerevisiae. Mol. Cell.
Biol. 11: 5710–5717.
Miles, J., and T. Formosa, 1992a Evidence that POB1, a Saccharomyces cerevisiae protein that binds to DNA polymerase ␣, acts in
DNA metabolism in vivo. Mol. Cell. Biol. 12: 5724–5735.
Miles, J., and T. Formosa, 1992b Protein affinity chromatography
with purified yeast DNA polymerase ␣ detects proteins that bind
to DNA polymerase. Proc. Natl. Acad. Sci. USA 89: 1276–1280.
Newport, J., 1987 Nuclear reconstitution in vitro: stages of assembly
around protein-free DNA. Cell 48: 205–217.
Okuhara, K., K. Ohta, H. Seo, M. Shioda, T. Yamada et al., 1999
A DNA unwinding factor involved in DNA replication in cell-free
extracts of Xenopus eggs. Curr. Biol. 9: 341–350.
Orphanides, G., G. LeRoy, C.-H. Chang, D. S. Luse and D. Reinberg, 1998 FACT, a factor that facilitates transcript elongation
through nucleosomes. Cell 92: 105–116.
Orphanides, G., W. H. Wu, W. S. Lane, M. Hampsey and D. Reinberg, 1999 The chromatin-specific transcription elongation
factor FACT comprises human SPT16 and SSRP1 proteins. Nature 400: 284–288.
Paulovich, A. G., and L. H. Hartwell, 1995 A checkpoint regulates the rate of progression through S phase in S. cerevisiae in
response to DNA damage. Cell 82: 841–847.
Paulovich, A. G., D. P. Toczyski and L. H. Hartwell, 1997 When
checkpoints fail. Cell 88: 315–321.
Prendergast, J. A., L. E. Murray, A. Rowley, D. R. Carruthers,
R. A. Singer et al., 1990 Size selection identifies new genes that
regulate Saccharomyces cerevisiae cell proliferation. Genetics 124:
81–90.
Rose, M. D., F. Winston and P. Hieter, 1990 Methods in Yeast Genetics, A Laboratory Course Manual. Cold Spring Harbor Laboratory
Press, Cold Spring Harbor, NY.
Rowley, A., R. A. Singer and G. Johnston, 1991 CDC68, a yeast
gene that affects regulation of cell proliferation and transcription,
encodes a protein with a highly acidic carboxyl terminus. Mol.
Cell. Biol. 11: 5718–5726.
Schnell, R., L. D’Ari, M. Foss, D. Goodman and J. Rine, 1989 Genetic and molecular characterization of suppressors of SIR4 mutations in Saccharomyces cerevisiae. Genetics 122: 29–46.
Sikorski, R. S., and M. D. Boeke, 1991 In vitro mutagenesis and
plasmid shuffling: from cloned gene to mutant yeast. Methods
Enzymol. 194: 302–318.
Weinert, T., 1998 DNA damage and checkpoint pathways: molecular anatomy and interactions with repair. Cell 94: 555–558.
Weinert, T., and L. Hartwell, 1988 The RAD9 gene controls the
cell cycle response to DNA damage in Saccharomyces cerevisiae.
Science 241: 317–322.
Weinert, T. A., G. L. Kiser and L. H. Hartwell, 1994 Mitotic
checkpoint genes in budding yeast and the dependence of mitosis
on DNA replication and repair. Genes Dev. 8: 652–665.
Winston, F., and M. Carlson, 1992 Yeast SNF/SWI transcriptional
activators and the SPT/SIN chromatin connection. Trends
Genet. 8: 387–391.
Winston, F., K. J. Durbin and G. R. Fink, 1984 The SPT3 gene is
required for normal transcription of Ty elements in S. cerevisiae.
Cell 39: 675–682.
Wittmeyer, J., and T. Formosa, 1995 Identifying DNA replication
complex components using protein affinity chromatography.
Methods Enzymol. 262: 415–430.
Wittmeyer, J., and T. Formosa, 1997 The Saccharomyces cerevisiae
DNA polymerase ␣ catalytic subunit interacts with Cdc68/Spt16
and with Pob3, a protein similar to an HMG1-like protein. Mol.
Cell. Biol. 17: 4178–4190.
Wittmeyer, J., L. Joss and T. Formosa, 1999 Spt16 and Pob3 of
Saccharomyces cerevisiae form an essential, abundant heterodimer
1606
M. B. Schlesinger and T. Formosa
that is nuclear, chromatin-associated, and copurifies with DNA
polymerase ␣. Biochemistry 38: 8961–8971.
Xu, Q., G. C. Johnston and R. A. Singer, 1993 The Saccharomyces
cerevisiae Cdc68 transcription activator is antagonized by San1, a
protein implicated in transcriptional silencing. Mol. Cell. Biol.
13: 7553–7565.
Xu, Q., R. A. Singer and G. C. Johnston, 1995 Sug1 modulates yeast
transcription activation by Cdc68. Mol. Cell. Biol. 15: 6025–6035.
Zhang, Z., A. Clawson, C. Realini, C. C. Jensen, J. R. Knowlton
et al., 1998 Identification of an activation region in the protea-
some activator REGalpha [see comments]. Proc. Natl. Acad. Sci.
USA 95: 2807–2811.
Zhao, X., E. G. Muller and R. Rothstein, 1998 A suppressor of
two essential checkpoint genes identifies a novel protein that
negatively affects dNTP pools. Mol. Cell 2: 329–340.
Zhou, Y. H., X. P. Zhang and R. H. Ebright, 1991 Random mutagenesis of gene-sized DNA molecules by use of PCR with Taq
DNA polymerase. Nucleic Acids Res. 19: 6052.
Communicating editor: F. Winston