* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download 24 October - web.biosci.utexas.edu
DNA barcoding wikipedia , lookup
Comparative genomic hybridization wikipedia , lookup
Polyadenylation wikipedia , lookup
DNA sequencing wikipedia , lookup
Agarose gel electrophoresis wikipedia , lookup
Maurice Wilkins wikipedia , lookup
Non-coding RNA wikipedia , lookup
Molecular evolution wikipedia , lookup
Gel electrophoresis of nucleic acids wikipedia , lookup
Transcription factor wikipedia , lookup
Real-time polymerase chain reaction wikipedia , lookup
Gene expression wikipedia , lookup
Biosynthesis wikipedia , lookup
Molecular cloning wikipedia , lookup
Community fingerprinting wikipedia , lookup
Point mutation wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
DNA supercoil wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Silencer (genetics) wikipedia , lookup
Non-coding DNA wikipedia , lookup
Promoter (genetics) wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
RNA polymerase II holoenzyme wikipedia , lookup
Eukaryotic transcription wikipedia , lookup
Name: ________________________ (Last, First) Discussion Unique No. _______ Discussion Questions # 8 (Oct 24th, 2006) Please write a brief summery for the animations of Helicase and Replication posted on the course website. PRINT it out and turn it in either on your discussion sections or on next Monday's class no later than 12:00PM. Email attachments and late delivery are not acceptable. 1. What factors ensure the fidelity of replication during DNA synthesis? 2. Define “promoter” and discuss the common features of bacterial promoters. 3. Describe functions of different subunits of bacterial RNA polymerase and specify their relative locations on DNA to initiation transcription. 4. How does rifampicin affect transcription? 5. Given below is a double-stranded DNA fragments: 5’ ATCGAGTCTTGACATGGCTACAGTTGTATAATACGTAGCTAGGGGGGG 3’ 3’ TAGCTCAGAACTGTACCGATGTCAACATATTATGCATCGATCCCCCCC 5’ a) Mark -35 region, -10 region and +1 site on this sequence. Describe the function of these regions. b) Which DNA strand (top or bottom) do you use as templates to get transcripts? c) Transcribe the DNA template and list the first six nucleotides. 6. Define terminator and compare (rho)-independent and (rho)-dependent termination in transcription process. 7. What is the difference between primase (function in DNA replication) and RNA polymerase (function in transcription)? 8. What is Shine-Dalgarno sequence? What does it do?