Download A Plastid in the Making: Evidence for a Second

ARTICLE IN PRESS
Protist, Vol. 156, 425—432, October 2005
http://www.elsevier.de/protis
Published online date 12 October 2005
ORIGINAL PAPER
A Plastid in the Making: Evidence for a Second
Primary Endosymbiosis
Birger Marin1, Eva C. M. Nowack, and Michael Melkonian
Botanisches Institut, Lehrstuhl I, Universität zu Köln, Gyrhofstr. 15, 50931 Köln, Germany
Submitted August 18, 2005; Accepted September 14, 2005
Monitoring Editor: Keith Gull
One of the major steps in the evolution of life was the origin of photosynthesis in nucleated cells
underpinning the evolution of plants. It is well accepted that this evolutionary process was initiated
when a photosynthetic bacterium (a cyanobacterium) was taken up by a colorless host cell, probably
more than a billion years ago, and transformed into a photosynthetic organelle (a plastid) during a
process known as primary endosymbiosis. Here, we use sequence comparisons and phylogenetic
analyses of the prokaryotic rDNA operon to show that the thecate, filose amoeba Paulinella
chromatophora Lauterborn obtained its photosynthetic organelles by a similar but more recent
process, which involved a different cyanobacterium, indicating that the evolution of photosynthetic
organelles from cyanobacteria was not a unique event, as is commonly believed, but may be an
ongoing process.
& 2005 Elsevier GmbH. All rights reserved.
Key words: cyanobacteria; molecular synapomorphies; Paulinella chromatophora; plastid phylogeny; primary
endosymbiosis; rDNA operon.
Introduction
The thecate, filose amoeba Paulinella chromatophora was discovered by Robert Lauterborn in
1895 in wetlands of the upper Rhine valley and
apparently has a global distribution in sediments
of ponds and lakes (Melkonian and Mollenhauer
2005). Its most distinctive feature are (one or two)
sausage-shaped blue-green inclusions (Fig. 1 a)
that support the photoautrophic existence of the
amoeba (unlike its marine relatives, this Paulinella
species is not known to feed on bacteria; Hannah
et al. 1996; Johnson et al. 1988; Vørs 1993). The
nature of the photosynthetic inclusions of P.
1
Corresponding author;
fax 49 221 470 5181
e-mail [email protected] (B. Marin)
& 2005 Elsevier GmbH. All rights reserved.
doi:10.1016/j.protis.2005.09.001
chromatophora has been debated for 100 years
(Geitler 1927; Keeling 2004a; Lauterborn 1895;
Lederberg 1952; Pascher 1929); were they just
food particles, intracellular cyanobacterial symbionts, or genuine photosynthetic organelles?
Whereas the first alternative can now be refuted
(a clonal, photoautotrophic culture of P. chromatophora has been growing in the authors’ laboratory for more than 10 years), the last two
alternatives still need to be addressed. For
convenience sake, we will refer to these inclusions
as photosynthetic organelles.
Convincing evidence has been obtained that
plastids shared a monophyletic origin among
cyanobacteria (e.g. Helmchen et al. 1995; Keeling
2004a; Rodrı́guez-Ezpeleta et al. 2005), often
ARTICLE IN PRESS
426
B. Marin et al.
ARTICLE IN PRESS
A Plastid in the Making
equated with a single primary endosymbiotic
event. One type of plastid (the cyanelles of the
Glaucoplantae) retains remnants of the peptidoglycan cell wall of its prokaryote ancestor making
cyanelles the only osmotically stable plastids.
Interestingly, the photosynthetic organelles of P.
chromatophora also contain a residual peptidoglycan cell wall (sandwiched between two envelope membranes; Kies 1974) raising the possibility
that both organelles had a monophyletic origin.
The two hosts (the Glaucoplantae and P. chromatophora), however, are not monophyletic and
belong to two different eukaryote ‘supergroups’
(Plantae and Rhizaria; Bhattacharya et al. 1995;
Cavalier-Smith 2002; Keeling 2004a).
To clarify the phylogenetic position of the
photosynthetic organelles of P. chromatophora,
we determined almost complete sequences of the
prokaryotic rDNA operon of P. chromatophora,
and the plastids of two glaucophytes and two
structurally simple red algae, and performed
phylogenetic analyses of the rDNA operon including diverse eubacterial/cyanobacterial and plastid
sequences.
Results and Discussion
(1) The phylogenetic tree (Fig. 1 a) shows that all
plastid sequences are monophyletic (with
100%/1.00 support in all analyses; clade 4).
(2) The P. chromatophora sequence does not
belong to the plastid clade but forms a
monophyletic lineage (clade 6) with a group
of cyanobacteria (strains of Prochlorococcus
and Synechococcus). The latter clade is
unambiguously (100%/1.00) supported by all
methods of analysis, and is further character-
427
ized by two unique signatures (non-homoplasious synapomorphies; Marin et al. 2003) in the
SSU and LSU rRNA (16S rRNA and 23S rRNA)
molecule, respectively (Fig. 1 b).
(3) Paulinella chromatophora is the earliest divergence in this cyanobacterial clade and is sister
to a well-supported subclade (no. 7; Fig. 1 a)
containing Prochlorococcus and marine strains
of Synechococcus. The Prochlorococcus/Synechococcus subclade is also supported by a
non-homoplasious molecular synapomorphy in
the LSU rRNA molecule (Fig. 2).
(4) The phylogenetic resolution within the cyanobacteria is generally improved over phylogenies using SSU rDNA alone (e.g. Fewer et al.
2002; Honda et al. 1999; Turner et al. 1999;
Wilmotte and Herdman 2001) or a concatenated data set of 50 plastid-encoded proteins
(Rodrı́guez-Ezpeleta et al. 2005) although
taxon sampling is still limited. In particular, we
note that a lineage of cyanobacteria (clade no.
3; Fig. 1 a) is moderately supported that may
represent the sister group of the plastid lineage
(Fig. 1 a). This lineage contains only cyanobacteria with Form 1B RubisCo (and bcarboxysomes; Badger et al. 2002), whereas
the sister lineage of the photosynthetic organelle of P. chromatophora (subclade no. 7; Fig.
1 a) displays cyanobacteria with Form 1A
RubisCo (and a-carboxysomes).
(5) Cyanelles and rhodoplasts are moderately
supported as sister groups, while both are
sister to the chloroplasts (Fig. 1 a). The
phylogenetic relationship between the three
types of simple (primary) plastids is still unsettled (e.g. Bhattacharya et al. 2003; Keeling
2004b; McFadden 2001; Moreira and Philippe
2001; Palmer 2003; Palmer et al. 2004;
Figure 1. a. Phylogenetic evidence for an independent cyanobacterial origin of the photosynthetic organelle
of Paulinella chromatophora, significantly separated from the plastid lineage. The maximum-likelihood tree
(GTR+I+G; I ¼ 0:2661; G ¼ 0:7513) was based on almost-complete rDNA operon sequences (genes
encoding SSU rRNA, tRNA-Ile, tRNA-Ala, and LSU rRNA; 4104 aligned characters); numbers at branches
are bootstrap values [neighbor joining and maximum parsimony (460%)] and Bayesian posterior
probabilities 40.90 (branches in bold have 100/100/1.00 support). Strain designations when available (for
abbreviations, see Methods) and EMBL/GENBANK accession numbers are given. Sequences determined
new to this study are in bold. Encircled numbers (1—7) denote clades analyzed by single gene- and
partitioned analyses (see Results and Discussion, and Table 1). The inset shows a light micrograph of a cell of
Paulinella chromatophora, displaying the theca consisting of silica scales, and a single photosynthetic
organelle undergoing division. b. Unique molecular signatures (non-homoplasious synapomorphies
according to Marin et al. 2003) in highly conserved regions of the SSU and LSU rRNA molecules.
Synapomorphies characteristic for the clade (no. 6 in Fig. 1 a) comprising P. chromatophora, Synechococcus
and Prochlorococcus were found in the 30 -terminus of the SSU rRNA (second to last nt), and in the GTPaseassociated center of the LSU rRNA (Helix 1082; Cannone et al. 2002). Secondary structure drawings based
on the Paulinella sequence.
ARTICLE IN PRESS
428
B. Marin et al.
Figure 2. Evidence for the monophyly of Synechococcus and Prochlorococcus (clade no. 7 in Fig. 1 a) to the
exclusion of the photosynthetic organelle of Paulinella chromatophora: free-living taxa share compensatory
base changes (synapomorphies) in successive positions in the LSU rRNA (Helix 837), whereas the P.
chromatophora organelle retained the conserved (plesiomorphic) character states. One of the two
synapomorphies shown is unique (pair 868—909; numbers indicate homologous positions in Escherichia
coli). Secondary structure drawing based on Synechococcus WH 8102 sequence; interactions (base pairing)
in gray color according to Cannone et al. (2002) but absent from models in De Rijk et al. (2000).
Rodrı́guez-Ezpeleta et al. 2005). Whereas phylogenetic analyses of protein-coding genes or
SSU rDNA alone often led to the conclusion that
the cyanelles are the earliest diverging plastids,
other topologies have also been recovered; e.g.
Palmer et al. (2004) cited unpublished observations of Turner et al. suggesting a strong
support for a cyanelle/rhodoplast sister group
in LSU rDNA phylogenies (although Cyanophora
paradoxa was the only glaucoplant used in
these analyses). Here, we report similar results
(Fig. 1 a), but note that by adding more cyanelle
rDNA sequences (in total three), the support
values for a cyanelle/rhodoplast clade were
somewhat lower compared to trees containing
fewer cyanelle and rhodoplast sequences (unpublished observations).
In addition to analyses of the concatenated data
set, both rRNA genes (SSU rDNA and LSU rDNA)
were analyzed separately, and a partitioned
Bayesian analysis (see Methods) was performed
to ensure that data partitions produced similar
tree topologies (Table 1). Except for the branching
pattern of cyanelles, rhodoplasts and chloroplasts
(clade no. 5 in Fig. 1 a and Table 1), single gene
and partitioned analyses were congruent, especially concerning the position of P. chromatophora
(clades nos. 6 and 7 Table 1). Support for tree
topologies produced by LSU rDNA alone were
comparable to those of the concatenated analysis
(Fig. 1 a), whereas in SSU rDNA analyses distinctly
lower support values were obtained for most
clades (Table 1).
To exclude the possibility that a cyanobacterial
contaminant had been sequenced (the culture of
P. chromatophora is not axenic), we (1) carefully
studied chlorophyll autofluorescence in the culture
by confocal laser scanning microscopy, and (2)
sequenced rDNA from isolated and washed single
photosynthetic organelles. The first approach
ARTICLE IN PRESS
A Plastid in the Making
429
Table 1. Confidence measures for seven clades (encircled numbers in Fig. 1 a), inferred by single-gene
analyses of SSU rDNA and LSU rDNA (support values as in Fig. 1 a), and posterior probabilities resulting from
a Bayesian analysis of the complete alignment with three data partitions corresponding to SSU rDNA (1438
positions), both tRNA genes (148 positions), and LSU rDNA (2518 positions), using a mixed model (GTR+I+G)
with independent parameter estimates for each partition.
Clade
SSU rDNA (1438
positions)
LSU rDNA (2518
positions)
rDNA-operon (4104 positions); partitioned
Bayesian analysis
1
2
3
4
5
6
7
71/78/1.00
/68/0.99
76/58/0.97
96/87/1.00
*/*/*
100/100/0.98
81//0.92
99/98/1.00
94/77/1.00
96/55/0.99
100/100/1.00
90/93/1.00
100/100/1.00
100/98/1.00
1.00
1.00
1.00
1.00
1.00
1.00
1.00
*These analyses favored chloroplasts and rhodoplasts as sister clades with low significance (61/53/0.92).
revealed no contaminants, and the second yielded
rDNA sequences that were identical to those
obtained before (results not shown). It had been
previously shown by DAPI staining that the
photosynthetic organelles of P. chromatophora
contained nucleoids that resembled most closely
those of a unicellular cyanobacterium (Lukavský
and Cepák 1992).
Using SSU rDNA alone and a larger taxon
sampling (including freshwater strains of Synechococcus), we still recovered the photosynthetic
organelle of P. chromatophora as a separate
branch (results not shown). A close cyanobacterial
relative of the photosynthetic organelle of P.
chromatophora has thus not yet been identified
(attempts to grow the photosynthetic organelle
outside its host have consistently failed, and cell
and organelle division are precisely coordinated;
Hoogenraad 1927, and own observations). The
acquisition of the photosynthetic organelle of P.
chromatophora was likely a more recent event
than the origin of plastids, since the Paulinella
rDNA sequences are significantly more closely
related to those of their cyanobacterial sister
group than is the amount of sequence divergence
even within plastids. To what extent the photosynthetic organelle of P. chromatophora is genetically reduced (its genome size is not yet known)
will be of considerable interest and awaits further
analysis.
Methods
Culture origins and molecular methods: DNA
from Paulinella chromatophora Lauterborn (strain
M 0880; the strain is available from the authors
upon request), two glaucoplants (Glaucocystis
nostochinearum and Cyanoptyche gloeocystis),
and two rhodophytes (Porphyridium aerugineum
and Compsopogon coeruleus) was extracted by
using a CTAB protocol, or the DNeasy Plant Mini
Kit (QIAGEN). The source of P. chromatophora has
been described earlier (Bhattacharya et al. 1995);
for origin of other cultures, see Figure 1. Culture
collections: ATCC (http://www.atcc.org), CCMP
(http://ccmp.bigelow.org/), M (Culture Collection
Melkonian, University of Cologne, Germany), MIT
(Massachusetts Institute of Technology), NCTC
(http://www.ukncc.co.uk), NIES (http://www.nies.
go.jp/biology/mcc/home.htm), PCC (http://www.
pasteur.fr/recherche/banques/PCC/), SAG (http://
www.gwdg.de/epsag/phykologia/epsag.html),
WH (Woods Hole Culture Collection), UTEX (http://
www.bio.utexas.edu/research/utex/).
The plastid/organelle-encoded ribosomal DNA
operon was amplified by polymerase chain reaction (PCR), using an initial step of 3 min at 95 1C,
followed by 30 cycles of 95 1C (1 min), 55 or 60 1C
(2 min) and 72 1C (3 min), and a final step of 5 min
at 72 1C. To avoid unintended amplification of a
bacterial rDNA operon (all cultures contained
bacteria), the 23S rRNA gene was screened for
molecular synapomorphies that uniquely characterized the Cyanobacteria lineage (including plastids) to the exclusion of the domain Bacteria
(for search strategy, see below). Two of the
synapomorphies found (one located in the spacer
between domains C and D, the other in Helix
B19; nomenclature after De Rijk et al. 2000)
have been used to design cyanobacterial/plastid-specific primers ptLSU C-D-rev (50 -GCCGGCTCATTCTTCAAC-30 ) and ptLSU B19-forw (50 -CACGTGRAATYCCGTGTGAATCWGC-30 ) with specific
ARTICLE IN PRESS
430
B. Marin et al.
positions at the 30 ends. For PCR reactions, these
specific primers were combined with universal
SSU rRNA (SSU-4-forw, 50 -GATCCTKGCTCAGGATKAACGCTGGC-30 ) and LSU rDNA primers
(LSU G20-rev, CACCGGATATGGACCRAACTGTC;
and LSU H1-4-rev, 50 -ACTYATCTTRRGGTRGGCTTC-30 ) to obtain overlapping PCR products that
together covered the almost complete rDNA
operon (length: 4290—4934 nt). Purified PCR products were sequenced directly (see Marin et al.
1998) with 15 sequencing primers (not shown) using
a bidirectional LI-COR sequencer (LONG READ IR
4200). The five new rDNA sequences are available
under accession numbers AM084273—AM084277.
As a control, partial rDNA sequences from
single photosynthetic organelles of Paulinella
chromatophora were obtained as follows: several
cells were placed between two coverslips, and
carefully subjected to mechanical force to destroy
the scaly covering and release intact photosynthetic organelles. Under the light microscope,
single photosynthetic organelles were isolated
with a micropipette, washed several times with
sterile culture medium, and transferred into a
PCR-tube with distilled water, immediately followed by a freezing step (liquid nitrogen) and a
short incubation at 95 1C (3 min). At 4 1C, PCRcomponents and primers SSU-4-forw and ptLSU
C-D-rev were added for a primary PCR with 60 1C
as annealing temperature. Since no visible PCR
products were obtained, 0.5—2 ml of the primary
PCR were added to a second PCR with SSU-4forw and the reverse primer SG2 (50 -CACGGATCCAAGGAGGTGATCCANCCNCACC-30 ). Secondary PCR-products were used to determine partial
SSU rDNA sequences of single photosynthetic
organelles.
Alignments and phylogenetic analyses: The
new rDNA sequences were combined with database sequences to construct an alignment that
contained the genes encoding SSU rRNA, tRNAIle, tRNA-Ala, and LSU rRNA. Most sequences
came from completed or ongoing (‘shotgun’)
genome projects, whereas in some cases, separate entries for SSU and LSU rRNA genes from the
same strain were combined (for EMBL/GENBANK
accession numbers, see Fig. 1 a). The conserved
rRNA and tRNA secondary structure (available at
http://www.rna.icmb.utexas.edu/, and http://www.
psb.rug.ac.be/rRNA/index.html) determined the
architecture of the alignment.
A total of 4104 unambiguously aligned positions
were used to infer molecular phylogenetic trees
with maximum likelihood, distance (neighbor joining), maximum parsimony, and Bayesian methods
(PAUP 4.0b10; MrBayes_3.1.1; Ronquist and
Huelsenbeck 2003; Swofford 2002). Except for
maximum parsimony, analyses were performed
under a GTR+I+G model (model and model
parameters selected by AIC in MODELTEST;
Posada and Crandall 1998). The maximum likelihood tree was calculated by two heuristic
searches, with starting trees obtained by either
neighbor joining or by stepwise taxon addition
(both searches resulted in the same topology). The
robustness of branches was tested by bootstrapping (distance and maximum parsimony), using
1000 replications (5 sequence addition replicates
per bootstrap replicate in maximum parsimony).
For the Bayesian analysis, two separate MCMC
chains were performed with 300 000 generations;
trees were sampled every 100 generations.
Already after 28 000 generations, the standard
deviation between the two MCMC chains was
below 0.10, indicating convergence. Trees from
generations 1 to 28 000 were discarded as
‘burnin’, whereas the remaining trees (plotting
log-likelihoods against generations using the
command ‘sump’ confirmed that the analysis
reached a stationary phase) were used for
calculating two 90% majority rule consensus trees
(trees of the two MCMC chains were identical) to
obtain posterior probabilities of branches.
To compare the phylogenetic signal of single
genes, (1) separate analyses (distance and maximum parsimony bootstrap; Bayesian posterior
probabilities) of the SSU rRNA- and LSU rRNA
genes were performed as described before, and
(2) the Bayesian analysis of the complete
alignment was repeated after defining three
data partitions corresponding to SSU rDNA
(positions 1—1438), both tRNA genes (positions
1439—1586), and LSU rDNA (positions 1587
—4104), using a mixed GTR+I+G model that
allowed independent model parameter estimations for each partition.
Search for unique synapomorphies: The general procedure to find uniquely derived positions
for a clade (branch) of interest has been briefly
described earlier (Marin et al. 2003). First, sequence data and the treefile reflecting the maximum likelihood topology were imported into
PAUP. After defining the outgroup (Bacteria) and
selecting maximum parsimony as optimality
criterion (Parsimony settings; character state
optimization: DELTRAN), the logfile option
was activated (File –4 ‘Log Output to Disk’).
Sequence data were then used to obtain a labeled
tree reconstruction and a complete list of synapomorphies (Trees –4 ‘Describe Trees’ with
ARTICLE IN PRESS
A Plastid in the Making
‘phylogram’, ‘labeled internal nodes’, and ‘list of
synapomorphies’). The resulting logfile revealed all
synapomorphies of the data set, especially those
of two nested clades (nos. 6, 7 in Fig. 1 a): the
Synechococcus/Prochlorococcus clade including,
as well as excluding Paulinella. Over 99% of these
changes were homoplasious (usually indicated by
a low consistency indexo0.3), i.e. showed parallel
(convergent) changes. Synapomorphies with a
higher consistency index (0.3—1.00) were
mapped on the tree topology to visualize all
character changes via PAUP (Trees –4 ‘Show
Reconstructions’). Only five synapomorphies had
a consistency index of 1.00, and proved to be
unique within the taxa analyzed (i.e. they were
non-homoplasious synapomorphies [NHS] sensu
Marin et al. 2003; Figs 1b, 2). For these synapomorphies, the position in the conserved rRNA
secondary structure was identified (via alignment):
one was located at the end of the SSU rRNA
molecule ðU ¼¼ 4 AÞ, whereas the remaining
positions formed base pairs in the LSU rRNA
(Helix 837, Helix 1082; Cannone et al. 2002), i.e.
these synapomorphies represented unique compensatory base changes (see Figs 1b, 2).
Finally, BLAST searches were performed to test
the uniqueness of synapomorphies among homologous organellar/prokaryotic sequences in the
databases (http://www.ncbi.nlm.nih.gov/BLAST/).
BLAST searches using the sequences GGATGGATCACCTCCTA, TAGAAGCAGCCATCCTCAAAG,
CATTTCGGTGCGGGCTGCGA, and TGAACTCNGAATACCCTGT (for various synapomorphies, see
Figs 1 b, 2) revealed mismatches in the synapomorphic positions for all database sequences
except for rRNA genes of Synechococcus and
Prochlorococcus.
References
Badger MR, Hanson DT, Price GD (2002) Evolution
and diversity of CO2 concentrating mechanisms in
cyanobacteria. Funct Plant Biol 29: 407—416
Bhattacharya D, Helmchen T, Melkonian M (1995)
Molecular evolutionary analyses of nuclear-encoded
small subunit ribosomal RNA identify an independent rhizopod lineage containing the Euglyphina and
the Chlorarachniophyta. J Eukaryot Microbiol 42:
65—69
Bhattacharya D, Yoon HS, Hackett JD (2003)
Photosynthetic eukaryotes unite: endosymbiosis
connects the dots. BioEssays 26: 50—60
431
Cannone JJ, Subramanian S, Schnare MN, Collett
JR, D’Souza LM, Du Y, Feng B, Lin N, Madabusi
LV, Müller KM, Pande N, Shang Z, Yu N, Gutell RR
(2002) The comparative RNA web (CRW) site: an
online database of comparative sequence and
structure information for ribosomal, intron, and other
RNAs. BMC Bioinformatics 3: 2
Cavalier-Smith T (2002) The phagotrophic origin of
eukaryotes and phylogenetic classification of protozoa. Int J Syst Evol Microbiol 52: 297—354
De Rijk P, Wuyts J, Van de Peer Y, Winkelmans T,
De Wachter R (2000) The european large subunit
ribosomal RNA database. Nucleic Acids Res 28:
177—178
Fewer D, Friedl T, Büdel B (2002) Chroococcidiopsis and heterocyst-differentiating cyanobacteria are
each other’s closest living relatives. Mol Phylogen
Evol 23: 82—90
Geitler L (1927) Bemerkungen zu Paulinella chromatophora. Zool Anz 72: 333—334
Hannah F, Rogerson A, Anderson OR (1996) A
description of Paulinella indentata n. sp. (Filosea:
Euglyphina) from subtidal coastal benthic sediments.
J Eukaryot Microbiol 43: 1—4
Helmchen TA, Bhattacharya D, Melkonian M
(1995) Analyses of ribosomal RNA sequences from
glaucocystophyte cyanelles provide new insights
into the evolutionary relationships of plastids. J Mol
Evol 41: 203—210
Honda D, Yokota A, Sugiyama J (1999) Detection
of seven major evolutionary lineages in cyanobacteria based on the 16S rRNA gene sequence analysis with new sequences of five
marine Synechococcus strains. J Mol Evol 48:
723—739
Hoogenraad HR (1927) Zur Kenntnis der Fortpflanzung von Paulinella chromatophora Lauterb. Zool
Anz 72: 140—150
Johnson PW, Hargraves PE, Sieburth JMcN (1988)
Ultrastructure and ecology of Calycomonas ovalis
Wulff, 1919, (Chrysophyceae) and its redescription
as a testate rhizopod Paulinella ovalis n. comb.
(Filosea: Euglyphina). J Protozool 35: 618—626
Keeling PJ (2004a) Diversity and evolutionary
history of plastids and their hosts. Am J Bot 91:
1481—1493
Keeling PJ (2004b) A brief history of plastids and
their hosts. Protist 155: 3—7
Kies L (1974) Elektronenmikroskopische Untersuchungen an Paulinella chromatophora Lauterborn,
ARTICLE IN PRESS
432
B. Marin et al.
einer Thekamöbe mit blaugrünen Endosymbionten
(Cyanellen). Protoplasma 80: 69—89
Lauterborn R (1895) Protozoenstudien II. Paulinella
chromatophora nov. gen., nov. spec., ein beschalter
Rhizopode des SüXwassers mit blaugrünen chromatophorenartigen Einschlüssen. Z Wiss Zool 59:
537—544
Lederberg J (1952) Cell genetics and hereditary
symbiosis. J Physiol 32: 403—430
Lukavský J, Cepák V (1992) DAPI fluorescent
staining of DNA material in cyanelles of the rhizopod
Paulinella chromatophora Lauterb. Arch Protistenkd
142: 207—212
Marin B, Klingberg M, Melkonian M (1998)
Phylogenetic relationships among the Cryptophyta:
analyses of nuclear-encoded SSU rRNA sequences
support the monophyly of extant plastid-containing
lineages. Protist 149: 265—276
Marin B, Palm A, Klingberg M, Melkonian M (2003)
Phylogeny and taxonomic revision of plastid-containing euglenophytes based on SSU rDNA sequence comparisons and synapomorphic signatures
in the SSU rRNA secondary structure. Protist 154:
99—145
McFadden GI (2001) Primary and secondary endosymbiosis and the origin of plastids. J Phycol 37:
951—959
Melkonian M, Mollenhauer D (2005) Robert Lauterborn (1869—1952) and his Paulinella chromatophora. Protist 156: 253—262
Moreira D, Philippe H (2001) Sure facts and
open questions about the origin and evolution
of photosynthetic plastids. Res Microbiol 152:
771—780
Palmer JD (2003) The symbiotic birth and spread of
plastids: how many times and whodunit? J Phycol
39: 4—11
Palmer JD, Soltis DE, Chase MW (2004) The plant
tree of life: an overview and some points of view. Am
J Bot 91: 1437—1445
Pascher A (1929) Über die Natur der blaugrünen
Chromatophoren des Rhizopoden Paulinella chromatophora. Zool Anz 81: 189—194
Posada D, Crandall KA (1998) Modeltest: testing
the model of DNA substitution. Bioinformatics 14:
817—818
Rodrı́guez-Ezpeleta N, Brinkmann H, Burey SC,
Roure B, Burger G, Löffelhardt W, Bohnert HJ,
Philippe H, Lang BF (2005) Monophyly of primary
photosynthetic eukaryotes: green plants, red algae,
and glaucophytes. Curr Biol 15: 1325—1330
Ronquist F, Huelsenbeck JP (2003) MrBayes 3:
Bayesian phylogenetic inference under mixed models. Bioinformatics 19: 1572—1574
Swofford DL (2002) PAUP* Phylogenetic Analysis
using Parsimony (* and other Methods). Version 4.
Sinauer Associates, Sunderland, Massachusetts
Turner S, Pryer KM, Miao VP, Palmer JD (1999)
Investigating deep phylogenetic relationships
among cyanobacteria and plastids by small subunit
rRNA sequence analysis. J Eukaryot Microbiol 46:
327—338
Vørs N (1993) Marine heterotrophic amoebae,
flagellates and Heliozoa from Belize (Central America) and Tenerife (Canary Islands), with descriptions
of new species, Luffisphaera bulbochaete n. sp., L.
longihastis n. sp., L. turriformis n. sp. and Paulinella
intermedia n. sp. J Eukaryot Microbiol 40: 272—287
Wilmotte A, Herdman M (2001) Phylogenetic
Relationships Among the Cyanobacteria Based
on 16S rRNA Sequences. In Boone DR, Castenholz
RW (eds) Bergey’s Manual of Systematic Bacteriology, 2nd Ed., Vol. 1. Springer, New York,
pp 487—493