Download DNA Template for Protein Transcription Directions: 1) Use the DNA

DNA Template for Protein Transcription
Directions: 1) Use the DNA template (above) to find the corresponding piece of mRNA. (Remember you
have to identify the starting point in the strand first. The start CODON is?)
2) Once you have identified the starting point, transcribe the mRNA for that gene segment.
3) Use the mRNA sequence to perform the Translation that would occur at the ribosome
with the help of the tRNA molecules.
4) Once you know the Amino Acid sequence, from using the mRNA and the codon chart,
build the protein using the material of your choice (make sure it is school appropriate). Do not forget to represent the peptide bonds between the
amino acids
5) Use the chart below to construct your protein “key.” Your protein will have Twenty Amino Acids in it.
Grade Distribution
/ 15
Correct mRNA strand identified
/ 15
Correct Amino Acids identified and used
/ 10
Amino Acid Chart Key filled out and represented in project AND turned in with project
/ 10
Peptide bonds represented
/ 10
All 21 Amino Acids are represented
/ 10
Neatness
/5
Creativity
_______________________________
/ 75
Total
DNA :
TGCTACTTGGTTTCATTCCAGTAGCCACCCGCGCGGATGTGGTCAAAAGTAGGCTAAACAGTTATCTTTCGATATC
mRNA:
Protein:
Amino Acid Master Chart
Alanine (Ala) –
Arginine (Arg) –
Asparagine (Asn) –
Aspartic Acid (Asp) –
Cysteine (Cys) –
Glutamine (Gln) –
Glutamic Acid (Glu) –
Glycine (Gly) –
Histidine (His) –
Isoleucine (Ile) –
Leucine (Leu) –
Lysine (Lys) –
Methionine (Met) –
Phenylalanine (Phe) –
Proline (Pro) –
Serine (Ser) –
Threonine (Thr) –
Tryptophan (Trp) –
Tyrosine (Tyr) –
Valine (Val) –
DNA Template Key ( Amino Acid)
1. AUG – Meth – Green Square
2. AAC – Asn – White Triangle
3. CAA – Gln – Red Triangle
4. AGU – Ser – Yellow Square
5. AAG – Lys – Green Circle
6. GUC – Val – Pink Triangle
7. AUG – Meth – Green Square
8. GGU – Gly – Blue Square
9. GGG – Gly – Blue Square
10. CGC – Arg – White Square
11. GCC – Ala – White Circle
12. UAC – Tyr – Pink Square
13. ACC – Thr –Yellow Triangle
14. AGU – Ser – Yellow Square
15. UUU – Phe – Green Triangle
16. CAU – His – Black Circle
17. CCG – Pro – Yellow Circle
18. AUU – Ile – Black Square
19. UGU – Cys – Red Square
20. CAA – Gln – Red Triangle
21. UAG - Stop