Download Supporting Figures legends

Supporting Figures legends:
Supporting Figure 1: The overview of genomic aberrations in 23 human cancer cell lines
displayed by inferred copy number (ICN). The ICNs of SNPs were displayed in log2 ratio scale
relative to the normal copy of 2 log2 (tumor ICN/2). The color intensity is scaled from dark blue
(homozygous deletion) to white (neutral) and then to dark red (amplification). The ICN data was
annotated along physical position of chromosomes. The known amplicons and HDs were labeled by
arrowheads.
Supporting Figure 2: Common amplicon at 7p11.2 and HD at 9p21.3 in multiple human
cancer cells (A and B) and tissues (C and D) revealed by various SNP density arrays. (A). The
376 Kb overlapped amplicon of 3 cell lines (Hep3B, Tong and HK1) at 7p11.2 embraces one known
oncogenic EGFR gene. (B). The 45 Kb overlapped HD on 9p21.3 in 6 cell lines (H1437, SNU449,
SNU387, Sk-Hep-1, A549 and CL3) narrows down to two important known tumor suppressor
genes, MTAP and CDKN2A. (C). GSM449585 and GSM449628 are derived from lung squamous
cell carcinoma tissues. (D). GSM402763 and GSM402759 are derived from non-small cell lung
cancer tissues. GSM374566 is derived from metastatic prostate cancer tissues.
Supporting Figure 3: interphase FISH analysis for the amplification of FNDC3B labeled in red
and SLC29A2 in green in Hep3B cells.
Supporting Figure 4: Western blot analysis of knock down efficacy using shRNA against
FNDC3B and SLC29A2 in PLC/PRF/5 and Huh7, respectively. The experiments were
performed twice.
Supporting Figure 5: Altered effects and downstream signaling of overexpressed FNDC3B and
SLC29A2 in non-amplified Huh6 cell. Over-expressed FNDC3B and SLC29A2 in Huh6 cells
resulted in augmentation of cell proliferation as indicated in growth curve (A), Ki-67 up-regulation
(B) and increase of phosphorylation of Tyr705 of STAT3 protein using Western blot analysis (C).
(D). The increase of phosphorylation of Tyr705 of STAT3 was observed in amplified Hep3B cell in
compared to non-amplified Huh6 cell. The experiments were performed twice.
Supporting Figure 6: The distribution of SNP raw copy number versus the number of healthy
individuals in reference pool for CNA analysis. We selected 3 normal human chromosomes in
A549 cells to examine the influence of SNP raw copy number distribution by adding up number of
healthy individuals into CNA analysis reference pool. Starting from 10 to 50 healthy individuals in
the analysis reference pool, the number of SNPs with 2 copies of raw copy numbers reached
maximum and steady state.
Supporting Figure 7: Western blot analysis of FNDC3B isoforms expression in nuclear and
cytoplasmic compartments of Hep3B and HepG2 cells. C and N stand for protein extract
prepared from cytoplasmic and nuclear fractions, respectively. PARP and tubulin represent for
nuclear and cytoplasmic markers, respectively. The experiments were performed twice.
Supporting Table 1: all identified amplicons and HDs in 23 human cancer cell lines
Supporting Table 2: identification of several known HDs and amplicons in 23 human cancer
cell lines.
Supporting Table 3: association of up-regulated SLC29A2 and FNDC3B in related to various
clinicopathological factors of HCC.
Supporting Material and Methods:
Antibodies
Antibodies for Western blot analysis against FLAG were purchased from Sigma (SigmaAldrich, St. Louis, USA); Poly ADP-ribose polymerase (PARP); Ki-67, and STAT3 were ordered
from Santa cruz biotechnology; phospho-STAT3 (Tyr705) and phospho-Akt (Ser473) were
purchased from Cell Signaling.; and Tubulin was ordered from GeneTex.
Fluorescence in situ hybridization (FISH)
FISH was performed with Texas Red labeled BAC clone RP11-99M11(3q26.31,
173302345~173487547) probe for FNDC3B and FITC labeled-RP11-62G15 (11q13.2,
66223878~66383479) BAC clone probe for SLC29A2.
Preparation of cytoplasmic and nuclear extracts
Cells were trypsinized and washed with cold phosphate-buffered saline (PBS) twice. Cell pellets
were collected by centrifugation and lyzed in buffer A [10 mM HEPES (pH 7.9), 1.5 mM MgCl2, 10
mM KCl , 0.2mM PMSF, 2.5mM DTT and protease inhibitor], and incubated on ice. Insoluble
nuclei were separated by centrifugation at 13000 rpm for 1 min at 4°C and the supernatant contained
cytoplasmic extracts. The nuclear pellet was further washed with buffer A three times and resuspended in buffer C [20 mM HEPES (pH 7.9), 1.5 mM MgCl2, 420 mM NaCl, 25% (v/v) glycerol,
0.2 mM EDTA, 0.2mM PMSF, 0.5mM DTT, and protease inhibitors] and placed on ice for 20 min.
Quantitative RT-PCR
The qRT-PCR experiments were performed with the SYBR Green PCR Core Reagents kit and
primer sets were designed by Primer Express software (Applied Biosystems, USA) for SLC29A2
(SLC29A2-2261F
GAAGGAGTCAGGCAAGGATTG
GCTCTACCACGGACCAGTCACT),
ACCAGTCACTTCATATGTCTTGAA
FNDC3B
and
T
and
(FNDC3B
FNDC3B-4183R
SLC29A2-2346R
-4035F
GGCAGTCTTA
TCTGAGTGAACATATCTT) and β-ACTIN (β-ACTIN-1030F CCTGGCACCCAGC ACAAT
andβ-ACTIN-1221F GCAACTAAGTCATAGTCCGCCTAGA). The up regulation was defined as
when the expression of a gene in tumor is more than two fold compared to that of matching adjacent
normal tissue.
Supporting References:
1.Druck, T., Hadaczek, P., Fu, T.B., Ohta, M., Siprashvili, Z., Baffa, R., Negrini, M., Kastury, K.,
Veronese, M.L., Rosen, D., et al. (1997). Structure and expression of the human FHIT gene in
normal and tumor cells. Cancer Res 57, 504-512.
2.Pei, J., Kruger, W.D., and Testa, J.R. (2006). High-resolution analysis of 9p loss in human cancer
cells using single nucleotide polymorphism-based mapping arrays. Cancer Genet Cytogenet 170, 6568.
3.Virmani, A.K., Fong, K.M., Kodagoda, D., McIntire, D., Hung, J., Tonk, V., Minna, J.D., and
Gazdar, A.F. (1998). Allelotyping demonstrates common and distinct patterns of chromosomal loss
in human lung cancer types. Genes Chromosomes Cancer 21, 308-319.
4.Zhao, X., Weir, B.A., LaFramboise, T., Lin, M., Beroukhim, R., Garraway, L., Beheshti, J., Lee,
J.C., Naoki, K., Richards, W.G., et al. (2005). Homozygous deletions and chromosome
amplifications in human lung carcinomas revealed by single nucleotide polymorphism array
analysis. Cancer Res 65, 5561-5570.