Download Last Name - JhaveriChemBioWiki

Survey
yes no Was this document useful for you?
   Thank you for your participation!

* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project

Document related concepts

Nutriepigenomics wikipedia , lookup

Comparative genomic hybridization wikipedia , lookup

Mitochondrial DNA wikipedia , lookup

DNA paternity testing wikipedia , lookup

Transcription factor wikipedia , lookup

Holliday junction wikipedia , lookup

Genomic library wikipedia , lookup

Polyadenylation wikipedia , lookup

Cancer epigenetics wikipedia , lookup

No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup

Mutagen wikipedia , lookup

SNP genotyping wikipedia , lookup

DNA profiling wikipedia , lookup

RNA silencing wikipedia , lookup

Genetic engineering wikipedia , lookup

Point mutation wikipedia , lookup

DNA wikipedia , lookup

RNA world wikipedia , lookup

RNA-Seq wikipedia , lookup

DNA polymerase wikipedia , lookup

Nucleosome wikipedia , lookup

DNA damage theory of aging wikipedia , lookup

Epitranscriptome wikipedia , lookup

DNA vaccination wikipedia , lookup

Bisulfite sequencing wikipedia , lookup

Gene wikipedia , lookup

Artificial gene synthesis wikipedia , lookup

Gel electrophoresis of nucleic acids wikipedia , lookup

Genomics wikipedia , lookup

RNA wikipedia , lookup

United Kingdom National DNA Database wikipedia , lookup

Non-coding RNA wikipedia , lookup

Molecular cloning wikipedia , lookup

Epigenomics wikipedia , lookup

History of RNA biology wikipedia , lookup

Vectors in gene therapy wikipedia , lookup

Cell-free fetal DNA wikipedia , lookup

Genealogical DNA test wikipedia , lookup

Extrachromosomal DNA wikipedia , lookup

Nucleic acid tertiary structure wikipedia , lookup

Helitron (biology) wikipedia , lookup

Microevolution wikipedia , lookup

Replisome wikipedia , lookup

Cre-Lox recombination wikipedia , lookup

Nucleic acid double helix wikipedia , lookup

DNA supercoil wikipedia , lookup

History of genetic engineering wikipedia , lookup

Non-coding DNA wikipedia , lookup

Therapeutic gene modulation wikipedia , lookup

Primary transcript wikipedia , lookup

Nucleic acid analogue wikipedia , lookup

Deoxyribozyme wikipedia , lookup

Transcript
Last Name:
First Name:
Period #
March 2, 2010
Unit 3: Genetics
The Central Dogma and Transcription
Answer the following questions to see if you understand transcription.
Central Dogma
1. Using at least one complete sentence, state the central dogma of biology.
2. Using words and arrows, show the central dogma of biology.
3. Using the central dogma, explain why RNA is important for making protein.
DNA v. RNA
4. Complete this chart comparing and contrasting DNA and RNA.
DNA
# of strands
Nitrogenous
bases used
Type of sugar in
backbone
What does it do
with genetic
information?
Is it made of
nucleotides?
Where is it found?
Complimentary
strand to DNA of
GATTACTACGA?
Complimentary
strand to DNA of
TTTAGGGCCCAT
RNA
Transcription
5. What is the definition of transcription?
6. What part of DNA and RNA is the genetic information? What does the genetic information give
instructions for making?
7. Transcribe these DNA strands into their complimentary mRNA strands.
A. : GGGCCCGATAGGGAAAATTAGATCCT
B. ATATGGGAAACCTAGCTACTATCAAAGGTTA
Test Prep Sections: These questions were taken from New York and Texas State Tests. Can you compete with the
brightest around the nation?
90 The molecule coded directly
from DNA is represented
by number
(1) 1 (3) 3
(2)2 (4)4
22 Erwin Chargaff studied the DNA of organisms within a single species. Chargaff discovered that the
amount of adenine is about equal to the amount of thymine. Which of these explains why the ratio of
adenine to thymine is nearly 1:1?
A Adenine and thymine pair with each other.
B Adenine binds with phosphates, while
thymine binds with nitrates.
C Adenine and thymine are identical in
chemical composition.
D Adenine bases contain a form of thymine.