Download PTC bioinformatics

The restriction enzyme HaeII cuts or cleaves DNA at the GGCC sequence. If the individual has
that sequence the restriction enzyme will cleave the gene at that locality. Non tasters do not show
this sequence and so in this 221 base pair region of the DNA, the segment stays whole. If a
classmate was a taster, their DNA would be cleaved leaving a 44 and 177 base pair segment,
which would be able to be seen through gel electrophoresis. What would be seen specifically in
gel electrophoresis is a single stand for non tasters, and two split segments for those with the
ability to taste bitter (the PTC paper)
Note that the actual SNP on either allele is either a G or a C. If a C was present at postion
145 on both alleles, the genotype is predicted to be TT, If a G was present on both of the
student's alleles, they are designated a tt, for predicted nontaster. If a G was found on one
allele and a C was found on the other allele, the students indicate that they are
heterozygous, or Tt, or which is associated with a weak ability to taste PTC.
5726 TAS2R38- Taster
GCTTTGGGATAGATCTAGGCAAAGAGCTGGATGCTTTGTGAAGGAAAGGTCCTGGCT
TGGAACGTACATTTACCTTTCTGCACTGGGTGGCAACCAGGTCTTTAGATTAGCCAAC
TAGAGAAGAGAAGTAGAATAGCCAATTAGAGAAGTGACATCATGTTGACTCTAACT
CGCATCCGCACTGTGTCCTATGAAGTCAGGAGTACATTTCTGTTCATTTCAGTCCTGG
AGTTTGCAGTGGGGTTTCTGACCAATGCCTTCGTTTTCTTGGTGAATTTTTGGGATGT
AGTGAAGAGGCCGGCACTGAGCAACAGTGATTGTGTGCTGCTGTGTCTCAGCATCAG
CCGGCTTTTCCTGCATGGACTGCTGTTCCTGAGTGCTATCCAGCTTACCCACTTCCAG
AAGTTGAGTGAACCACTGAACCACAGCTACCAAGCCATCATCATGCTATGGATGATT
GCAAACCAAGCCAACCTCTGGCTTGCTGCCTGCCTCAGCCTGCTTTACTGCTCCAAGC
TCATCCGTTTCTCTCACACCTTCCTGATCTGCTTGGCAAGCTGGGTCTCCAGGAAGAT
CTCCCAGATGCTCCTGGGTATTATTC
Primer Sequence:
5'-CCTTCGTTTTCTTGGTGAATTTTTGGGATGTAGTGAAGAGGCGG-3’
5'-AGGTTGGCTTGGTTTGCAATCATC-3'
Go to the National Center for Biotechnology Information (NCBI) website,
http://www.ncbi.nlm.nih.gov/
1. Select BLAST on the top menu bar of the home page.
2. Under Basic BLAST, clicked nucleotide BLAST.
3. Past the sequence of the primers into the search window (excluding "5'- and -3'").
Switch the "Choose Search Set" dropdown menu to "Nucleotide collection (nr/nt)
Under program selection selecte the radio button labeled "Somewhat similar sequences
(blastn)."
4. Click ‘Blast
The information is split into three sections; Graphic Summary, Descriptions, and Alignments.
In the allignments section the primer sequence is aligned to the nucleotide sequence that was hit
in the search. Notice that 43 of the forward primer is missing, this is because the nucleotide did
not match the sequence. Also In the Alignments section each alignment has an E-value The Evalue is the number of alignments that would be expected by chance, the lower the E-value the
higher the probability is that the hit is a close match to the query. For example an E-value of 6e12 means that this is a strong match from the database. In the Descriptions section there are
many significant alignments that have E-values less than 0.1, they belong to humans and other
1
primates with the bitter taster receptor TAS2R38. Also notice the sequence numbers on the
bottom of the seqeunces highlited by the green arrows this is where the primers have landed on
the subject sequence.
In the alignments section click on the PTC Taster (ref|NM_176817.3|)
The top of the page contains information about the sequence, such as basepair length, database
accession number, source, and references. The middle of the report there are annotations of gene
and regulatory features. The bottom section has the entire nucleotide sequence of the DNA
sequence that contains the PCR product,
List the title of two studies linked to this nucleotide sequence
Return to the NCBI home page and clicked on "mapviewer."
In the table find Homo sapiens and click on the B icon next to the build with the highest number
Enter the primer sequences into the search window, except for the non-nucleotide letters.
Selected BLASTN from the drop-down menu then clicked "Begin Search"
1. Then clicked "View Report"
2. Next clicked "Human genome view"
3. Notice this sequence is located on chromosome seven.
Click on chromosome seven to go to the TAS2R38 locus,
The view can be adjusted to zoom out/in or move up/down the chromosomes to look at
neighboring genes. The genes found on either side of TAS2R38 are CLECF5S (a lectin domain
gene) and MGAM (a gene that encodes for a starch digesting enzyme). These genes have
multiple coding exons while TAS2R38 has only one coding exon. Most of the genes in this area
are mostly taste and olfactory receptors.
Go to NCBI Home page
In the dropdown search menu select ‘HomoloGene
What does this data base allow you to search?
Search the HomoloGene data base for the PTC Gene: 5726 TAS2R38
Scroll down to the protein Alignment section
Click on Show Pairwise Alignment Scores
1. List the percentage of similarity between the Human version of 5726 TAS2R38 and the
other mammals listed.
2. To compare the Human and Chimpanzee protein sequences click on “Blast” on the right
side of the data table.
3. How many proteins differences are there between humans and chimpanzees?
4. Repeat this same calculation for Humans and Bos Taurus, domestic cow
5. and Mus musculusm the common house mouse.
6. Explain why the this pattern of similarity exits for these 3 mammals.
2