Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Bioinformatics Interdisciplinary science that involves developing and applying information technology for analyzing biological data Overview of Bioinformatics BLAST The BLAST programs (Basic Local Alignment Search Tools) are a set of sequence comparison algorithms that are used to search international sequence databases for regions of similarity between sequences BLAST http://www.ncbi.nlm.nih.gov/ BLAST BLAST Program Description blastp Compares an amino acid query sequence against a protein sequence database. blastn Compares a nucleotide query sequence against a nucleotide sequence database. blastx Compares a nucleotide query sequence translated in all reading frames against a protein sequence database. You could use this option to find potential translation products of an unknown nucleotide sequence. BLAST ACATTTGCTT CTGACACAAC TGTGTTCACT AGCAACCTCA AACAGACACC ATGGTGCACC TGACTCCTGA GGAGAAGTCT GCCGTTACTG CCCTGTGGGG CAAGGTGAAC GTGGATGAAGTTGGTGGTGA GGCCCTGGGC AGGCTGCTGG TGGTCTACCC TTGGACCCAG AGGTTCTTTGAGTCCTTTGG GGATCTGTCC BLAST BLAST BLAST BLAST BLAST BLAST for Beginners Tutorial