* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download mastering protein synthesis
Epigenomics wikipedia , lookup
Nucleic acid double helix wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
DNA supercoil wikipedia , lookup
Non-coding DNA wikipedia , lookup
Extrachromosomal DNA wikipedia , lookup
Cell-free fetal DNA wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Protein moonlighting wikipedia , lookup
Epigenetics of neurodegenerative diseases wikipedia , lookup
Frameshift mutation wikipedia , lookup
Transfer RNA wikipedia , lookup
DNA vaccination wikipedia , lookup
Polyadenylation wikipedia , lookup
History of RNA biology wikipedia , lookup
Helitron (biology) wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
Non-coding RNA wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Point mutation wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Expanded genetic code wikipedia , lookup
RNA-binding protein wikipedia , lookup
Primary transcript wikipedia , lookup
Genetic code wikipedia , lookup
Name _______________________________ Period _________ MASTERING PROTEIN SYNTHESIS From this DNA, you have all the information you need to build protein. 5’ ATGGTTACAGTCTATTAGATGCTATTTCAACACCAATAA 3’ 3’ TACCAATGTCAGATAATCTACGATAAAGTTGTGGTTATT 5’ mRNA (codons) amino acids (use the codon chart in your book or notes) CHECKING FOR UNDERSTANDING 1. The RNA that decodes the mRNA is called? __________________________________________ 2. How many proteins were made from this strand of DNA?________________________________ 3. A protein is made of _____________________________________________________________ 4. What is a codon? ________________________________________________________________ 5. Where does protein synthesis occur?_________________________________________________ 6. The RNA that has an anticodon is called _____________________________________________ 7. What is the anticodon for methionine? _______________________________________________ 8. What is the anticodon for CGA? ____________________________________________________ 9. The process of making an exact copy of DNA is called __________________________________ 10. The process of making mRNA is called ______________________________________________ 11. The process of decoding mRNA is called _____________________________________________ 12. What would happen to the protein if the 6th codon on mRNA changed from a. UAG to UAA? ___________________________________________________________ b. UAG to UAU? ___________________________________________________________ 13. A protein is made up of 100 amino acids. How many bases would the mRNA have? __________ 14. DNA is made of units called _______________________________________________________