Download Small aminoacyl transfer centers at GU within a larger RNA

Small aminoacyl transfer centers at GU within a larger RNA
Mali Illangasekare and Michael Yarus
Department of Molecular, Cellular and Developmental Biology
University of Colorado
Boulder, CO 80309-0347
Corresponding author:
Michael Yarus
Tel: 303 492-8376
Fax: 303 492-7744
Email: [email protected]
Key words: oligonucleotide, enzyme, rRNA, aminoacylation, adenylate
Running head: Aminoacyl transfer at …GU…
Abstract
Separate aminoacyl transfer centers related to the small …GUNNN..: NNNU ribozyme
seem possible at the frequent GU sequences dispersed throughout an RNA tertiary
structure. In fact, such activity is easily detected and varies more than 2 orders in rate,
probably being faster at sites with less structural constraint. Analysis of a particular
constrained active site in an rRNA transcript suggests that its difficulty lies not in
substrate strand association, but in binding and/or group transfer from the aminoacyl
precursor. Efficient aminoacyl transfer requires accurate complementarity between large
or small ribozymes and oligoribonucleotide substrates, even when only three or four base
pairs link the two. Thus, multi-site active ribozymal superstructures might have
coordinated an RNA metabolism, including aiding an early translation apparatus.
Introduction
Significance of RNA-RNA interactions. There is now much evidence in support of the
emergence of coded protein biosynthesis (translation) from the activities of small RNAs,
without apparent need for other kinds of catalysts 1. A principal role for RNA activities
may also extend to an even earlier time in evolution, that of the first replicators 2. A
rationale for such versatility includes the fact that RNA and ribozymes are inherently
well-suited for active associations; only small complementary tracts within different
RNA molecules need be dedicated to interactions that encode a specific composite RNA
structure.
An experimental demonstration of this aptitude can be based on the trans-aminoacylating
ribozyme:substrate GUGGC:GCCU 3-5. Here a ribozymic aminoacyl transfer center can
potentially be created from very abundant elements: wherever the frequent dinucleotide
5 GU 3 occurs in a larger RNA. That is, only a 5 GU sequence in the ribozyme and the
3 U of the substrate are true active site nucleotides 3. Other nucleotides serve only to
juxtapose the ribozyme with its oligonucleotide substrate by base pairing 3. Therefore,
wherever a 5 ..GUNNN.. 3 potential ribozyme sequence appears and a 5..NNNU
substrate is supplied in trans (N is complementary to N) a potential ribozyme exists.
Results
Observing the activity: model active centers. To model the behavior of predicted RNA
reaction centers within a larger structure, we tested the GUGGC:GCCU aminoacylation
reaction (Figure 1, #1). We constructed ribozymes of increasing length under varied, but
simple, structural constraint on a central ribozyme sequence (Figure 1, #2-7). Figure 1
plots apparent total second order rate constants (based on total oligonucleotide substrate
concentration) for the aminoacyl transfer reaction between PheAMP and RNA at pH 7
and 4, corrected for hydrolytic decay of the PheAMP substrate. Structures for the
ribozyme strand at the top were drawn by BayesFold 6. The apparent second order rates
shown ( standard error of the mean, sem) potentially reflect both chemical effects (e.g.,
on RNA reactivity) and effects on ribozyme-substrate affinity (strand and PheAMP
associations).
Figure 1 displays one complication when internal GU sequences of larger RNAs are
utilized as ribozymes. The aminoacyl transfer reaction is fastest with short ribozymes (at
the top of Figure 1, active site nt are red, substrate pairing sequences are blue). Addition
of one additional 5 and 3 nucleotide to GUGGC ribozyme to make a 7-mer has no
significant effect on aminoacylation velocity (Figure 1, sequence #2). However, reaction
velocity declines markedly as the sequence containing GUGGC is lengthened to 11
nucleotides with possible internal structure (#3). Aminoacyl transfer is slower yet and
sensitive to small differences in structure when the ribozyme sequence is within a
potential hairpin loop (#4-7). For example, activity declines progressively when the
hairpin is closed with 3, 4 or 5 potential pairs (#4-6), presumably reflecting a parallel
decline in the frequency of the looped ribozyme’s active configuration. As a further
example of reactivity closely tracking structure; while maintaining a potential 5 pair
helix, reactivity increases when the loop flanking the ribozyme is opened from 7 to 11
nucleotides (sequence #7 versus #6).
Thus, though total aminoacylation slows thirty-fold with increased loop constraint from
surrounding sequences, activity remains detectable. In fact, aminoacylated product
accumulation appears to be a sensitive monitor of structure at the site of the ribozyme,
perhaps usable for this purpose in other experiments. Accordingly, these results suggest
that higher order structure within larger RNAs is a likely complication, but observable
reactions are consistent with measureable catalysis at a substantial fraction of ..GU.. sites
within a larger RNA.
Centers within a large RNA. To observe reactions within larger RNA directly we
employed three nested transcribed fragments based on the sequence of E coli 23S rRNA
domain IV. Ribosomal RNA transcripts 251, 366, and 1076 nucleotides long are shown
in their canonical ribosomal fold 7 in Figure 2, and in enlarged detail in supplementary
Figures 1 and 2. These potential ribozyme-containing transcripts are nested; rRNA251
overlaps the 5 section of rRNA1076, and rRNA366 overlaps the 3 of the large
rRNA1076 transcript. Complementary 5-mer RNA substrates were supplied for
GUNNNN sequences at various positions marked by red arrowheads (standard E coli
rRNA numbering shown in black in Figure 2 7).
Panel A of Figure 3 shows that the initial products, where a larger RNA transcript is
incubated with UCCCU oligonucleotide substrate (S1022) and PheAMP, resemble those
previously discussed. That is, phe-oligoRNA and short peptidyl-oligoRNAs 4 are
produced. As might also be anticipated, the large transcript (here rRNA251) is the
ribozyme, required for extensive aminoacyl transfer to UCCCU.
Several such GU centers in these rRNA transcripts (Figure 2 and Figure 3) were
detectably active, though apparent rate constants relative to unhindered small
oligonucleotide ribozymes containing the same sequences (leftward point in each group,
Figure 3B) were lowered by 75- to 500-fold, presumably with faster reactions
presumably reflecting lesser local structural constraint in the large ribozyme.
Active ribozymic sites in rRNA transcripts approach the velocities of the simple models
in Figure 1; the best showed about 3-fold lower reactivity than the small GUGGC
ribozyme constrained in a 7-membered hairpin loop (compare Figure 1, #6, and Figure
3B, S1022). However, activity measured at rRNA sites ranges down to barely above the
spontaneous acylation background (lowest in Figure 3B). However, the penalty paid for a
complex ribozyme structure need not continuously increase with ribozyme size. That is,
transcripts rRNA 251 and rRNA366 are both nested within the 1076 nucleotide rRNA,
which covers all potential reaction sites (Figure 2). As comparisons of apparent rate
constants for the smaller rRNA and larger rRNA in Figure 3B show, reactivity in all
cases is similar for the smaller and larger rRNA transcripts containing the same sites
(middle, Figure 3B). Thus structural inhibition is determined locally, by sequences within
a few hundred nucleotides of the active center. This is somewhat reminiscent of Figure 1,
where the loop structure penalty is roughly the same for all potential hairpins.
Thus, multiple GU…. aminoacyl transfer sites appear to be observable in a larger RNA,
though there are reactive, probably favorably structured sites as well as those that appear
unreactive, probably less favorably structured, ranging down to sites with experimentally
insignificant activity.
Selectivity of small oligonucleotide substrates among oligonucleotide ribozymes. Our
discussion thus far, however, implicitly assumes that action of a substrate
ribooligonucleotide can be attributed to its complementary site sequence within a large
RNA, though it associates via only three or four nucleotide pairs. One might question the
selectivity of such a limited interaction.
To test specificity, a set of parallel reactions for all smaller oligonucleotides is shown in
Figure 4, where all pairwise combinations of these 6-mer ribozymes and 5-mer substrates
are tested. A credible paired ribozyme-substrate structure is shown above each gel lane.
Each lane exhibits a dominant band of 5 [32P]substrate oligonucleotide at the bottom
(fastest-moving) position. Such unacylated substrate is the only substantial band in each
leftward lane from each set of five, serving as a control, always incubated without
ribozyme.
The other four lanes of each set, ranged to the right of the no enzyme control, represent
incubations that contained all reactants: ribozyme, oligonucleotide substrate and
PheAMP. Each lane containing products is linked by a line to the relevant co-structure
above. Significant product formation (bands migrating slower than 32P substrate) is not
observed unless the oligonucleotide ribozyme is complementary to the oligonucleotide
substrate, and aminoacylated products are observed for all completely complementary
combinations.
The most interesting case is that of S1945 (substrates are denoted SNNNN) and R1112
(potential ribozymes are RNNNN; lower right, Figure 4) where even three G-C pairs
proximal to active site nucleotides do not yield observed activity. However, the similar
combination (upper right), S1112 and R1945, which has the same three active-siteproximal nucleotide pairs but stacks G on each strand, is partially active. This latter
example is the only activity observed among partially cognate pairs – its activity is
understandable in light of successful ribozyme reactions in combinations capable of only
three G-C base pairs (eg, as shown in Figure 1 and in references4, 5). Lack of product for
3 base pairs at lower right may be due to self-pairing in the ribozyme, or other
destabilizing factors. However, in every case the aminoacylation reaction requires a
complementary ribozyme:substrate sequence adjacent to the GU of the active center.
Selectivity of small oligonucleotides acting within a large RNA. However, we also
wish to use small ribozymes imbedded in large RNAs. These may pose a more rigorous
challenge to specificity, in that such reactions offer the full variety of an RNA tertiary
structure for unexpected oligonucleotide substrate interactions. These data are in Figure
3B, where each set of four measurements for a given oligonucleotide substrate includes a
larger rRNA ribozyme control that contains no normal complementary ribozyme
sequence. For each substrate oligonucleotide, the non-complementary combination yields
the lowest activity (bottom, Figure 3B).
S1022 and S1112 are complementary to the 5 region of rRNA251 and rRNA1076
transcripts (Figure 2A). S1930 and S1945 are complementary only to the 3 region of the
rRNA, as found in rRNA366 and rRNA1076 transcripts. These apparent rate constants
are measured against a background of aminoacylation at a spontaneous rate of 0.06 
0.006 M-1 min-1, which has been subtracted. Three of four non-complementary
combinations show insignificant reaction over this background. The fourth is slowed to
about 6% reactivity (relative to potentially complementary rRNA251). This may in fact
be at a slower, partially complementary site (rRNA366 is shown in Supplementary Figure
2). Thus every oligonucleotide is most reactive by far with rRNA transcripts containing
its complementary site.
Complete deletion of sites in a large RNA. Finally, both exact complements for
UCCCU substrate (S1022; Supp. Fig. 1) were removed from a large transcript (based on
rRNA1076) by mutagenesis (and the sequences were confirmed by sequencing). With no
complementary site for the substrate S1022, reactivity with UCCCU and PheAMP
subsequently fell to background values (like the lowest in Figure 3B, but data not shown).
Thus, in both 6-mer (Figure 4) and the largest transcribed ribozymes (Figure 3B),
aminoacyl transfer activity predominantly occurs at sites predicted from simple base
pairing of the NNNN of a GUNNNN potential ribozyme sequence.
Canonical measurements of large RNA activity. We wished to compare ribozymic
sites of identical sequence in a large and small RNA, measuring standard MichaelisMenten quantities. We therefore prepared a mutated form of rRNA251 (nucleotide
changes G1036C, G1037A: confirmed by sequencing; see Supp. Fig. 1) that has only one
site complementary to 5 UCCCU 3 (the looped site in Supp. Fig. 1). The mutated rRNA
transcript (single potential ribozyme at nt 1022, Supp Fig. 1) and oligonucleotide R1022,
GUGGGA ribozyme were then compared by measuring aminoacyl transfer velocities
under [UCCCU] and [PheAMP] variation 5. Michaelis-Menten behavior was usually
observed, and implications of this analysis are shown in the Table below, where
calculated underlying kcat and KM and their standard errors (calculated from a bi bi
ordered mechanism 5, see Methods) are given.
[Table 1]
Table 1 Legend: at pH 7.0 and 4 in 0.35 M Hepes, 100 mM KCl, 20 mM MgCl2. kcat is
the first-order rate for aminoacyl transfer in UCCCU:GUGGGA:PheAMP, KM,S is the
Michaelis constant for pairing of ribozyme and oligoribonucleotide substrate sequences,
KM,PheAMP is the Michaelis constant for pairing of preassembled UCCCU:GUGGGA with
PheAMP.
The kinetic constants for the small oligonucleotide ribozyme resemble those of the
prototype oligonucleotide ribozyme, GCCU:GUGGC, already published 5, though
KM,PheAMP is lower for this complex. In contrast, the larger rRNA ribozyme could not be
saturated with the largest practical concentrations of PheAMP. In this, the only
experimental exception to Michaelis-Menten behavior; velocity with the single-site
rRNA transcript increased linearly with [PheAMP]. Therefore, we compare kcat/KM for
PheAMP with the same enzymatic constant for the smaller, fully-characterized
UCCCU/GUGGGA system. As indicated in the rightmost column of the Table, the large
RNA’s active site is hindered by about two orders with respect to the same site formed by
minimal oligonucleotides, in approximate agreement with less complete measurements of
apparent second order rate constants above.
Moreover, interaction between the active site in the large ribozyme and UCCCU
oligonucleotide substrate appears sound, or perhaps even superior (lower KM,S),
conceivably due to preconfiguration of the ribozyme sequence for substrate
oligonucleotide pairing. Accordingly, here inhibition by RNA structure appears not at all
in the RNA:RNA interaction, but selectively as inhibition of interaction with PheAMP or
inhibition of rapid aminoacyl transfer, or both (lowered kcat/KM, PheAMP).
Discussion
Aminoacyl-RNA synthesis from adenylates is a long-recognized capability of pure small
RNAs 8. These data show that tiny GUGGC-like aminoacylation centers could be
collected in permissively structured regions of a larger RNA. More generally, such
collective ribozymes could participate in a larger translation apparatus, as modeled here
by aminoacyl-RNA production at widely-separated ribosomal RNA loci.
This might be of evolutionary interest because ribozymes can elaborate active quaternary
structures at relatively small evolutionary cost; that is, such structures could appear under
small selection pressures. For example, such complexes seem ideal for substrate and
product channeling along electrostatic pathways, formed by exploiting the highly anionic
RNA backbone. Electrostatic channeling likely carries a charged intermediate 40 Å
between the active sites of dihydrofolate reductase and thymidylate synthetase 9. Similar
channeling might speed reactions attending the cationic amino group of carboxylactivated amino acids, the latter being probable reactants during the RNA origins of
translation 1.
Strikingly, these ribooligomers usually show efficient aminoacyl transfer only when a
complementary ribozyme is available. To be precise, these data (Figure 3B, 4) show
ribozyme activity (including substrate binding) at M strand concentrations (compare
Methods), where few mistaken reaction sites are utilized. We are accustomed to
significant triplet-triplet interactions on tRNAs 10, dependent on the special structural
context of an anticodon hairpin 11. However, the present data are a reminder that free,
linear triplets and quadruplets display biochemically useful affinities and specificities.
Thus, we emphasize the possible biochemical utility of such triplets and quadruplets: it
appears that ribozymes always have an intrinsic, specific enzyme-substrate interaction
available for any molecule that can be covalently linked to a three or four-nucleotide
cofactor. Because both ribozyme assembly and acquisition of substrates requires only
three or four nucleotide pairs, a metabolic network of ribozyme reactions linked by short
oligomers, specifically deploying even reactants that do not intrinsically interact well
with RNA, seems readily conceivable.
Materials and Methods
Aminoacylation reactions. rRNA-like transcripts were heated to 65o for 3 and slow
cooled to room temperature in the presence of reaction buffer. Then substrate RNA was
added and incubated for another 15. This solution was transferred to 4o and the reaction
was initiated by the addition of PheAMP. Timed samples were removed and quenched in
acidic loading dye and dry ice.
Acylation of different composed oligonucleotide structures. Aminoacylation
conditions were: 100 mM Hepes, pH 7.0, 100 mM KCl and 100 mM NaCl, 5 mM MgCl2
and 5 mM CaCl2, 4, 1.5 mM PheAMP, ribozyme 16.3 M, substrate 0.83 M.
Acylation of oligonucleotides by rRNA transcripts. Aminoacylation conditions were:
350 mM Hepes, pH 7.0, 100mM KCl, 20 mM MgCl2, 8 mM PheAMP, 0.8 – 1.2 M
ribozyme, approximately 0.2 M substrate, pH 7 and 4. High buffer concentrations are
required to prevent pH decrease at elevated PheAMP concentrations, when it is varied.
UCCCU and PheAMP variation with single-site rRNA ribozyme gave leastsquares values
( standard errors) of kcat/KM)appPheAMP = 0.331  0.008 M-1 min-1 (reaction linear in
[PheAMP] at all practical concentrations), KappM,S = 3.2  0.7 x 10-6 M and kappcat,S =
0.054  0.007 min-1. These observed quantities were used to calculate tabulated values,
which are the underlying values characteristic of the mechanism (see Kinetic Analysis,
below).
Acylation of pentamer oligonucleotide substrates with hexamer oligonucleotide
enzymes. Aminoacylation conditions were: 350 mM Hepes, pH 7.0, 100 mM KCl, 20
mM MgCl2, 8.6 mM PheAMP, 0.8 M ribozyme, 0.1 M substrate, 2 min at pH 7 and
4.
Quantitative acylation velocities for UCCCU. UCCCU was varied to 10.1 M in the
presence of 0.46 M rRNA transcript, 9.4 mM PheAMP at 4. PheAMP was varied to
15.2 mM in the presence of 0.46 M rRNA transcript and 0.1 M UCCCU. UCCCU was
varied to 10 M in the presence of 0.46 M GUGGGA and 7.1 mM PheAMP. PheAMP
was varied to 15.2 mM in the presence of 0.46 M GUGGGA and 0.1 M UCCCU.
Values from leastsquares Eadie-Hofstee plots ( standard errors) used to derive tabulated
values were KappM, PheAMP = 11.4  1.4 mM, kcat = 0.13  0.009 min-1, KappM,S = 8.3  0.7
x 10-7 M, kappcat,S = 0.11  0.004 min-1.
Gel analysis of reactions. Reaction samples were analyzed in 12% PAGE, 6M Urea,
0.1M sodium acetate, pH 5.2 gels (40 cm) for about 16 hrs at 4o. Gels were dried and
analyzed with a Bio-Rad Molecular phosphorimager.
Kinetic analysis. “Apparent rates” are approximate second order rate constants (k below;
units of M-1 min-1) based on ribozyme-substrate assembly that is assumed to be complete,
and PheAMP concentrations assumed to decay3 at 0.024 min-1.
k
GUGGGA : UCCCU  PheAMP 
 GUGGGA : UCCCU  Phe  AMP
1
0.024min
PheAMP 
 Phe  AMP
The rate constant giving the best least squares error at several times (product based on
acid gel phosphorimages) is quoted. Hydrolytic decay of PheAMP substrate was
compensated by analyzing all kinetics versus a decay-corrected time, tcorr:
k
tcorr 
(1  e decay )
kdecay
t
where kdecay was 0.024 min-1.
For complete Michaelis-Menten analysis, a bisubstrate ordered mechanism is used:
M ,S

 GUGGGA : UCCCU
GUGGGA  UCCCU 

K

 GUGGGA : UCCCU : PheAMP
GUGGGA : UCCCU  PheAMP 

K M ,PheAMP
kcat
GUGGGA : UCCCU : PheAMP 
GUGGGA : UCCCU  Phe  AMP
where total transfer of Phe to UCCCU is measured and the three underlying kinetic
constants are from apparent quantities (and their standard errors) from Eadie-Hofstee
plots 5 of velocity at six different initial concentrations of UCCCU or PheAMP. Using the
superscript “apparent” to imply experimental values from separate Eadie-Hofstee plots
where [UCCCU] (at 7.1 mM PheAMP) and [PheAMP] (at 0.1 M UCCCU) are varied
(at 0.46 M GUGGGA):
apparent
kcat  kcat
(
,S
K M , PheAMP
K M , PheAMP  PheAMP
)
PheAMP
GUGGGA
 K Mapparent
)
, PheAMP (
GUGGGA  K M , S
K M , S  K Mapparent
(
,S
K M , PheAMP  PheAMP
K M , PheAMP
)
and true kcat is that observed on saturation with PheAMP.
rRNA partial transcripts. Ribosomal RNA fragments were generated by synthesizing
cDNA to E coli rRNA as follows: 0.1 g/l of E coli total RNA (Invitrogen), 0.7 3
DNA oligo (either TACCCAACAACGCATAAGC for rRNA251 or
TTCACTGAGTCTCGGGTGGAGACAGC for rRNA366 and rRNA1076), 1 mM each
dNTP, 2U/l RnaseOut (Invitrogen), 1U/l AMV Reverse Transcriptase (Life Sciences,
Inc) and buffer provided by the company.
For preparation of PCR DNA, DNA oligos
TAATACGACTCACTATAGGAGACACACGGCGGGTGC (T7 promoter in bold
italics), TACCCAACAACGCATAAGC and corresponding cDNA was used for
rRNA251; TAATACGACTCACTATAGAGAGAACTCGGGTGAAGGA,
TTCACTGAGTCTCGGGTGGAGACAGC with cDNA366 for rRNA366; and
TAATACGACTCACTATAGGAGACACACGGCGGGTGC,
TTCACTGAGTCTCGGGTGGAGACAGC with cDNA366 for rRNA1076. T7
transcripts of rRNA251, rRNA366 and rRNA1076 were synthesized using above PCR
DNA and all RNAs were PAGE purified.
Mutated rRNA. Mutagenized rRNA1037 was prepared similarly, except that DNA
oligos TAATAC GACTCACTATAG AAA CAA CCC AGA CCG CCA GCT AAG GTC
CCA AAG TCA TGG TTA AGT CAG AAA CG A TGT CAG AAG GC and
TTCACTGAGTCTCGGGTGGAGACAGC (mutated nucleotides are in bold,
underlined) with cDNA366 was used to make PCR DNA. This transcript has no
complementary sites for S1022. RNA transcripts that have single mutation were prepared
by using DNA oligos - either TAATAC GACTCACTATAGAAA CAA CCC AGA CCG
CCA GCT AAG GTC CCA AAG TCA TGG TTA AGT GGG AAA CG A TGT CAG
AAG GC or TAA TAC GAC TCA CTA TAG AAA CAA CCC AGA CCG CCA GCT
AAG GTC CCA AAG TCA TGG TTA AGT CAG AAA CG A TG .
Oligonucleotides. All small RNAs were synthesized by Dharmacon (Thermo Fisher).
Other operations. Synthesis of PheAmp has been described 8. Substrate RNAs were
labeled at the 5’ end using T4 Polynucleotide Kinase 4 (New England Biolabs) and PAGE
purified in 15% denaturing gel. Excised RNA was extracted in water, filtered (Costar
Spinex Centrifuge Tube filter (.22m cellulose acetate)) and lyophilized to dryness (2-3
hrs).
References
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
Yarus, M. On translation by RNAs alone. Cold Spring Harb Symp Quant Biol 66,
207-215 (2001).
Yarus, M. Getting past the RNA world: the Initial Darwinian Ancestor. Cold
Spring Harbor Perspect Biol, doi: 10.1101/cshperspect.a003590 (2010).
Chumachenko, N.V., Novikov, Y. & Yarus, M. Rapid and simple ribozymic
aminoacylation using three conserved nucleotides. J Am Chem Soc 131, 52575263 (2009).
Turk, R.M., Chumachenko, N.V. & Yarus, M. Multiple translational products
from a five-nucleotide ribozyme. Proc Natl Acad Sci U S A 107, 4585-4589
(2010).
Turk, R.M., Illangasekare, M. & Yarus, M. Catalyzed and spontaneous reactions
on ribozyme ribose. JACS, PMID: 21438575 (2011).
Knight, R., Birmingham, A. & Yarus, M. BayesFold: rational secondary folds that
combine thermodynamic, covariation, and chemical data for aligned RNA
sequences. RNA 10, 1323-1336 (2004).
Cannone, J.J. et al. The comparative RNA web (CRW) site: an online database of
comparative sequence and structure information for ribosomal, intron, and other
RNAs. BMC Bioinformatics 3, 2 (2002).
Illangasekare, M., Sanchez, G., Nickles, T. & Yarus, M. Aminoacyl-RNA
synthesis catalyzed by an RNA. Science 267, 643-647 (1995).
Miles, E.W., Rhee, S. & Davies, D.R. The molecular basis of substrate
channeling. J Biol Chem 274, 12193-12196 (1999).
Uhlenbeck, O.C. Complementary oligonucleotide binding to transfer RNA. J Mol
Biol 65, 25-41 (1972).
Romby, P., Giege, R., Houssier, C. & Grosjean, H. Anticodon-anticodon
interactions in solution. Studies of the self-association of yeast or Escherichia coli
tRNAAsp and of their interactions with Escherichia coli tRNAVal. J Mol Biol
184, 107-118 (1985).
Figures
Figure 1 Effect of ribozyme structure. Reactions #1 through #7: synthetic
oligonucleotides create the ribozyme sequence GUGGC (potentially reactive with the
substrate GCCU) in different structural contexts. Red nucleotides at the top are active
center, blue nucleotides function in substrate pairing. Apparent second order rate
constants (with standard error of the mean, sem, bars) for total aminoacyl-RNA
synthesis3, 5 are presented after correction for PheAMP decay and background at 4 and
pH 7.
Figure 2 Fragments of 23S rRNA. Complementary oligonucleotide reactions are
compared to reactions using transcripts based on fragments of E coli 23S RNA (termini
are shown as black triangles in panel A) incubated with complementary substrate
ribopentamers. The standard nucleotide position of the G in each potential rRNA
GUNNNN ribozyme is indicated by a red triangle in panel A. The large potential
ribozymic transcripts are named for their sizes; that is, rRNA1076 is the long transcript
containing all rRNA sites, nominally 1076 nucleotides long.
Figure 3 Reactions of the rRNA transcripts compared to oligonucleotide reactions.
Panel A Dependence of reaction on rRNA transcript ribozyme. Products of ribosomal
RNA fragment rRNA251 incubated with [32P]UCCCU and PheAMP (60 min, 4) parallel
those characterized before 4
Panel B Apparent second order rate constants for reaction between oligonucleotide
ribozymes or rRNA transcripts and oligonucleotide substrates are shown (with sem
shown at the top), grouped by oligonucleotide substrate: left-to-right - S1022, S1112,
S1930 and S1945. In each set of four, the left-hand bar is the small complementary
oligonucleotide ribozyme. R1022 is the minimal complementary oligonucleotide
ribozyme for S1022, then rRNA251, rRNA366 and rRNA1076, the corresponding larger
transcripts shown in Figure 2, follow in each set. Rates are in excess of uncatalyzed
acylation background (0.06  0.006 M-1 min-1, mean  sem; 7 measurements), whose rate
has been subtracted. Expanded drawings of the rRNA loci are shown in supplementary
Figures.
Figure 4 Reactions of substrate oligonucleotides (Snnnn) with ribozyme
oligonucleotides (Rnnnn). All combinations of hexanucleotide ribozymes and
pentanucleotide substrates are incubated. Above the lanes are plausible structures, shown
linked to the relevant gel lanes containing the cognate reaction products, shown after
fractionation on a 10% acrylamide acid gel.
First Supplementary Figure: 5 rRNA sites An enlarged section of the rRNA sequence
containing the 5-primeward nucleotides of rRNA251 and the same section within the
larger rRNA1076. Oligonucleotide substrates are shown paired at complementary sites in
pink. For quantitative velocity studies the upper UCCCU (S1022) site was disrupted by
double mutagenesis (G1036C, G1037A: confirmed by Sanger sequencing), to leave the
single looped site below.
Second Supplementary Figure: 3 rRNA sites An enlarged section of the rRNA
sequence containing the 3-primeward nucleotides of rRNA366 and the same section
within the larger rRNA1076. Oligonucleotide substrates are shown paired at
complementary sites in pink.