Download Strand A - hrsbstaff.ednet.ns.ca

Name:
RFLPs and Sickle Cell Anemia
Background Information:
Linda Fulcher and her husband Glenn were a bit nervous as they met with Beth Greendale, the
genetic counselor at Children’s Hospital. The Fulchers, a young black couple from Miami, have
been married for three years, and now they wanted to start a family.
Like most young people, the Fulchers were healthy. They assumed that any children they might
have would be healthy, too. But when they heard at their church about the screening program for
sickle cell trait, they thought they should look into it.
They found that about 1 in 625 black children in the United States are born with sickle cell
anemia each year. When Beth Greendale gave her presentation to the church group as part of the
screening program, she said that sickle cell anemia is caused by a problem with hemoglobin, the
protein that carries oxygen in the blood. As a result of the abnormal hemoglobin, the blood cells
take on a sickle shape, as shown in figure 1.
As you can see, the cells are long and rigid,
instead of round and flexible. People who have
the disorder experience severe pain in their long
bones and joints and are susceptible to infections.
Some do not live beyond childhood. With good
medical care, however, affected persons can live
reasonably normal lives into adulthood.
Sickle cell anemia, Beth said, is a co-dominant
trait. That means affected individuals have two
abnormal genes, one from each parent. Some
people are said to be carriers and have the sickle
trait. They have one normal allele and one
affected but the trait. They have some sickle cells,
but not enough to affect their lifestyle.
Figure 1: Sickle and normal blood cells
Question 1. If two people with the sickle trait reproduce, what is the probability that they will have
a child with sickle cell anemia?
Beth had explained that each major ethnic group seems to have one genetic disorder that
occurs more frequently in that population. Blacks, who trace their ancestry to Africa, are at
increased risk for sickle cell anemia.
Linda and Glenn decided to have themselves tested for the sickle cell trait. When the results
showed that they both had the sickle cell trait, they called Beth at the genetic counseling clinic at
Children’s Hospital to talk about family planning. Beth told them that there is a very accurate
prenatal test that can determine whether the developing fetus has sickle cell anemia, sickle trait,
or normal hemoglobin. Linda and Glenn listened as Beth introduced them to RFLPs.
Red blood cells are filled with a protein called hemoglobin. Hemoglobin carries oxygen to cells
that are actively working. In the late 1940’s, Dr. Linus Pauling suggested that sickle cell anemia
might be caused by an abnormality in hemoglobin. A person with sickle cell anemia has a low red
blood count (anemia).
Many years of research revealed that the DNA that codes for the hemoglobin molecule has a
mutation in individuals who have sickle hemoglobin. The mutation changes one amino acid
(glutamic acid) in normal hemoglobin to a different amino acid (valine) in sickle hemoglobin. That
change gives the red blood cells a different shape, which causes the problems seen in affected
individuals.
Procedure:
1.
Table 1 shows bases that are part of the DNA sequence for normal hemoglobin and sickle
hemoglobin. Complete the table, by using the codon table from your text book (included
as table 2).
DNA
Normal
hemoglobin DNA
GGT CTC CTC
Sickle hemoglobin
GGT CAC CTC
Table 1: Hemoglobin proteins
Table 2: Codons in mRNA
MRNA codons
Proteins
Question 2. What are the differences in the genetic code and the result of that difference?
2.
Strands A and B represent two single strands of DNA. Using the strips of paper, colour in
each square according to the information below. Assign a colour to represent each of the
four bases (adenine, thymine, cytosine, guanine). Include this key in your lab.
Strand A
AGGTCTCCTCTAATTGGTCTCCTTAGGTCTCCTTA
Strand B
AGGTCTCCTCTAATTGGTCACCTTAGGTCTCCTTA
3.
The restriction enzyme MstII recognizes the DNA sequence GGTCTCC and cuts the DNA
cut
between the first T and the first C of that sequence, reading from left to right. Either mark
the cuts on your paper strips or cut the strips at the proper spot(s). Glue the strips at the in
the space on the last page (leave room to answer the question on that page!).
Question 3: What will be the length of the fragments (haw many bases) if strand A is cut with
MstII? What will be the length of the fragments in strand B?
Question 4: How could you use MstII to distinguish between normal hemoglobin from sickle
hemoglobin?
Question 5: Assume that Ms. Fulcher undergoes prenatal testing. The genetic counselor shows
Ms.Fulcher and her husband the results of the DNA test.
In each case, give the diagnosis for the developing fetus
a)
fragment sizes = 4, 14, 10, 7
b)
fragment sizes = 4, 14, 10, 24, 7
c)
fragment sizes = 4, 24, 7
Question 6: Mutations among different ethnic groups are usually present due to their usefulness
to a population. There is a very good reason why people of African descent are more likely to have
the sickle trait or sickle cell anemia. Find out why and how this trait is beneficial.
Strand A
Strand B
Strand A
Strand B
Strand A
Strand B