Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Name:_________________ Block:_________________ Date:__________________ The Protein Synthesis Candy Factory Making proteins in the cell is a lot like making candy in a factory! The boss of the Candy Factory, Frieda, sits in her office all day handing out recipe cards to messengers who go out to the various assembly stations on the factory floor and direct the assembly of ingredients that correspond to the recipes. Combinations of ingredients must pass through one of several work stations before they end up as candy. Think about how proteins are made in the cell. Now, fill in the table below to compare how protein synthesis is like making candy. PROTEIN SYTHESIS CANDY FACTORY Boss gives recipe to messenger Messenger leaves office through door; goes to factory floor and to workstations Workers pick up ingredients Workers bring ingredients to the workstation Ingredients are combined according to the recipe In this lab you will be making your own candy protein!! Follow the steps below in order to go from DNA to protein (aka Candy!!) Answer all questions directly on this sheet. Assume a strand of DNA has the following base sequence: TACCTAAGGGTATAACGGAATATT 1. Show the sequence of bases that would be found in the opposite strand of DNA, using complementary base pairing rules. 2. Show the sequence of bases that would be found in mRNA if the original strand given above undergoes transcription. 3. This sequence of bases in mRNA must now be decoded by the cell. What is this process of decoding called? ______________________________________________________________ ______________________________________________________________ 4. How many codons are represented by the mRNA strand in number 2? ______________________________________________________________ ______________________________________________________________ 5. How many amino acids could this potentially code for? ______________________________________________________________ ______________________________________________________________ 6. Show the sequence of bases to be found in each tRNA anticodon that corresponds to each codon in mRNA. 7. Compare the sequence of tRNA bases to the original strand of DNA. How do they compare? ______________________________________________________________ ______________________________________________________________ 8. Using your codon chart, list the correct sequence of amino acids that would be coded for from the above sequence. (Hint: remember which strand to always read your ‘message’ from on your codon chart) ______________________________________________________________ ______________________________________________________________ 9. Using the list of ingredients used in Frieda’s Candy Factory assemble your protein based on the amino acid sequence above. Place each candy on the skewer in the proper order and write the candy names and order below. ______________________________________________________________ ______________________________________________________________ Finally, check with Frieda (aka Ms. Smith) to see if your protein (candy) is ready to be used by the cell (EATEN!!!!) This candy has been made under the guidelines of protein synthesis by Frieda’s Candy Factory. Mark: ______ - ________________________ Frieda Name: Master Block:_________________ Date:__________________ The Protein Synthesis Candy Factory Making proteins in the cell is a lot like making candy in a factory! The boss of the Candy Factory, Frieda, sits in her office all day handing out recipe cards to messengers who go out to the various assembly stations on the factory floor and direct the assembly of ingredients that correspond to the recipes. Combinations of ingredients must pass through one of several work stations before they end up as candy. Think about how proteins are made in the cell. Now, fill in the table below to compare how protein synthesis is like making candy. PROTEIN SYTHESIS mRNA transcribed from DNA CANDY FACTORY Boss gives recipe to messenger mRNA exits through nuclear pore to cytoplasm/ribosomes Messenger leaves office through door; goes to factory floor and to workstations tRNA binds to amino acids Workers pick up ingredients tRNA bonds to mRNA at ribosome Workers bring ingredients to the workstation Polypeptide chain grows in response to mRNA codons Ingredients are combined according to the recipe In this lab you will be making your own candy protein!! Follow the steps below in order to go from DNA to protein (aka Candy!!) Answer all questions directly on this sheet. Assume a strand of DNA has the following base sequence: T A C C T A A G G G T A T A A C G G A A T A T T A A 1. Show the sequence of bases that would be found in the opposite strand of DNA, using complementary base pairing rules. A T G G A T T C C C A T A T T G C C T T A T 2. Show the sequence of bases that would be found in mRNA if the original strand given above undergoes transcription. A U G G A U U C C C A U A U U G C C U U A U A A 3. The above sequence of mRNA must now be decoded by the ribosomes. What is this process of decoding called? Translation 4. How many codons are represented by the mRNA strand in number 2? 8 5. How many amino acids does this code for? 7 6. Show the sequence of bases to be found in each tRNA anticodon that corresponds to each codon in mRNA. U A C C U A A G G G U A U A A C G G A A U A U U 7. Compare the sequence of tRNA bases to the original strand of DNA. How do they compare? Identical, except for uracil has replaced thymine in the tRNA strand. 8. Using your codon chart, list the correct sequence of amino acids that would be coded for from the above sequence. (Hint: remember which strand to always read your ‘message’ from on your codon chart) 9. Using the list of ingredients used in Frieda’s Candy Factory assemble your protein based on the amino acid sequence above. Place each candy on the skewer in the proper order and write the candy names and order below. ______________________________________________________________ ______________________________________________________________ Finally, check with Frieda (aka-> Ms. Smith) to see if your protein (candy) is ready to be used by the cell (EATEN!!!!) This candy has been made under the guidelines of protein synthesis by Frieda’s Candy Factory. Mark: ______ - ________________________ Frieda Ingredient List Although there are 20 different amino acids that are coded for by 64 different codons, Frieda’s Candy Shop Specializes in candy recipes that contain only 7 amino acids. The table below shows the Candy ingredient and which amino acid it corresponds with in order to make candy protein. Amino Acid Three-letter abbreviation Candy Ingredient Alanine Ala Pink bunnies Aspartic acid Asp Orange jujubes Histidine His Green jujubes Isoleucine Ile Blue bunnies Leucine Leu Black jujubes Methionine Serine Met Ser Red jujubes Yellow jujubes