Download Document 8931044

Atlas of Genetics and Cytogenetics
in Oncology and Haematology
OPEN ACCESS JOURNAL AT INIST-CNRS
Scope
The Atlas of Genetics and Cytogenetics in Oncology and Haematology is a peer reviewed on-line journal in
open access, devoted to genes, cytogenetics, clinical entities in cancer, and cancer-prone diseases.
It presents structured review articles ("cards") on genes, leukaemias, solid tumours, cancer-prone diseases, more
traditional review articles on these and also on surrounding topics ("deep insights"), case reports in hematology, and
educational items in the various related topics for students in Medicine and in Sciences.
Editorial correspondance
Jean-Loup Huret
Genetics, Department of Medical Information,
University Hospital
F-86021 Poitiers, France
tel +33 5 49 44 45 46 or +33 5 49 45 47 67
[email protected] or [email protected]
Staff
Mohammad Ahmad, Mélanie Arsaban, Marie-Christine Jacquemot-Perbal, Maureen Labarussias, Catherine Morel-Pair,
Laurent Rassinoux, Sylvie Yau Chun Wan - Senon, Alain Zasadzinski.
Database Director: Philippe Dessen, and the Chairman of the on-line version: Alain Bernheim (Gustave Roussy
Institute, Villejuif, France).
The Atlas of Genetics and Cytogenetics in Oncology and Haematology (ISSN 1768-3262) is published 4 times a year
by ARMGHM, a non profit organisation.
The Atlas is hosted by INIST-CNRS (http://www.inist.fr)
http://AtlasGeneticsOncology.org
© ATLAS - ISSN 1768-3262
The PDF version of the Atlas of Genetics and Cytogenetics in Oncology and Haematology is a reissue of the original articles published in collaboration with the
Institute for Scientific and Technical Information (INstitut de l’Information Scientifique et Technique - INIST) of the French National Center for Scientific Research
(CNRS) on its electronic publishing platform I-Revues.
Online and PDF versions of the Atlas of Genetics and Cytogenetics in Oncology and Haematology are hosted by INIST-CNRS.
Atlas of Genetics and Cytogenetics
in Oncology and Haematology
OPEN ACCESS JOURNAL AT INIST-CNRS
Editor-in-Chief
Jean-Loup Huret
(Poitiers, France)
Editorial Board
Alessandro Beghini
Anne von Bergh
Vasantha Brito-Babapulle
Charles Buys
Anne Marie Capodano
Fei Chen
Antonio Cuneo
Paola Dal Cin
Louis Dallaire
François Desangles
Gordon Dewald
Richard Gatti
Oskar Haas
Anne Hagemeijer
Nyla Heerema
Jim Heighway
Sakari Knuutila
Lidia Larizza
Lisa Lee-Jones
Edmond Ma
Cristina Mecucci
Yasmin Mehraein
Fredrik Mertens
Konstantin Miller
Felix Mitelman
Hossain Mossafa
Florence Pedeutour
Susana Raimondi
Mariano Rocchi
Alain Sarasin
Albert Schinzel
Clelia Storlazzi
Sabine Strehl
Nancy Uhrhammer
Dan Van Dyke
Roberta Vanni
Franck Viguié
Thomas Wan
Bernhard Weber
(Milan, Italy)
(Rotterdam, The Netherlands)
(London, UK)
(Groningen, The Netherlands)
(Marseille, France)
(Morgantown, West Virginia)
(Ferrara, Italy)
(Boston, Massachussetts)
(Montreal, Canada)
(Paris, France)
(Rochester, Minnesota)
(Los Angeles, California)
(Vienna, Austria)
(Leuven, Belgium)
(Colombus, Ohio)
(Liverpool, UK)
(Helsinki, Finland)
(Milano, Italy)
(Newcastle, UK)
(Hong Kong, China)
(Perugia, Italy)
(Homburg, Germany)
(Lund, Sweden)
(Hannover, Germany)
(Lund, Sweden)
(Cergy Pontoise, France)
(Nice, France)
(Memphis, Tennesse)
(Bari, Italy)
(Villejuif, France)
(Schwerzenbach, Switzerland)
(Bari, Italy)
(Vienna, Austria)
(Clermont Ferrand, France)
(Rochester, Minnesota)
(Montserrato, Italy)
(Paris, France)
(Hong Kong, China)
(Würzburg, Germany)
Atlas Genet Cytogenet Oncol Haematol. 2007;11(3)
Genes Section
Genes / Leukemia Sections
Leukemia Section
Deep Insights Section
Solid Tumors Section
Genes / Deep Insights Sections
Leukemia Section
Genes / Solid Tumors Sections
Education Section
Leukemia / Solid Tumors Sections
Leukemia / Deep Insights Sections
Cancer-Prone Diseases / Deep Insights Sections
Genes / Leukemia Sections
Deep Insights Section
Leukemia Section
Genes / Deep Insights Sections
Deep Insights Section
Solid Tumors Section
Solid Tumors Section
Leukemia Section
Genes / Leukemia Sections
Cancer-Prone Diseases Section
Solid Tumors Section
Education Section
Deep Insights Section
Leukemia Section
Genes / Solid Tumors Sections
Genes / Leukemia Section
Genes Section
Cancer-Prone Diseases Section
Education Section
Genes Section
Genes / Leukemia Sections
Genes / Cancer-Prone Diseases Sections
Education Section
Solid Tumors Section
Leukemia Section
Genes / Leukemia Sections
Education Section
Atlas of Genetics and Cytogenetics
in Oncology and Haematology
OPEN ACCESS JOURNAL AT INIST-CNRS
Volume 11, Number 3, July-September 2007
Table of contents
Gene Section
INTS6 (integrator complex subunit 6)
Ilse Wieland
165
LDB1 (LIM domain binding 1)
Takeshi Setogawa, Testu Akiyama
167
MSH6 (mutS homolog 6 (E. Coli))
Sreeparna Banerjee
169
BARD1 (BRCA1 associated RING domain 1)
Irmgard Irminger-Finger
173
BCL6 (B-Cell Lymphoma 6)
Stevan Knezevich
177
BRD4 (bromodomain containing 4)
Anna Collin
180
ENPP2 (ectonucleotide pyrophosphatase/phosphodiesterase 2)
Mary L Stracke, Timothy Clair
182
EPHA7 (EPH receptor A7)
Haruhiko Sugimura, Hiroki Mori, Tomoyasu Bunai, Masaya Suzuki
186
FLCN (folliculin gene)
Laura S Schmidt
188
HIC1 (hypermethylated in cancer 1)
Dominique Leprince
192
HSPD1 (heat shock 60kDa protein 1)
Ahmad Faried, Leri S Faried
194
HSPH1 (heat shock 105kDa/110kDa protein 1)
Takumi Hatayama, Nobuyuki Yamagishi
197
JAG2 (human jagged2)
Pushpankur Ghoshal, Lionel J Coignet
199
MUC4 (mucin 4, cell surface associated)
Nicolas Moniaux, Pallavi Chaturvedi, Isabelle Van Seuningen, Nicole Porchet, Ajay P
Singh, Surinder K Batra
201
NUT (nuclear protein in testis)
Anna Collin
207
RAC3 (ras-related C3 botulinum toxin substrate 3
(rho family, small GTP binding protein Rac3))
Nora C Heisterkamp
209
RBM5 (RNA binding motif protein 5)
Mirna Mourtada-Maarabouni
213
RHOB (ras homolog gene family, member B)
Minzhou Huang, Lisa D Laury-Kleintop, George Prendergast
217
Atlas Genet Cytogenet Oncol Haematol. 2007;11(3)
Atlas of Genetics and Cytogenetics
in Oncology and Haematology
OPEN ACCESS JOURNAL AT INIST-CNRS
RNASET2 (ribonuclease T2)
Francesco Acquati, Paola Campomenosi
219
ALOX12 (arachidonate 12-lipoxygenase) Homo sapiens
Sreeparna Banerjee, Asli Erdog
222
IL6 (interleukin 6 (interferon beta 2))
Stefan Nagel, Roderick AF MacLeod
226
KLF6 (Krüppel like factor 6)
Scott L Friedman, Goutham Narla, John A Martignetti
229
MIRN21 (microRNA 21)
Sadan Duygu Selcuklu, Mustafa Cengiz Yakicier, Ayse Elif Erson
232
PSIP1 (PC4 and SFRS1 interacting protein 1)
Cristina Morerio, Claudio Panarello
237
RAF1 (v-raf-1 murine leukemia viral oncogene homolog 1)
Max Cayo, David Yu Greenblatt, Muthusamy Kunnimalaiyaan, Herbert Chen
239
Leukaemia Section
i(8)(q10) in acute myeloid leukaemia
David Betts
245
t(5;12)(q31;p13) in MDS, AML and AEL
Maria D Odero
247
Solid Tumour Section
Carcinoma with t(15;19) translocation
Anna Collin
249
Vulva and Vagina tumors: an overview
Roberta Vanni, Giuseppina Parodo
252
Cancer Prone Disease Section
Diamond-Blackfan anemia (DBA)
Hanna T Gazda
256
Case Report Section
t(16;21)(q24;q22) in therapy-related acute myelogenous leukemia arising from
myelodysplastic syndrome
Paola Dal Cin, Karim Ouahchi
A de novo AML with a t(1;21)(p36;q22) in an elderly patient
Paola Dal Cin, Andrew J Yee, Bimalangshu Dey
Atlas Genet Cytogenet Oncol Haematol. 2007;11(3)
258
261
Atlas of Genetics and Cytogenetics
in Oncology and Haematology
OPEN ACCESS JOURNAL AT INIST-CNRS
Gene Section
Mini Review
INTS6 (integrator complex subunit 6)
Ilse Wieland
Institut für Humangenetik, Otto-von-Guericke-Universität, Leipziger Str. 44, 39120 Magdeburg, Germany
Published in Atlas Database: November 2006
Online updated version: http://AtlasGeneticsOncology.org/Genes/INTS6ID40287ch13q14.html
DOI: 10.4267/2042/38428
This work is licensed under a Creative Commons Attribution-Non-commercial-No Derivative Works 2.0 France Licence.
© 2007 Atlas of Genetics and Cytogenetics in Oncology and Haematology
Localisation
Identity
Mainly nuclear localisation.
Hugo: INTS6
Other names: DICE1; deleted in cancer 1; DBI-1;
DDX26; INT6
Location: 13q14.3
Function
Predicted motifs of DICE1 protein were a von
willebrand factor a (VWFA) domain of nuclear
proteins, nuclear sorting signals and a DEAD box of
ATP-dependent helicases. Ectopic expression of
DICE1 cDNA in tumour cells suppresses colony
formation and in cell culture. The Int6 protein was
purified as a subunit of a RNA polymerase II
multiprotein complex with roles in transcriptional
regulation and RNA processing.
DNA/RNA
Description
The DICE1 gene consists of 18 exons and contains a
GpC-rich promoter.
Transcription
Homology
A major transcript of 4.4 kb and a minor transcript of
6.9 kb was detected in fetal and adult tissues. In adult
heart, brain and skeletal muscle an additional smaller
transcript of 4 kb has been detected by Northern blot
analysis. The DICE1 cDNA consists of 3665 bp with a
coding sequence of 2661 bp; an alternatively spliced
variant generated by skipping of exon 3 has been
detected specifically in brain.
Weak homology
superfamily II.
members
of
the
helicase
Mutations
Note: Mutations in the coding sequence of
DICE1/DDX26 have been infrequently detected in
tumour cells.
Pseudogene
Somatic
Presumably LOC285634 at 5p13.1.
Frequent loss of heterozygosity (LOH) has been
observed in lung, esophageal and prostate carcinomas.
Promoter hypermethylation concomitant with reduced
mRNA expression has been observed in lung and
prostate carcinomas. In esophageal squamous cell
carcinomas missense mutations V431I, R658Q have
been detected. In prostate cancer cell line LNCaP
missense mutation D546G has been described.
Protein
Description
For the DICE1 protein 887 amino acids were predicted.
A protein of approximately 100 kDaltons was detected
by coupled in vitro transcription and translation. The
Int6 protein was purified as an approximately 110
kDaltons polypeptide component of a nuclear
Integrator complex.
Atlas Genet Cytogenet Oncol Haematol. 2007;11(3)
to
165
INTS6 (integrator complex subunit 6)
Wieland I
Implicated in
References
Functional inactivation of the DICE1 gene has been
implicated in:
Hoff HBIII, Tresini M, Li S, Sell C. DBI-1, a novel gene related
to the Notch family, modulates mitogenic response to insulinlike growth factor 1. Exp Cell Res 1998;238:359-370.
Tumorigenesis of sporadic lung
carcinomas, esophagus carcinomas,
prostate carcinomas and possibly other
sporadic carcinomas
Meixner A, Wiche G, Propst F. Analysis of the mouse MAPIB
gene identifies a highly conserved 4.3 kb 3¹untranslated region
and provides evidence against the proposed structure of DBI-1
cDNA. Biochim Biophys Acta 1999;1445; 345-350.
Wieland I, Arden KC, Michels D, Klein-Hitpass L, Böhm M,
Viars CS, Weidle UH. Isolation of DICE1: A gene frequently
affected by LOH and downregulated in lung carcinomas.
Oncogene 1999;18:4530-4537.
Abnormal Protein
A 6.3 kb fusion cDNA of a Notch-like with Dice1
cDNA (DBI-1) was detected in mouse cell line TC4.
Overexpression of DBI-1 cDNA in IGF-IR transformed
mouse cells compromised the mitogenic response to
IGF-1 and interfered with anchorage-independent
growth.
Oncogenesis
Downregulation of DICE1 mRNA was detected in 7 of
8 non-small cell lung carcinoma cell lines by Northern
blot analysis. Microdissected non-small cell lung
carcinomas showed reduced or absent expression of
DICE1
mRNA
by
RT-PCR.
Promoter
hypermethylation was found in tumour cells with
downregulated DICE1 expression. Aberrantly sized
transcripts were detected in two non-small cell lung
carcinoma cell lines. A reduced DICE1 expression was
also observed in prostate cancer cell lines DU145 and
LNCaP by real-time RT-PCR. DICE1 promoter
hypermethylation was detected in 6 of 10
microdissected prostate cancer samples. Ectopic
expression of DICE1 cDNA inhibited colony formation
of human non-small cell lung carcinoma cell lines and
prostate carcinoma cell lines and suppressed
anchorage-independent growth of IGF-IR transformed
mouse cells.
Wieland I, Röpke A, Stumm M, Sell C, Weidle UH, Wieacker
PF. Molecular characterization of the DICE1 (DDX26) tumor
suppressor gene in lung carcinomas. Oncol Res 2001;12:491500.
Whittaker CA and Hynes RO. Distribution and evolution of von
willebrand/integrin a domains: widely dispersed domains with
roles in cell adhesion and elsewhere. Mol Biol Cell
2002;13:3369-3387. (Review).
Li WJ, Hu N, Su H, Wang C, Goldstein AM, Wang Y, EmmertBuck MR, Roth MJ, Guo WJ, Taylor PR. Allelic loss on
chromosome 13q14 and mutation in deleted in cancer 1 gene
in esophageal squamous cell carcinoma. Oncogene
2003;22:314-318.
Wieland I, Sell C, Weidle UH, Wieacker P. Ectopic expression
of DICE1 suppresses tumor cell growth. Oncol Rep
2004;12:207-211.
Baillat D, Hakimi MA, Näär AM, Shilatifard A, Cooch N,
Shiekhattar R. Integrator, a multiprotein mediator of small
nuclear RNA processing, associates with the C-terminal repeat
of RNA polymerase II. Cell 2005;123:265-276.
Hernándes M, Papadopoulos N, Almeida TA. Absence of
mutations in DICE1/DDX26 gene in human cancer cell lines
with frequent 13q14 deletions. Cancer Genet Cytogenet
2005;163:91-92.
Röpke A, Buthz P, Böhm M, Seger J, Wieland I, Allhoff EP,
Wieacker P. Promoter CpG hypermethylation downregulates
DICE1
expression
in
prostate
cancer.
Oncogene
2005;24:6667-6675.
Han SM, Lee TH, Mun Jy, Kim MJ, Kritikou EA, Lee SJ, Han
SS, Hengartner MO, Koo HS. Deleted in cancer 1 (DICE1) is
an essential protein controlling the topology of the inner
mitochondrial membrane in C. elegans. Development
2006;133:3597-3606.
This article should be referenced as such:
Wieland I. INTS6 (integrator complex subunit 6). Atlas Genet
Cytogenet Oncol Haematol.2007;11(3):165-166.
Atlas Genet Cytogenet Oncol Haematol. 2007;11(3)
166
Atlas of Genetics and Cytogenetics
in Oncology and Haematology
OPEN ACCESS JOURNAL AT INIST-CNRS
Gene Section
Short Communication
LDB1 (LIM domain binding 1)
Takeshi Setogawa, Testu Akiyama
Laboratory of Molecular and Genetic Information, Institute for Molecular and Cellular Biosciences, The
University of Tokyo, 1-1-1 Yayoi, Bunkyo-ku, Tokyo 113-0032, Japan
Published in Atlas Database: November 2006
Online updated version: http://AtlasGeneticsOncology.org/Genes/LDB1ID41135ch10q24.html
DOI: 10.4267/2042/38429
This work is licensed under a Creative Commons Attribution-Non-commercial-No Derivative Works 2.0 France Licence.
© 2007 Atlas of Genetics and Cytogenetics in Oncology and Haematology
mice displays multiple developmental defects that
reveal a requirement of Ldb1 gene during normal
development.
Identity
Hugo: LDB1
Other names: CLIM2; NLI
Location: 10q24
Implicated in
Oral squamous cell carcinoma
DNA/RNA
Oncogenesis
LDB1 and LMO4 are frequently detected in lessdifferentiated and metastasized squamous carcinoma,
and overexpressed at the carcinoma invasive front.
Description
7 kb; 11 exons.
Transcription
2292 nucleotides mRNA.
References
Protein
Agulnick AD, Taira M, Breen JJ, Tanaka T, Dawid IB, Westphal
H. Interactions of the LIM-domain-binding factor Ldb1 with LIM
homeodomain proteins. Nature 1996;384:270-272.
Description
Bach I, Carrière C, Ostendorff HP, Andersen B, Rosenfeld MG.
A family of LIM domain-associated cofactors confer
transcriptional synergism between LIM and Otx homeodomain
proteins. Genes Dev 1997;11:1370-1380.
375 amino acids; 42.8 kDa protein.
Expression
Widely expressed.
Jurata LW, Gill GN. Functional analysis of the nuclear LIM
domain interactor NLI. Mol Cell Biol 1997;17:5688-5698.
Localisation
Visvader JE, Mao X, Fujiwara Y, Hahm K, Orkin SH. The LIMdomain binding protein Ldb1 and its partner LMO2 act as
negative regulators of erythroid differentiation. Proc Natl Acad
Sci USA 1997;94:13707-13712.
Nuclear.
Function
Chen L, Segal D, Hukriede NA, Podtelejnikov AV, Bayarsaihan
D, Kennison JA, Ogryzko VV, Dawid IB, Westphal H. Ssdp
proteins interact with the LIM-domain-binding protein Ldb1 to
regulate development. Proc Natl Acad Sci USA
2002;99:14320-14325.
LDB1 is a nuclear protein that contains an N-terminal
dimerization domain and a C-terminal LIM interaction
domain (LID). LDB1 binds to LIM-homeodomain
(LIM-HD) and LIM-only (LMO) proteins. It acts as an
adaptor protein that mediates interactions between
different classes of transcription factors and their
cofactors. LDB1 forms a complex with LKB1, LMO4,
and GATA-6. The tumor suppressor LKB1 is mutated
in Peutz-Jeghers syndrome and various sporadic
cancers. A complex containing LDB1, LKB1, LMO4,
and GATA-6 induces cyclin-dependent kinase inhibitor
p21 expression. Targeted deletion of the Ldb1 gene in
Atlas Genet Cytogenet Oncol Haematol. 2007;11(3)
Matthews JM, Visvader JE. LIM-domain-binding protein 1: a
multifunctional cofactor that interacts with diverse proteins.
EMBO Rep 2003;4:1132-1137. (Review).
Mizunuma H, Miyazawa J, Sanada K, Imai K. The LIM-only
protein, LMO4, and the LIM domain-binding protein, LDB1,
expression in squamous cell carcinomas of the oral cavity. Br J
Cancer 2003;88:1543-1548.
Mukhopadhyay M, Teufel A, Yamashita T, Agulnick AD, Chen
L, Downs KM, Schindler A, Grinberg A, Huang SP, Dorward D,
167
LDB1 (LIM domain binding 1)
Setogawa T, Akiyama T
Westphal H. Functional ablation of the mouse Ldb1 gene
results in severe patterning defects during gastrulation.
Development 2003;130:495-505.
This article should be referenced as such:
Setogawa T, Akiyama T. LDB1 (LIM domain binding 1). Atlas
Genet Cytogenet Oncol Haematol.2007;11(3):167-168.
Setogawa T, Shinozaki-Yabana S, Masuda T, Matsuura K,
Akiyama T. The tumor suppressor LKB1 induces p21
expression in collaboration with LMO4, GATA-6, and Ldb1.
Biochem Biophys Res Commun 2006;343:1186-1190.
Atlas Genet Cytogenet Oncol Haematol. 2007;11(3)
168
Atlas of Genetics and Cytogenetics
in Oncology and Haematology
OPEN ACCESS JOURNAL AT INIST-CNRS
Gene Section
Review
MSH6 (mutS homolog 6 (E. Coli))
Sreeparna Banerjee
Department of Biology, Middle East Technical University, Ankara 06531, Turkey
Published in Atlas Database: November 2006
Online updated version: http://AtlasGeneticsOncology.org/Genes/MSH6ID344ch2p16.html
DOI: 10.4267/2042/38430
This work is licensed under a Creative Commons Attribution-Non-commercial-No Derivative Works 2.0 France Licence.
© 2007 Atlas of Genetics and Cytogenetics in Oncology and Haematology
of 23.8 kilo bases. MSH6 has 10 exons, the sizes being
347, 197, 170, 2545, 266, 119, 89, 155, 200 and 176
bps.
Identity
Hugo: MSH6
Other names: GTBP; HSAP; HNPCC5
Location: 2p16
Local order: Genes flanking MSH6 in centromere to
telomere direction on 2p16 are:
HTLF (2p22-p16) (human T-cell leukemia virus
enhancer factor).
FBXO11 (2p16.3) (F-box protein 11).
MSH6 (2p16) (mutS homolog 6 (E. coli)).
LOC285053 (2p16.3) (similar to ribosomal protein
L18a).
KCNK12 (2p22-p21) (potassium channel, subfamily K,
member 12).
MSH2 (2p22-p21) (mutS homolog 2, colon cancer,
nonpolyposis type 1 (E. coli)).
Transcription
Human MSH6 gene is transcriptionally upregulated 2.5
fold at late G1/early S phase while the amount of
protein remains unchanged during the whole cell cycle.
The promoter region has a high GC content, as well as
multiple start sites. Sequence analysis of 3.9 kb of the
5'-upstream region of the MSH6 gene revealed the
absence of TATAA- or CAAT-boxes. Seven consensus
binding sequences for the ubiquitous transcription
factor Sp1 were found in the promoter region. This
factor is implicated in positioning the RNA polymerase
II complex at the transcriptional start sites of promoters
lacking TATA- and CAAT-boxes. The proximal
promoter region of MSH6 gene also contains several
consensus binding sites of the embryonic TEA domaincontaining factor ETF. This transcription factor has
also been reported to stimulate transcription from
promoters lacking the TATA box. In addition, the
trancription of MSH6 gene is downregulated by CpG
methylation of the promoter region.
Three common polymorphic variants (-557 T G, -448
G A, and -159 C T) of the MSH6 promoter have been
identified in which different Sp1 sites were inactivated
by single-nucleotide polymorphisms (SNPs) resulting
in altered promoter activity.
DNA/RNA
Note: The genes for MSH2 and MSH6 which form the
major mismatch recognition MutSalpha complex
functional in the mismatch repair (MMR) pathway are
located within 1 Mb of each other. MSH2 and MSH6
may have been produced by duplication of a primordial
mutS repair gene.
Description
MSH6 gene maps to NC_000002.10 and spans a region
Exons are represented by gray boxes (in scale) with exon numbers on the bottom. The arrows show the ATG and the stop codons
respectively.
Atlas Genet Cytogenet Oncol Haematol. 2007;11(3)
169
MSH6 (mutS homolog 6 (E. Coli))
Banerjee S
S.cerevisiae: MSH6 (Mismatch repair protein).
A.thaliana: MSH6 (MSH6).
Pseudogene
No pseudogene has been reported for the MSH6 gene.
Mutations
Protein
Note: The MSH6 gene plays a role in the development
of inherited cancers, especially the colorectum and
endometrial cancers.
Note: Eukaryotic MutSalpha is a heterodimer of the
100-kDa MSH2 and the 160-kDa MSH6 that
participates in the mismatch repair pathway. The
proteins are required for single base and frameshift
mispair specific binding, a result consistent with the
finding that tumour-derived cell lines devoid of either
protein have a mutator phenotype.
Germinal
MSH6 germline mutations have variable penetration.
Atypical hereditary non polyposis colorectal cancer
(HNPCC) can result from germline mutations in
MSH6; however, disease-causing germline mutations
of MSH6 are rare in HNPCC and HNPCC-like
families. Other studies have indicated that germline
MSH6 mutations may contribute to a subset of earlyonset colorectal cancer.
Description
The MSH6 protein maps to NP_000170 and has 1360
amino acids. The molecular weight is 152786 Da. The
protein contains a highly conserved helix-turn-helix
domain associated with a Walker-A motif (an adenine
nucleotide and magnesium binding motif) with ATPase
activity.
The breast cancer 1 gene (BRCA1) product is part of a
large multisubunit protein complex of tumor
suppressors, DNA damage sensors, and signal
transducers. This complex is called BASC, for
'BRCA1-associated genome surveillance complex and
the mismatch repair protein MSH6 was found to be a
part of this complex.
Somatic
The involvement of somatic or epigenetic inactivation
of hMSH6 is rare in colorectal cancer and missense
mutations in MSH6 are often clinically innocuous or
have a low penetrance. However, somatic mutations of
MSH6 have been shown to confer resistance to
alkylating agents such as temozolomide in malignant
gliomas in vivo. This concurrently results in
accelerated mutagenesis in resistant clones as a
consequence of continued exposure to alkylating agents
in the presence of defective mismatch repair.
Therefore, when MSH6 is inactivated in gliomas, there
is a change in status of the alkylating agents from
induction of tumour cell death to promotion of
neoplastic progression.
Localisation
The subcellular localisation of MSH6 is the nucleus.
Function
hMSH6 gene product with hMSH2, hMSH3 gene
products play role in strand specific repair of DNA
replication errors. Studies show that hMSH2-hMSH6
complex functions in the recognition step of the repair
of base-base mismatches or single frameshifts.
The ADP/ATP binding domain of the heterodimer and
the associated ATPase activity function to regulate
mismatch binding as a molecular switch. Both MSH2
and MSH6 can simultaneously bind ATP. The MSH6
subunit contains the high-affinity ATP binding site and
MSH2 contains a high-affinity ADP binding site.
Stable binding of ATP to MSH6 results in a decreased
affinity of MSH2 for ADP, and binding to mispaired
DNA stabilizes the binding of ATP to MSH6. Mispair
binding encourages a dual-occupancy state with ATP
bound to Msh6 and Msh2; following which there is a
hydrolysis-independent sliding along DNA. Subsequent
steps result in the excision of the mispaired region
followed by DNA synthesis and ligation.
Implicated in
Hereditary non polyposis colorectal
cancer
Disease
Mutations in the mismatch repair genes MSH2, MSH6,
MLH1 and PMS2 results in hereditary non polyposis
colorectal cancer (HNPCC, Lynch syndrome).
Individuals predisposed to this syndrome have
increased lifetime risk of developing colorectal,
endometrial and other cancers. The resulting mismatch
repair deficiency leads to microsatellite instability
which is the hallmark of tumors arising within this
syndrome, as well as a variable proportion of sporadic
tumors.
Clinically, HNPCC can be divided into two subgroups:
Type I: a young onset age for hereditary colorectal
cancer, and carcinoma of the proximal colon.
Type II: patients are susceptible to cancers in tissues
such as the colon, uterus, ovary, breast, stomach, small
intestine and skin.
Diagnosis of classical HNPCC is based on the
Amsterdam criteria:
Homology
H.sapiens: MSH6 (mutS homolog 6 (E. coli)).
C.familiaris: LOC474585 (similar to mutS homolog 6).
M.musculus: Msh6 (mutS homolog 6 (E. coli)).
C.elegans: msh-6 (MSH (MutS Homolog) family).
S.pombe: SPCC285.16c (hypothetical protein).
Atlas Genet Cytogenet Oncol Haematol. 2007;11(3)
170
MSH6 (mutS homolog 6 (E. Coli))
Banerjee S
- 3 or more relatives affected by colorectal cancer, one
a first degree relative of the other two;
- 2 or more generation affected;
- 1 or more colorectal cancers presenting before 50
years of age; exclusion of hereditary polyposis
syndromes.
References
Palombo, F.; Gallinari, P.; Iaccarino, I.; Lettieri, T.; Hughes, M.;
D'Arrigo, A.; Truong, O.; Hsuan, J. J.; Jiricny, J. GTBP, a 160kilodalton protein essential for mismatch-binding activity in
human cells. Science 1995;268:1912-1914.
Papadopoulos N, Nicolaides NC, Liu B, Parsons R, Lengauer
C, Palombo F, D'Arrigo A, Markowitz S, Willson JK, Kinzler
KW, et al. Mutations of GTBP in genetically unstable cells.
Science 1995;268(5219):1915-1917.
Turcot Syndrome
Disease
Turcot syndrome is a condition whereby central
nervous system malignant tumours are associated with
familial colorectal cancer. A homozygous mutation in
MSH6 has been reported in a family with childhoodonset brain tumour, lymphoma, colorectal cancer, and
neurofibromatosis type 1 phenotype.
Acharya S, Wilson T, Gradia S, Kane MF, Guerrette S,
Marsischky GT, Kolodner R, Fishel R. hMSH2 forms specific
mispair-binding complexes with hMSH3 and hMSH6. Proc Natl
Acad Sci USA 1996;93(24):13629-13634.
Gradia, S.; Acharya, S.; Fishel, R. The human mismatch
recognition complex hMSH2-hMSH6 functions as a novel
molecular switch. Cell 1997;91(7):995-1005.
Gradia S, Subramanian D, Wilson T, Acharya S, Makhov A,
Griffith J, Fishel R. hMSH2-hMSH6 forms a hydrolysisindependent sliding clamp on mismatched DNA. Mol Cell
1999;3(2):255-261.
Colorectal cancer
Disease
Mutations in four mismatch repair genes MSH2,
MLH1, MSH6, and PMS2, have been convincingly
linked to susceptibility of hereditary nonpolyposis
colorectal cancer (HNPCC)/Lynch syndrome. Of the
500 different HNPCC-associated MMR gene mutations
known, approximately 10% are associated with
mutations in the MSH6 gene.
Charames GS, Millar AL, Pal T, Narod S, Bapat B. Do MSH6
mutations contribute to double primary cancers of the
colorectum and endometrium?. Hum Genet 2000;107(6):623629.
Wang Y, Cortez D, Yazdi P, Neff N, Elledge SJ, Qin J. BASC,
a super complex of BRCA1-associated proteins involved in the
recognition and repair of aberrant DNA structures. Genes Dev
2000;14(8):927-939.
Endometrial cancer
Plaschke J, Krüger S, Pistorius S, Theissig F, Saeger HD,
Schackert HK. Involvement of hMSH6 in the development of
hereditary and sporadic colorectal cancer revealed by
immunostaining is based on germline mutations, but rarely on
somatic inactivation. Int J Cancer 2002;97(5):643-648.
Disease
Germline mutations in the MSH6 gene are often
observed in HNPCC-like families with an increased
frequency of endometrial cancer. Sequence analysis of
the MSH6 coding region revealed the presence of three
putative missense mutations in patients with atypical
family histories that do not meet HNPCC criteria.
MSH6 mutations may contribute to the etiology of
double primary carcinomas of the colorectum and
endometrium.
Suchy J, Kurzawski G, Jakubowska A, Lubiński J. Ovarian
cancer of endometrioid type as part of the MSH6 gene
mutation phenotype. J Hum Genet 2002;47(10):529-531.
Szadkowski M, Jiricny J. Identification and functional
characterization of the promoter region of the human MSH6
gene. Genes Chromosomes Cancer 2002;33(1):36-46.
Ovarian cancer
Gazzoli I, Kolodner RD. Regulation of the human MSH6 gene
by the Sp1 transcription factor and alteration of promoter
activity and expression by polymorphisms. Mol Cell Biol
2003;23(22):7992-8007.
Disease
Late-onset endometrioid type of ovarian cancer can be
linked to MSH6 germline mutations.
Peterlongo P, Nafa K, Lerman GS, Glogowski E, Shia J, Ye
TZ, Markowitz AJ, Guillem JG, Kolachana P, Boyd JA, Offit K,
Ellis NA. MSH6 germline mutations are rare in colorectal
cancer families. Int J Cancer 2003;107(4):571-579.
Lung cancer
Kariola R, Hampel H, Frankel WL, Raevaara TE, de la
Chapelle A, Nystrom-Lahti M. MSH6 missense mutations are
often associated with no or low cancer susceptibility. Br J
Cancer 2004;91(7):1287-1292.
Disease
Early onset lung cancer (before age 50) has been
associated with polymorphisms in the MSH6 gene.
Cadmium, an environmental and occupational
carcinogen associated with lung cancer development
was shown to inhibit the ATPase activity of MSH2MSH6 heterodimer.
Banerjee S, Flores-Rozas H. Cadmium inhibits mismatch
repair by blocking the ATPase activity of the MSH2-MSH6
complex. Nucleic Acids Res 2005;33(4):1410-1419.
Hegde MR, Chong B, Blazo ME, Chin LH, Ward PA,
Chintagumpala MM, Kim JY, Plon SE, Richards CS. A
homozygous mutation in MSH6 causes Turcot syndrome. Clin
Cancer Res 2005;11(13):4689-4693.
Breast cancer
Peltomäki P. Lynch
2005;4(3):227-232.
Disease
Mutations in the MSH6 gene are not usually connected
with breast cancer, even when associated with
endometrial or colorectal cancer.
Atlas Genet Cytogenet Oncol Haematol. 2007;11(3)
syndrome
genes.
Fam
Cancer
Rowley PT. Inherited susceptibility to colorectal cancer. Annu
Rev Med 2005;56:539-554.
Sánchez de Abajo A, de la Hoya M, Tosar A, Godino J,
Fernández JM, Asenjo JL, Villamil BP, Segura PP, Diaz-Rubio
171
MSH6 (mutS homolog 6 (E. Coli))
Banerjee S
E, Caldes T. Low prevalence of germline hMSH6 mutations in
colorectal cancer families from Spain. World J Gastroenterol
2005;11(37):5770-5776.
Jiricny J. The multifaceted mismatch-repair system. Nat Rev
Mol Cell Biol 2006;7(5):335-346.
Landi S, Gemignani F, Canzian F, Gaborieau V, Barale R,
Landi D, Szeszenia-Dabrowska N, Zaridze D, Lissowska J,
Rudnai P, Fabianova E, Mates D, Foretova L, Janout V,
Bencko V, Gioia-Patricola L, Hall J, Boffetta P, Hung RJ,
Brennan P. DNA repair and cell cycle control genes and the
risk
of
young-onset
lung
cancer.
Cancer
Res
2006;66(22):11062-11069.
Vahteristo P, Ojala S, Tamminen A, Tommiska J, Sammalkorpi
H, Kiuru-Kuhlefelt S, Eerola H, Aaltonen LA, Aittomäki K,
Nevanlinna H. No MSH6 germline mutations in breast cancer
families with colorectal and/or endometrial cancer. J Med
Genet 2005;42(4):e22.
Abdel-Rahman WM, Mecklin JP, Peltomäki P. The genetics of
HNPCC: application to diagnosis and screening. Crit Rev
Oncol Hematol 2006;58(3):208-220.
Mazur DJ, Mendillo ML, Kolodner RD. Inhibition of Msh6
ATPase activity by mispaired DNA induces a Msh2(ATP)Msh6(ATP) state capable of hydrolysis-independent movement
along DNA. Mol Cell 2006;22(1):39-49.
Barnetson RA, Tenesa A, Farrington SM, Nicholl ID,
Cetnarskyj R, Porteous ME, Campbell H, Dunlop MG.
Identification and survival of carriers of mutations in DNA
mismatch-repair genes in colon cancer. N Engl J Med
2006;354(26):2751-2763.
Pinto C, Veiga I, Pinheiro M, Mesquita B, Jeronimo C, Sousa
O, Fragoso M, Santos L, Moreira-Dias L, Baptista M, Lopes C,
Castedo S, Teixeira MR. MSH6 germline mutations in earlyonset colorectal cancer patients without family history of the
disease. Br J Cancer 2006;95(6):752-756.
Hunter C, Smith R, Cahill DP, Stephens P, Stevens C, Teague
J, Greenman C, Edkins S, Bignell G, Davies H, et al. A
hypermutation phenotype and somatic MSH6 mutations in
recurrent human malignant gliomas after alkylator
chemotherapy. Cancer Res 2006;66(8):3987-3991.
Atlas Genet Cytogenet Oncol Haematol. 2007;11(3)
This article should be referenced as such:
Banerjee S. MSH6 (mutS homolog 6 (E. Coli)). Atlas Genet
Cytogenet Oncol Haematol.2007;11(3):169-172.
172
Atlas of Genetics and Cytogenetics
in Oncology and Haematology
OPEN ACCESS JOURNAL AT INIST-CNRS
Gene Section
Mini Review
BARD1 (BRCA1 associated RING domain 1)
Irmgard Irminger-Finger
Biology of Aging Laboratory, Dept of Geriatrics and Dept of Gynecology and Obstetrics, Geneva University
and University Hospitals, 30, Bloulevard de la Cluse, CH-1211 Geneva, Switzerland
Published in Atlas Database: February 2007
Online updated version: http://AtlasGeneticsOncology.org/Genes/BARD1ID756ch2q35.html
DOI: 10.4267/2042/38431
This work is licensed under a Creative Commons Attribution-Non-commercial-No Derivative Works 2.0 France Licence.
© 2007 Atlas of Genetics and Cytogenetics in Oncology and Haematology
BARD1beta (rat testis);
BARD1delta (rat ovarian cancer cells);
BARD1delta (HeLa);
BARD1delta (rat ovarian cancer cells).
Identity
Hugo: BARD1
Other names: BRCA1-associated RING domain
protein 1
Location: 2q35
Local order: Antiparallel.
Transcription
Transcription start is 100 bp upstream of first ATG of
the BARD1 ORF. There a two 3’ends reported and
possibly two alternative polyadenylation sites. BARD1
is expressed in most proliferative tissues. Highest
expression in testis and spleen. No expression the
central nervous system.
DNA/RNA
Description
The gene spans 81 kb, composed of 11 exons.
Alternatively spliced isoforms are identified.
Insert known isoforms:
Pseudogene
No pseudogenes reported.
BARD1 structure is presented with RING finger (green) ankyrin repeats (ANK, blue) and BRCT domains (red). Positions of introns (in)
are indicated. Structures of splice variants are shown for BARD1beta from the rat (Feki et al., 2004), BARD1delta (Feki et al., 2005;
Tsuzuki et al., 2006).
Atlas Genet Cytogenet Oncol Haematol. 2007;11(3)
173
BARD1 (BRCA1 associated RING domain 1)
Irminger-Finger I
Mouse and human BARD1 protein sequences are shown schematically. RING finger domains (gren), Ankyrin repeats (ANK, blue),
BRCT domains (red), nulear localization signals (light blue). Homology between human and mouse BARD1 is indicated in perentage of
identical amino acids for structural regions.
Description
response
kinase
DNA-PK,
facilitating
p53
phosphorylation and stabilization. Thus BARD1 acts as
signaling molecule from genotoxic stress towards p53dependent apoptosis.
Human BARD1 777 amino acids; Structural motifs:
RING, 5 Ankyrin repeats, 2 BRCT domains.
Homology
Protein
BARD1 is homologous to BRCA1, regarding the Nterminal RING finger and the C-terminal BRCT
domains. Weak homology between BARD1 and
BRCA1 can be found throughout exon 1 to exon 4. and
from exon 7 through exon 11, with conserved intronexon junctions.
Expression
In the mouse BARD1 is expressed in most proliferative
tissues. Highest expression in testis and spleen, no
expression in nervous system.
During mouse development BARD1 is expressed in
early embryogenesis and declines after day 9.
Mutations
Localisation
During S-phase BARD1 localizes to nuclear dots.
Partially, BARD1 is also localized to the cytoplasm in
response to stress.
Note: Several mutations of BARD1 have been
identified in breast and ovarian cancers. Three
mutations have been reported associated with inherited
predisposition to breast and ovarian cancer.
Function
Germinal
BARD1 functions as heterodimer with BRCA1 as
ubiquitin ligase. Several targets of the BARD1-BRCA1
ubiquitin ligase have been identified and suggest its
implication in DNA repair, polyadenylation, cell cycle
control, and mitosis.
BARD1 acts as inducer of apoptosis, independently of
BRCA1, by binding to p53, and by binding to the stress
Germline mutations were reported for C557S and
Q564H.
Somatic
Several somatic mutation were reported in addition to
C557S and Q564H.
BARD1 mutations associated with cancer. Small mutations are not unambiguously identified as cancer causing mutations, long arrows
red labeled mutations are accepted as cancer associated. Blue indication maps germ line mutations. Q406R, might be cancer
associated.
Atlas Genet Cytogenet Oncol Haematol. 2007;11(3)
174
BARD1 (BRCA1 associated RING domain 1)
Irminger-Finger I
Irminger-Finger I, Soriano JV, Vaudan G, Montesano R,
Sappino AP. In vitro repression of Brca1-associated RING
domain gene, Bard1, induces phenotypic changes in mammary
epithelial cells. J Cell Biol 1998;143(5):1329-1339.
Implicated in
Breast and/or ovarian cancer
Thai TH, Du F, Tsan JT, Jin Y, Phung A, Spillman MA, Massa
HF, Muller CY, Ashfaq R, Mathis JM, Miller DS, Trask BJ, Baer
R, Bowcock AM. Mutations in the BRCA1-associated RING
domain (BARD1) gene in primary breast, ovarian and uterine
cancers. Hum Mol Genet 1998;7(2):195-202.
Note: Upregulated expression of truncated BARD1 in
epithelial cancers.
Prognosis
Upregulated BARD1 is correlated with poor prognosis
in breast and ovarian cancer.
Cytogenetics
No determined.
Hybrid/Mutated Gene
Not determined.
Abnormal Protein
No fusion proteins reported.
Dechend R, Hirano F, Lehmann K, Heissmeyer V, Ansieau S,
Wulczyn FG, Scheidereit C, Leutz A. The Bcl-3 oncoprotein
acts as a bridging factor between NF-kappaB/Rel and nuclear
co-regulators. Oncogene 1999;18(22):3316-3323.
Kleiman FE, Manley JL. Functional interaction of BRCA1associated BARD1 with polyadenylation factor CstF-50.
Science 1999;285(5433):1576-1579.
Gautier F, Irminger-Finger I, Grégoire M, Meflah K, Harb J.
Identification of an apoptotic cleavage product of BARD1 as an
autoantigen: a potential factor in the antitumoral response
mediated by apoptotic bodies. Cancer Res 2000;60(24):68956900.
Ovarian cancer
Brzovic PS, Rajagopal P, Hoyt DW, King MC, Klevit RE.
Structure of a BRCA1-BARD1 heterodimeric RING-RING
complex. Nat Struct Biol 2001;8(10):833-837.
Prognosis
Upregulated BARD1 is correlated with poor prognosis
in breast and ovarian cancer.
Hybrid/Mutated Gene
No.
Abnormal Protein
No fusion proteins reported.
Hashizume R, Fukuda M, Maeda I, Nishikawa H, Oyake D,
Yabuki Y, Ogata H, Ohta T. The RING heterodimer BRCA1BARD1 is a ubiquitin ligase inactivated by a breast cancerderived mutation. J Biol Chem 2001;276(18):14537-14540.
Kleiman FE, Manley JL. The BARD1-CstF-50 interaction links
mRNA 3' end formation to DNA damage and tumor
suppression. Cell 2001;104(5):743-53.
Irminger-Finger I, Leung WC, Li J, Dubois-Dauphin M, Harb J,
Feki A, Jefford CE, Soriano JV, Jaconi M, Montesano R,
Krause KH. Identification of BARD1 as mediator between
proapoptotic stress and p53-dependent apoptosis. Mol Cell
2001;8(6):1255-1266.
Lung cancer
Prognosis
Upregulated BARD1 is correlated with poor prognosis
in breast and ovarian cancer.
Hybrid/Mutated Gene
No.
Abnormal Protein
No fusion proteins reported.
Chen A, Kleiman FE, Manley JL, Ouchi T, Pan ZQ.
Autoubiquitination of the BRCA1*BARD1 RING ubiquitin
ligase. J Biol Chem 2002;277(24):22085-22092.
Chiba N, Parvin JD. The BRCA1 and BARD1 association with
the RNA polymerase II holoenzyme. Cancer Res
2002;62(15):4222-4228.
Fabbro M, Rodriguez JA, Baer R, Henderson BR. BARD1
induces BRCA1 intranuclear foci formation by increasing
RING-dependent BRCA1 nuclear import and inhibiting BRCA1
nuclear export. J Biol Chem 2002;277(24):21315-21324.
References
Wu LC, Wang ZW, Tsan JT, Spillman MA, Phung A, Xu XL,
Yang MC, Hwang LY, Bowcock AM, Baer R. Identification of a
RING protein that can interact in vivo with the BRCA1 gene
product. Nat Genet 1996;14(4):430-440.
Ghimenti C, Sensi E, Presciuttini S, Brunetti IM, Conte P,
Bevilacqua G, Caligo MA. Germline mutations of the BRCA1associated ring domain (BARD1) gene in breast and
breast/ovarian families negative for BRCA1 and BRCA2
alterations. Genes Chromosomes Cancer 2002;33(3):235-242.
Scully R, Anderson SF, Chao DM, Wei W, Ye L, Young RA,
Livingston DM, Parvin JD. BRCA1 is a component of the RNA
polymerase II holoenzyme. Proc Natl Acad Sci USA
1997;94(11):5605-5610.
Irminger-Finger I, Leung WC. BRCA1-dependent and
independent functions of BARD1. Int J Biochem Cell Biol
2002;34(6):582-587.
Scully R, Chen J, Ochs RL, Keegan K, Hoekstra M, Feunteun
J, Livingston DM. Dynamic changes of BRCA1 subnuclear
location and phosphorylation state are initiated by DNA
damage. Cell 1997;90(3):425-435.
Mallery DL, Vandenberg CJ, Hiom K. Activation of the E3
ligase function of the BRCA1/BARD1 complex by polyubiquitin
chains. EMBO J 2002;21(24):6755-6762.
Morris JR, Keep NH, Solomon E. Identification of residues
required for the interaction of BARD1 with BRCA1. J Biol
Chem 2002;277(11):9382-9386.
Ayi TC, Tsan JT, Hwang LY, Bowcock AM, Baer R.
Conservation of function and primary structure in the BRCA1associated RING domain (BARD1) protein. Oncogene
1998;17(16):2143-2148.
Ren B, Cam H, Takahashi Y, Volkert T, Terragni J, Young RA,
Dynlacht BD. E2F integrates cell cycle progression with DNA
repair, replication, and G(2)/M checkpoints. Genes Dev
2002;16(2):245-256.
Chen J, Silver DP, Walpita D, Cantor SB, Gazdar AF,
Tomlinson G, Couch FJ, Weber BL, Ashley T, Livingston DM,
Scully R. Stable interaction between the products of the
BRCA1 and BRCA2 tumor suppressor genes in mitotic and
meiotic cells. Mol Cell 1998;2(3):317-328.
Atlas Genet Cytogenet Oncol Haematol. 2007;11(3)
Spahn L, Petermann R, Siligan C, Schmid JA, Aryee DN,
Kovar H. Interaction of the EWS NH2 terminus with BARD1
175
BARD1 (BRCA1 associated RING domain 1)
Irminger-Finger I
links the Ewing's sarcoma gene to a common tumor
suppressor pathway. Cancer Res 2002;62(16):4583-4587.
development and tumorigenesis. Nature 2005;437(7055):147153.
Ishitobi M, Miyoshi Y, Hasegawa S, Egawa C, Tamaki Y,
Monden M, Noguchi S. Mutational analysis of BARD1 in
familial breast cancer patients in Japan. Cancer Lett
2003;200(1):1-7.
Hayami R, Sato K, Wu W, Nishikawa T, Hiroi J, Ohtani-Kaneko
R, Fukuda M, Ohta T. Down-regulation of BRCA1-BARD1
ubiquitin ligase by CDK2. Cancer Res 2005;65(1):6-10.
Kleiman FE, Wu-Baer F, Fonseca D, Kaneko S, Baer R,
Manley JL. BRCA1/BARD1 inhibition of mRNA 3' processing
involves targeted degradation of RNA polymerase II. Genes
Dev 2005;19(10):1227-1237.
McCarthy EE, Celebi JT, Baer R, Ludwig T. Loss of Bard1, the
heterodimeric partner of the Brca1 tumor suppressor, results in
early embryonic lethality and chromosomal instability. Mol Cell
Biol 2003;23(14):5056-5063.
Schüchner S, Tembe V, Rodriguez JA, Henderson BR.
Nuclear targeting and cell cycle regulatory function of human
BARD1. J Biol Chem 2005;280(10):8855-8861.
Westermark UK, Reyngold M, Olshen AB, Baer R, Jasin M,
Moynahan ME. BARD1 participates with BRCA1 in homologydirected repair of chromosome breaks. Mol Cell Biol
2003;23(21):7926-7936.
Starita LM, Horwitz AA, Keogh MC, Ishioka C, Parvin JD,
Chiba N. BRCA1/BARD1 ubiquitinate phosphorylated RNA
polymerase II. J Biol Chem 2005;280(26):24498-24505.
Choudhury AD, Xu H, Baer R. Ubiquitination and proteasomal
degradation of the BRCA1 tumor suppressor is regulated
during
cell
cycle
progression.
J
Biol
Chem
2004;279(32):33909-33918.
Irminger-Finger I, Busquets S, Calabrio F, Loópez-Soriano FJ,
Argilés JM. BARD1 content correlates with increased DNA
fragmentation associated with muscle wasting in tumourbearing rats. Oncol Rep 2006;15(6):1425-1458.
Fabbro M, Savage K, Hobson K, Deans AJ, Powell SN,
McArthur GA, Khanna KK. BRCA1-BARD1 complexes are
required for p53Ser-15 phosphorylation and a G1/S arrest
following ionizing radiation-induced DNA damage. J Biol Chem
2004;279(30):31251-31258.
Irminger-Finger I, Jefford CE. Is there more to BARD1 than
BRCA1?. Nat Rev Cancer 2006;6(5):382-391.
Joukov V, Groen AC, Prokhorova T, Gerson R, White E,
Rodriguez A, Walter JC, Livingston DM. The BRCA1/BARD1
heterodimer modulates ran-dependent mitotic spindle
assembly. Cell 2006;127(3):539-552.
Fabbro M, Schuechner S, Au WW, Henderson BR. BARD1
regulates BRCA1 apoptotic function by a mechanism involving
nuclear retention. Exp Cell Res 2004;298(2):661-673.
Karppinen SM, Barkardottir RB, Backenhorn K, Sydenham T,
Syrjäkoski K, Schleutker J, Ikonen T, Pylkäs K, Rapakko K,
Erkko H, Johannesdottir G, Gerdes AM, Thomassen M,
Agnarsson BA, Grip M, Kallioniemi A, Kere J, Aaltonen LA,
Arason A, Møller P, Kruse TA, Borg A, Winqvist R. Nordic
collaborative study of the BARD1 Cys557Ser allele in 3956
patients with cancer: enrichment in familial BRCA1/BRCA2
mutation-negative breast cancer but not in other malignancies.
J Med Genet 2006;43(11):856-862.
Feki A, Jefford CE, Durand P, Harb J, Lucas H, Krause KH,
Irminger-Finger I. BARD1 expression during spermatogenesis
is associated with apoptosis and hormonally regulated. Biol
Reprod 2004;71(5):1614-1624.
Jefford CE, Feki A, Harb J, Krause KH, Irminger-Finger I.
Nuclear-cytoplasmic translocation of BARD1 is linked to its
apoptotic activity. Oncogene 2004;23(20):3509-3520.
Karppinen SM, Heikkinen K, Rapakko K, Winqvist R. Mutation
screening of the BARD1 gene: evidence for involvement of the
Cys557Ser allele in hereditary susceptibility to breast cancer. J
Med Genet 2004;41(9):e114.
Morris JR, Solomon E. BRCA1 : BARD1 induces the formation
of conjugated ubiquitin structures, dependent on K6 of
ubiquitin, in cells during DNA replication and repair. Hum Mol
Genet 2004;13(8):807-817.
Stacey SN, Sulem P, Johannsson OT, Helgason A,
Gudmundsson J, Kostic JP, Kristjansson K, Jonsdottir T,
Sigurdsson H, Hrafnkelsson J, Johannsson J, Sveinsson T,
Myrdal G, Grimsson HN, Bergthorsson JT, Amundadottir LT,
Gulcher JR, Thorsteinsdottir U, Kong A, Stefansson K. The
BARD1 Cys557Ser variant and breast cancer risk in Iceland.
PLoS Med 2006;3(7):e217.
Rodriguez JA, Schüchner S, Au WW, Fabbro M, Henderson
BR. Nuclear-cytoplasmic shuttling of BARD1 contributes to its
proapoptotic activity and is regulated by dimerization with
BRCA1. Oncogene 2004;23(10):1809-1820.
Tsuzuki M, Wu W, Nishikawa H, Hayami R, Oyake D, Yabuki
Y, Fukuda M, Ohta T. A truncated splice variant of human
BARD1 that lacks the RING finger and ankyrin repeats. Cancer
Lett 2006;233(1):108-116.
Sato K, Hayami R, Wu W, Nishikawa T, Nishikawa H, Okuda
Y, Ogata H, Fukuda M, Ohta T. Nucleophosmin/B23 is a
candidate substrate for the BRCA1-BARD1 ubiquitin ligase. J
Biol Chem 2004;279(30):30919-30922.
Vahteristo P, Syrjäkoski K, Heikkinen T, Eerola H, Aittomäki K,
von Smitten K, Holli K, Blomqvist C, Kallioniemi OP,
Nevanlinna H. BARD1 variants Cys557Ser and Val507Met in
breast cancer predisposition. Eur J Hum Genet
2006;14(2):167-172.
Starita LM, Machida Y, Sankaran S, Elias JE, Griffin K,
Schlegel BP, Gygi SP, Parvin JD. BRCA1-dependent
ubiquitination of gamma-tubulin regulates centrosome number.
Mol Cell Biol 2004;24(19):8457-8466.
Wu JY, Vlastos AT, Pelte MF, Caligo MA, Bianco A, Krause
KH, Laurent GJ, Irminger-Finger I. Aberrant expression of
BARD1 in breast and ovarian cancers with poor prognosis. Int
J Cancer 2006;118(5):1215-1226.
Stark JM, Pierce AJ, Oh J, Pastink A, Jasin M. Genetic steps
of mammalian homologous repair with distinct mutagenic
consequences. Mol Cell Biol 2004;24(21):9305-9316.
Lu Y, Amleh A, Sun J, Jin X, McCullough SD, Baer R, Ren D,
Li R, Hu Y. Ubiquitination and Proteasome-Mediated
Degradation of BRCA1 and BARD1 During steroidogenesis in
Human
Ovarian
Granulosa
Cells.
Mol
Endocrinol
2007;21(3):651-663.
Choudhury AD, Xu H, Modi AP, Zhang W, Ludwig T, Baer R.
Hyperphosphorylation of the BARD1 tumor suppressor in
mitotic cells. J Biol Chem 2005;280(26):24669-24679.
Feki A, Jefford CE, Berardi P, Wu JY, Cartier L, Krause KH,
Irminger-Finger I. BARD1 induces apoptosis by catalysing
phosphorylation of p53 by DNA-damage response kinase.
Oncogene 2005;24(23):3726-3736.
This article should be referenced as such:
Irminger-Finger I. BARD1 (BRCA1 associated RING domain
1). Atlas Genet Cytogenet Oncol Haematol.2007;11(3):173176.
Grisendi S, Bernardi R, Rossi M, Cheng K, Khandker L,
Manova K, Pandolfi PP. Role of nucleophosmin in embryonic
Atlas Genet Cytogenet Oncol Haematol. 2007;11(3)
176
Atlas of Genetics and Cytogenetics
in Oncology and Haematology
OPEN ACCESS JOURNAL AT INIST-CNRS
Gene Section
Mini Review
BCL6 (B-Cell Lymphoma 6)
Stevan Knezevich
BC Cancer Research Centre (BCCRC), Vancouver, British Columbia, Canada
Published in Atlas Database: February 2007
Online updated version: http://AtlasGeneticsOncology.org/Genes/BCL6ID20.html
DOI: 10.4267/2042/38432
This article is an update of: Kerkaert JP. LAZ3 (lymphoma associated zinc finger on chromosome 3). Atlas Genet Cytogenet Oncol
Haematol.1999;3(1):1-2.
This work is licensed under a Creative Commons Attribution-Non-commercial-No Derivative Works 2.0 France Licence.
© 2007 Atlas of Genetics and Cytogenetics in Oncology and Haematology
Identity
Transcription
Hugo: BCL6
Other names: LAZ3 ( Lymphoma Associated Zinc
finger on chromosome 3); ZNF51 (Zinc Finger Protein
51)
Location: 3q27
Local order: gene orientation: telomere - 5' LAZ3 3' centromere.
3.8 kb mRNA.
Protein
Description
The protein product is 706 amino acids with an
estimated molecular weight of 78.8 kDa.
Expression
Normally expressed in germinal center B and T cells,
other lymphoid tissues, in skeletal muscle cells and in
keratinocytes.
Localisation
Nuclear paraspeckles/dots.
Function
The protein can bind to sequence specific DNA and
repress its transcription in addition to recruiting other
protein repressors. The DNA binding is mediated
through the consensus sequence: TTCCT(A/C)GAA
while the protein-protein interactions are mediated
through the BTB/POZ domain and it has been shown to
interact with other zinc finger proteins and corepressors
(including Histone Deacetylase 1 (HDAC1) and
Silencing Mediator of Retinoid and Thryoid Receptor 1
(SMRT1)). The carboxy terminus, on the other hand, is
responsible for sequence specific DNA binding through
its 6 zinc fingers.
BCL6 (3q27) - Courtesy Mariano Rocchi, Resources for
Molecular Cytogenetics. Laboratories willing to validate the
probes are welcome : contact [email protected].
DNA/RNA
Description
The gene is encoded by 11 exons that are located on
Chromosome 3q27 and is 24.3 kb. The 5’ portion
encodes for the BTB/POZ domain (broadcomplex/tramtrack/bric-a-brac/pox virus/zinc finger),
while the 3’ end encodes for 6 DNA binding zinc
fingers. The first ATG occurs in exon 3.
Atlas Genet Cytogenet Oncol Haematol. 2007;11(3)
Homology
BTB/POZ - Zinc Finger proteins (PLZF, HIC1, KUP,
BAZF, ttk (drosophila), BrC (drosophila)...).
177
BCL6 (B-Cell Lymphoma 6)
Knezevich S
Implicated in
normal BCL6 exon 2 splice acceptor site. In some cases
reciprocal chimeric transcripts driven by the 5'
regulatory region of BCL6 fused to the partner gene
coding region, have been characterised.
t(2;3)(p12;q27) the gene in 2p12 is IGK
t(3;3)(q25;q27) the gene in 3q25 is MBNL1
t(3;3)(q27;q27) the gene in 3q27 is ST6GAL1
t(3;3)(q27;q27) the gene in 3q27 is EIF4A2
t(3;3)(q27;q29) the gene in 3q29 is TFRC
t(3;4)(q27;p13) the gene in 4p13 is RHOH
t(3;6)(q27;p22) the gene in 6p22 is HIST1H4I
t(3;6)(q27;p21) the gene in 6p21 is PIM1
t(3;6)(q27;p21) the gene in 6p21 is SFRS3
t(3;6)(q27;p21) the gene in 6p21 is Histone H4
t(3;6)(q27;p12) the gene in 6p12 is HSP90AB1
t(3;6)(q27;q15) the gene in 6q15 is SNHG5
t(3;7)(q27;p12) the gene in 7p12 is IKZF1
t(3;8)(q27;q24.1) the gene in 8q24.1 is MYC
t(3;9)(q27;p11) the gene in 9p11 is GRHPR
t(3;11)(q27;q23) the gene in 11q23 is POU2AF1
t(3;12)(q27;p13) the gene in 12p13 is GAPDH
t(3;12)(q27;q12) the gene in 12q12 is LRMP
t(3;12)(q27;q23) the gene in 12q23 is NACA
t(3;13)(q27;q14) the gene in 13q14 is LCP1
t(3;14)(q27;q32) the gene in 14q32 is IGH
t(3;14)(q27;q32) the gene in 14q32 is HSP90AA1
t(3;16)(q27;p13) the gene in 16p13 is CIITA
t(3;16)(q27;p11) the gene in 16p11 is IL21R
t(3;19)(q27;q13) the gene in 19q13 is NAPA
t(3;22)(q27;q11) the gene in 22q11 is IGL
Abnormal Protein
No fusion protein.
3q27 rearrangements /NHL (non
Hodgkin lymphomas)
Disease
B cell non-Hodgkin Lymphoma (B-NHL) carry the
greatest number of translocations involving the BCL6
gene locus. Translocations are most commonly
detected within 15-40% of Diffuse Large B-Cell
Lymphomas (DLBCL), 6-15% of Follicular
Lymphomas (FL), and 50% of nodular lymphocyte
predominant Hodgkin Lymphomas.
Prognosis
Generally considered to be a better prognosis if there is
increased expression of BCL6. The mechanism by
which its expression is increased does not seem to
matter (ie different translocation partners increasing its
expression results in the same prognosis).
Cytogenetics
3q27 rearrangements/aberrations are diverse and
include:
translocations,
micro-deletions,
point
mutations and hypermutation. Approximately 50% of
3q27 translocations involves Ig genes at 14q32 (IgH),
2p12 (IgK) and 22q12 (IgL) (e.g. t(3;14)(q27;q32).
Less than half (~40%) include a variety of other
chromosomal regions (1q21, 2q21, 4p11, 5q31, 6p21,
7p12, 8q24, 9p13, 11q13, 11q23, 12q11, 13q14-21,
14q11, 15q21, 16p11...). In addition, there are frequent
bi-allelic alterations (translocation and deletion or
mutation on the non-translocated allele).
Hybrid/Mutated Gene
Hybrid gene and transcripts are formed following
promoter substitution between BCL6 and its different
partners. Chimeric transcripts are generally detected
containing the 5' part of the gene partner fused to the
Atlas Genet Cytogenet Oncol Haematol. 2007;11(3)
Breakpoints
Note: Clustered in a 3,3kb EcoRI fragment (MTC)
includind exon 1A and intron 1.
178
BCL6 (B-Cell Lymphoma 6)
Knezevich S
2p12 (IgK)
22q11 (IgL)
3q25 (MBNL1)
19q13 (NAPA)
3q27 (ST6GAL1)
16p13 (CIITA)
3q28 (EIF4A2)
3q29 (TFRC)
16p11 (IL21R)
4p13 (RHOH)
14q32 (HSP90AA1)
3q27 (BCL6)
14q32 (IgH)
6p22 (HIST1H4I)
13q14 (LCP1)
6p21 (HSP90AB1)
12q23 (NACA)
6p21 (PIM1)
12p13 (GAPDH)
12p12 (LRMP)
6p21 (SFRS3)
11q23 (POU2AF1)
6q15 (SNHG5)
9q12 (GRHPR)
? 8q24 (? MY C)
7p12 (IKZF1)
BCL6 and 25 partners and/or recurrent translocations. Editor 09/2001; last update 03/2007
Note: HSP89A, f ound in Xu et al. 2000, is possibly HSPCA, but may be another heat shock protein.
References
Niitsu N, Okamoto M, Nakamura N, Nakamine H, Aoki S,
Hirano M, Miura I. Prognostic impact of chromosomal alteration
of 3q27 on nodal B-cell lymphoma: Correlation with histology,
immunophenotype, karyotype, and clinical outcome in 329
consecutive patients. Leuk Res 2006;.
Kerckaert JP, Deweindt C, Tilly H, Quief S, Lecocq G, Bastard
C. LAZ3, a novel zinc-finger encoding gene, is disrupted by
recurring chromosome 3q27 translocations in human
lymphomas. Nat Genet 1993;5(1):66-70.
Ohno H. Pathogenetic and clinical implications of nonimmunoglobulin ; BCL6 translocations in B-cell non-Hodgkin's
lymphoma. J Clin Exp Hematop 2006;46(2):43-53. (Review).
Ye BH, Lista F, Lo Coco F, Knowles DM, Offit K, Chaganti RS,
Dalla-Favera R. Alterations of a zinc finger-encoding gene,
BCL-6,
in
diffuse
large-cell
lymphoma.
Science
1993;262(5134):747-750.
Tapinassi C, Micucci C, Lahortiga I, Malazzi O, Gasparini P,
Gorosquieta A, Odero MD, Belloni E. A novel t(2;3)(p11;q27) in
a case of follicular lymphoma. Cancer Genet Cytogenet
2007;172(1):70-73.
Miki T, Kawamata N, Hirosawa S, Aoki N. Gene involved in the
3q27 translocation associated with B-cell lymphoma, BCL5,
encodes
a
Krüppel-like
zinc-finger
protein.
Blood
1994;83(1):26-32.
Wang HY, Bossler AD, Schaffer A, Tomczak E, DiPatri D,
Frank DM, Nowell PC, Bagg A. A novel t(3;8)(q27;q24.1)
simultaneously involving both the BCL6 and MYC genes in a
diffuse large B-cell lymphoma. Cancer Genet Cytogenet
2007;172(1):45-53.
Chen YW, Hu XT, Liang AC, Au WY, So CC, Wong ML, Shen
L, Tao Q, Chu KM, Kwong YL, Liang RH, Srivastava G. High
BCL6 expression predicts better prognosis, independent of
BCL6 translocation status, translocation partner, or BCL6
deregulating mutations, in gastric lymphoma. Blood 2006;108
(7):2373-2383.
This article should be referenced as such:
Knezevich S. BCL6 (B-Cell Lymphoma 6). Atlas Genet
Cytogenet Oncol Haematol.2007;11(3):177-179.
Keller CE, Nandula S, Vakiani E, Alobeid B, Murty VV, Bhagat
G. Intrachromosomal rearrangement of chromosome 3q27: an
under recognized mechanism of BCL6 translocation in B-cell
non-Hodgkin lymphoma. Hum Pathol 2006;37(8):1093-1099.
Atlas Genet Cytogenet Oncol Haematol. 2007;11(3)
179
Atlas of Genetics and Cytogenetics
in Oncology and Haematology
OPEN ACCESS JOURNAL AT INIST-CNRS
Gene Section
Mini Review
BRD4 (bromodomain containing 4)
Anna Collin
Department of Clinical Genetics, Lund University Hospital, 221 85 Lund, Sweden
Published in Atlas Database: February 2007
Online updated version: http://AtlasGeneticsOncology.org/Genes/BRD4ID837ch19p13.html
DOI: 10.4267/2042/38433
This work is licensed under a Creative Commons Attribution-Non-commercial-No Derivative Works 2.0 France Licence.
© 2007 Atlas of Genetics and Cytogenetics in Oncology and Haematology
Function
Identity
A striking feature of BRD4 is its association with
euchromatic regions of mitotic chromosomes. By this
association, the protein exerts its function as regulator
of cell cycle progression from G2 to M but also in the
G1 to S transition. It has also been suggested that the
association of BRD4 to chromatin is important for the
transmission of a transcriptional memory during cell
division.
Hugo: BRD4
Other names: HUNK1; MCAP
Location: 19p13
Location_base_pair: position 15252262-15209302 on
the chromosome 19 genomic sequence.
DNA/RNA
Description
Implicated in
The gene consists of 20 exons that span approximately
43 kb of genomic DNA in the centromere-to-telomere
orientation. The translation initiation codon and stop
codon are located to exon 2 and exon 20, respectively.
Carcinoma with t(15;19)(q14;p13)
translocation.
Prognosis
Carcinoma with t(15;19) translocation is invariably
fatal with a rapid clinical course when located to the
midline thoracic, head and neck structures. One tumor,
displaying the cytogenetic and molecular cytogenetic
features of carcinoma with t(15;19) translocation, but
located to the iliac bone, has been reported as
successfully cured.
Cytogenetics
t(15;19)(q14;p13) [reported breakpoints: t(15;19)(q1115;p13)].
Hybrid/Mutated Gene
The t(15;19)(q14;p13) results in a BRD4-NUT
chimeric gene where exon 10 of BRD4 is fused to exon
2 of NUT.
Abnormal Protein
The BRD4-NUT fusion protein is composed of the Nterminal of BRD4 (amino acids 1-720 out of 1372) and
almost the entire protein sequence of NUT (amino
acids 6-1127). The N-terminal of BRD4 includes
bromodomains 1 and 2 and other, less well
characterized functional domains.
Transcription
Two isoforms of BRD4 have been reported. The 'BRD4
long isoform' corresponds to the ordinary full length
transcript while the 'BRD4 short isoform' corresponds
to an alternative splicing variant lacking exons 12-20.
The 'BRD4 long variant' encodes a 6.0 kb transcript
and the 'BRD4 short variant' encodes a 4.4 kb
transcript.
Protein
Description
BRD4 belongs to the BET subgroup of the
bromodomain
superfamily
and
contains
2
bromodomains and a conserved ET-domain.
The open reading frame encodes a 1362 amino acid
protein with a molecular weight of 200 kDa.
Expression
Northen blot analysis has shown an ubiquitous normal
expression of both BRD4 isoforms.
Localisation
Nuclear.
Atlas Genet Cytogenet Oncol Haematol. 2007;11(3)
180
BRD4 (bromodomain containing 4)
Collin A
replication factor C and inhibits progression to S phase. Mol
Cell Biol 2002;22:6509-6520.
Oncogenesis
It has been suggested that the oncogenic effect of the
NUT-BRD4 fusion is caused not only by the abnormal
regulation of NUT by BRD4 promoter elements but
also by the consequent ectopic expression of NUT in
non-germinal tissues.
Dey A, Chitsaz F, Abbasi A, Misteli T, Ozato K. The double
bromodomain protein Brd4 binds to acetylated chromatin
during interphase and mitois. Proc Natl Acad Sci USA
2003;100:8758-8763.
French CA, Miyoshi I, Kubonishi I, Grier HE, Perez-Atayde AR,
Fletcher JA. BRD4-NUT fusion oncogene: a novel mechanism
in aggressive carcinoma. Cancer Res 2003;63:304-307.
Breakpoints
French CA, Kutok JL, Faquin WC, Toretsky JA, Antonescu CR,
Griffin CA, Nose V, Vargas SO, Moschovi M, TzortzatouStathopoulo F, Miyoshi I, Perez-Atayde AR, Aster JC, Fletcher
JA. Midline carcinoma of children and young adults with NUT
rearrangement. J Clin Oncol 2004;22:4135-4139.
Note: The vast majority of reported 19p breakpoints
were assigned to band 19p13, the exception being the
cytogenetic interpretation of a 19q13 breakpoint
reported once. The reported breakpoints on
chromosome 15 have varied (15q11-q15).
Marx A, French CA, Fletcher JA. Carcinoma with t(15;19)
translocation. In:World Health Organization classification of
tumours. Pathology and genetics of tumours of the lung,
thymus, pleura and heart. Travis WD, Brambilla E, MullerHermelink K, Harris CC, editors. Oxford University Press 2004.
pp185-186.
References
Kees UR, Mulcahy MT, Willoughby MLN. Intrathoracic
carcinoma in an 11-year-old girl showing a translocation
t(15;19). Am J Pediatr Hematol Oncol 1991;13:459-464.
You J, Croyle JL, Nishimura A, Ozato K, Howley P. Interaction
of the bovine papillomavirus E2 protein with Brd4 tethers the
viral DNA to host mitotic chromosomes. Cell 2004;117:349360.
Dey A, Ellenberg J, Farina A, Coleman AE, Maruyama T,
Sciortino S, Lippincott-Schwartz J, Ozato K. A bromodomain
protein MCAP, associates with mitotic chromosomes and
affects G2-to-M transition. Mol Cell Biol 2000;20:6537-6549.
Engleson J, Soller M, Panagopoulos I, Dahlén A, Dictor M,
Jerkeman M. Midline carcinoma with t(15;19) and BRD4-NUT
fusion oncogene in a 30-year-old female with response to
docetaxel and radiotherapy. BMC Cancer 2006;6:69.
Florence B, Faller DV. You bet-cha: a novel family of
transcriptional regulators. Front Biosci 2001;6:D1008-1018.
French CA, Miyoshi I, Aster JC, Kubonishi I, Kroll TG, Dal Cin
P, Vargas SO, Perez-Atayde AR, Fletcher JA. BRD4
bromodomain gene rearrangement in aggressive carcinoma
with translocation t(15;19). Am J Pathol 2001;159:1987-1992.
Mertens F, Wiebe T, Adlercreutz C, Mandahl N, French CA.
Successful treatment of a child with t(15;19)-positive tumor.
Pediatr Blood Cancer 2006.
Maruyama T, Farina A, dey A, Cheong JH, Bermudez VP,
Tamura T, Sciortino S, Shuman J, Hurwitz J, Ozato K. A
mammalian bromodomein protein, Brd4, interacts with
This article should be referenced as such:
Collin A. BRD4 (bromodomain containing 4). Atlas Genet
Cytogenet Oncol Haematol.2007;11(3):180-181.
Atlas Genet Cytogenet Oncol Haematol. 2007;11(3)
181
Atlas of Genetics and Cytogenetics
in Oncology and Haematology
OPEN ACCESS JOURNAL AT INIST-CNRS
Gene Section
Review
ENPP2 (ectonucleotide
pyrophosphatase/phosphodiesterase 2)
Mary L Stracke, Timothy Clair
Laboratory of Pathology, National Cancer Institute, National Institutes of Health, Bldg 10, Rm 2A33, MSC
1500, 9000 Rockville Pike, Bethesda, MD 20892
Published in Atlas Database: February 2007
Online updated version: http://AtlasGeneticsOncology.org/Genes/ENPP2ID40455ch8q24.html
DOI: 10.4267/2042/38434
This work is licensed under a Creative Commons Attribution-Non-commercial-No Derivative Works 2.0 France Licence.
© 2007 Atlas of Genetics and Cytogenetics in Oncology and Haematology
exon 26; however, there is a 152 bp exon (exon 12) that
is alternatively spliced and is included primarily in
neurally derived tissues.
Identity
Hugo: ENPP2
Other names: Autotaxin; ATX; NPP2; PD1alpha;
lysophospholipase D; PDNP2
Location: 8q24.12
Local order: Telomeric to NOV (nephroblastoma
overxpressed gene), centromeric to TAF2; colocalized
with pseudogene CYCSP23.
Transcription
The mRNA for ENPP2 is 3276 bp with exon 12 and
3120 bp without it. The ENPP2 promoter is reported to
have four SP1 sites as well as binding sites for NFAT
and NF-kappaB but no TATA or CAAT boxes. The
only transcription factor that has been proven to
increase
ENPP2
protein
expression
is
NFATC2/NFAT1, after release of alpha6beta4 from
hemidesmosomes in a breast cancer cell line. A number
of growth factors have been found to stimulate ENPP2
protein expression, while several inflammatory
cytokines have been reported to inhibit expression.
DNA/RNA
Note: mRNA length 3276 or 3120 bp, depending upon
alternate splicing.
Description
The ENPP2 gene is 81,754 bp in length and is
composed of 26 exons. Part of exon 1 and 26 are
untranslated (UTR); translation extends from the
remainder of exon 1 through the proximal portion of
Pseudogene
CYCSP23
ENPP2 Gene: Intron-exon organization of ENPP2.
Atlas Genet Cytogenet Oncol Haematol. 2007;11(3)
182
ENPP2 (ectonucleotide pyrophosphatase/phosphodiesterase 2)
Stracke ML, Clair T
ENPP2 Protein (NPP2/ATX): Organization of domains and other critical elements within ENPP2.
plasma lysophospholipase D activity, hydrolyzing
lysophosphatidylcholine into lysophosphatidic acid as
well as cyclic phosphatidic acid. NPP2 also hydrolyzes
sphingosylphosphorylcholine
into
sphingosine-1phosphate; however, NPP2 is not a major source of
sphingosine-1-phosphate in plasma. The production of
lysophosphatidic acid is thought to account for many of
the physiological and pathological roles of ENPP2.
Both enzymatic activities of NPP2 share a common
catalytic domain. Like other members of the NPP
family, NPP2 is a metallo-enzyme with binding sites
for 2 metal atoms coordinated by three critical
histidines (H316, H360, and H475) and associated
aspartates (D172, D312, and D359). T210 is
nucleotidylated
during
the
nucleotide
pyrophosphatase/phosphodiesterase reaction and is
essential for hydrolysis of substrate during the
lysophospholipase D reaction as well.
Protein
Description
The ENPP2 protein, NPP2 or ATX, is an Nglycolsylated member of the ecto-nucleotide
pyrophosphatase and phosphodiesterase (NPP) family
of proteins. The NPP2 precursor contains 915 amino
acids, 105.2 KDa; and an alternately spliced variant is
863 amino acids, 99.0 KDa. The amino terminal signal
peptide sequence is cleaved at a signal peptidase site
between G27 and F28 to yield a secreted protein that
contains 888/836 amino acids, 102.3/96.9 KDa. NPP2
contains up to 3 ASN-linked glycosylation sites that
appear to be required for secretion as well as for
stabilization of its active conformation.
Expression
NPP2 is expressed in many tissues during development,
but it is critical for blood vessel maturation and
neurogenesis. Certain inflammatory cytokines and the
tumor suppressor CST6 downregulate ENPP2
expression, and some of the NPP2 products exert a
negative feedback on its expression. Conversely, a
number of growth factors as well as EBV infection (in
Hodgkin's lymphoma) upregulate ENPP2 expression.
Disruption of hemidesmosomes in breast cancer cells
releases alpha6beta4, which initiates a signaling
cascade that culminates in the activation of the
transcription factor NFAT1, which binds to the ENPP2
promoter
to
upregulate
protein
expression.
Upregulation of ENPP2 has been reported in a number
of aggressive tumors, including glioblastoma,
undifferentiated anaplastic thyroid carcinoma, invasive
breast carcinoma, and metastatic hepatocellular
carcinoma.
In adults, NPP2 is the major source of serum and
plasma lysophospholipase D activity. It is also highly
expressed in brain, kidney, liver, ovary, small intestine,
and placenta, and is present in many other tissues.
Homology
NPP2 is a member of the nucleotide pyrophosphatase
and phosphodiesterase family, which includes ENPP1
(PC1) and ENPP3 (B10). Although the catalytic
domain is highly conserved within this family of
proteins, only NPP2 possesses lysophospholipase D
activity.
Mutations
Note: There are a number of single nucleotide
polymorphisms (SNPs) that have been reported within
the ENPP2 gene but none are yet reported to be
associated with altered phenotype. However, knockout
of ENPP2 is lethal in mice (approximately E12),
therefore mutations associated with loss of function
might be lethal.
Implicated in
Various cancers
Disease
Overexpression of the ENPP2 protein has been
associated with tumor cell motility and invasion, tumor
growth and metastasis, and blood vessel formation.
Function
NPP2 is a Type 2 nucleotide pyrophosphatase and
phosphodiesterase that also has ATPase activity. In
addition, NPP2 is the major source of serum and
Atlas Genet Cytogenet Oncol Haematol. 2007;11(3)
183
ENPP2 (ectonucleotide pyrophosphatase/phosphodiesterase 2)
Stracke ML, Clair T
Prognosis
ENPP2 is over-expressed in poorly differentiated nonsmall cell lung carcinomas and invasive and metastatic
hepatocellular carcinoma. In thyroid carcinomas,
ENPP2 expression was found to be higher in
undifferentiated anaplastic thyroid carcinoma cell lines
and tissues than in follicular thyroid carcinomas or
goiters. When glioblastoma multiforme cells were
collected from tumor cores vs. areas of white matter
invasion, ENPP2 was found to be overexpressed
predominantly at the invasive front.
Oncogenesis
Upregulation of NPP2 expression appears to be
associated with cancer progression rather than with
oncogenesis. Transfection of ENPP2 cDNA into mouse
fibroblast cell lines (NIH3T3 clone7) did not result in
tumorigenic cell lines, but transfection into Rastransformed fibroblasts resulted in rapidly growing,
hematogenous, highly metastatic tumors. NPP2
expression was found in Hodgkin's lymphoma cells as
well as in CD30+ anaplastic large-cell lymphomas. In
the Hodgkin's lymphomas, EBV infection was
correlated to induction of ENPP2 expression (P =
0.006).
Transfection of the tumor suppressor CST6 into MDAMB-435 cells resulted in down-regulation of ENPP2. In
contrast, down regulation of ENPP2 by specific
siRNAs resulted in down-regulation of the tumor
suppressors, thrombospondin-1 and thrombospondin-2
(THBS1 and THBS2, respectively).
linked to phosphodiesterase catalytic site of autotaxin. J Biol
Chem 1996;271:24408-24412.
Diabetes
Nam SW, Clair T, Kim YS, McMarlin A, Schiffmann E, Liotta
LA, Stracke ML. Autotaxin (NPP-2), a metastasis-enhancing
motogen, is an angiogenic factor. Cancer Res 2001;61:69386944.
Lee HY, Murata J, Clair T, Polymeropoulos MH, Torres R,
Manrow RE, Liotta LA, Stracke ML. Cloning, chromosomal
localization, and tissue expression of autotaxin from human
teratocarcinoma cells. Biochem Biophys Res Commun
1996;218:714-719.
Clair T, Lee HY, Liotta LA, Stracke ML. Autotaxin is an
exoenzyme possessing 5'-nucleotide phosphodiesterase/ATP
pyrophosphatase and ATPase activities. J Biol Chem
1997;272:996-1001.
Kawagoe H, Stracke ML, Nakamura H, Sano K. Expression
and transcriptional regulation of the PD-Ialpha/autotaxin gene
in neuroblastoma. Cancer Res 1997;236:449-454.
Bächner D, Ahrens M, Schröder D, Hoffmann A, Lauber J,
Betat N, Steinert P, Flohé L, Gross G. Bmp-2 downstream
targets in mesenchymal development identified by subtractive
cloning
from
recombinant
mesenchymal
progenitors
(C3H10T1/2). Dev Dyn 1998;213:398-411.
Bächner D, Ahrens M, Betat N, Schröder D, Gross G.
Developmental expression analysis of murine autotaxin (ATX).
Mech Dev 1999;84:121-125.
Yang Y, Mou Lj, Liu N, Tsao MS. Autotaxin expression in nonsmall-cell lung cancer. Am J Respir Cell Mol Biol 1999;21:216222.
Zhang G, Zhao Z, Xu S, Ni L, Wang X. Expression of autotaxin
mRNA in human hepatocellular carcinoma. Chin Med J
1999;112:330-332.
Nam SW, Clair T, Campo CK, Lee HY, Liotta LA, Stracke ML.
Autotaxin (ATX), a potent tumor motogen, augments invasive
and metastatic potential of ras-transformed cells. Oncogene
2000;19:241-247.
Gijsbers R, Ceulemans H, Stalmans W, Bollen M. Structural
and
catalytic
similarities
between
nucleotide
pyrophosphatases/phosphodiesterases
and
alkaline
phosphatases. J Biol Chem 2001;276:1361-1368.
Disease
NPP2 expression is highly upregulated during
adipocyte
differentiation
and
its
product,
lysophosphatidic acid, stimulates proliferation in
preadipocytes. In genetically obese, diabetic mice,
NPP2 expression was increased in adipose tissue
compared to their lean siblings. This is a possible
model for type 2 diabetes, which has a strong genetic
component.
Lee HY, Bae GU, Jung ID, Lee JS, Kim YK, Noh SH, Stracke
ML, Park CG, Lee HW, Han JW. Autotaxin promotes motility
via G protein-coupled phosphoinositide 3-kinase gamma in
human melanoma cells. FEBS Lett 2002;515:137-140.
Tokumura A, Majima E, Kariya Y, Tominaga K, Kogure K,
Yasuda K, Fukuzawa K. Identification of human plasma
lysophospholipase D, a lysophosphatidic acid-producing
enzyme, as autotaxin, a multifunctional phosphodiesterase. J
Biol Chem 2002;277:39436-39442.
References
Umezu-Goto M, Kishi Y, Taira A, Hama K, Dohmae N, Takio K,
Yamori T, Mills GB, Inoue K, Aoki J, Arai H. Autotaxin has
lysophospholipase D activity leading to tumor cell growth and
motility by lysophosphatidic acid production. J Cell Biol
2002;158:227-233.
Stracke ML, Krutzsch HC, Unsworth EJ, Arestad A, Cioce V,
Schiffmann E, Liotta LA. Identification, purification, and partial
sequence analysis of autotaxin, a novel motility-stimulating
protein. J Biol Chem 1992;267:2524-2529.
Yang SY, Lee J, Park CG, Kim S, Hong S, Chung HC, Min SK,
Han JW, Lee HW, Lee HY. Expression of autotaxin (NPP-2) is
closely linked to invasiveness of breast cancer cells. Clin Exp
Metastasis 2002;19:603-608.
Murata J, Lee HY, Clair T, Krutzsch HC, Arestad AA, Sobel
ME, Liotta LA, Stracke ML. cDNA cloning of the human tumor
motility-stimulating protein, autotaxin, reveals a homology with
phosphodiesterases. J Biol Chem 1994;269:30479-30484.
Clair T, Aoki J, Koh E, Bandle RW, Nam SW, Ptaszynska MM,
Mills GB, Schiffmann E, Liotta LA, Stracke ML. Autotaxin
hydrolyzes sphingosylphosphorylcholine to produce the
regulator of migration, sphingosine-1-phosphate. Cancer Res
2003;62:5446-5453.
Kawagoe H, Soma O, Goji J, Nishimura N, Narita M, Inazawa
J, Nakamura H, Sano K. Molecular cloning and chromosomal
assignment of the human brain-type phosphodiesterase
I/nucleotide pyrophosphatase gene (PDNP2). Genomics
1995;30:380-384.
Ferry G, Tellier E, Try A, Grés S, Naime I, Simon MF,
Rodriguez M, Boucher J, Tack I, Gesta S, Chomarat P, Dieu
M, Raes M, Galizzi JP, Valet P, Boutin JA, Saulnier-Blache JS.
Autotaxin
is
released
from
adipocytes,
catalyzes
Lee HY, Clair T, Mulvaney PT, Woodhouse EC, Aznavoorian
S, Liotta LA, Stracke ML. Stimulation of tumor cell motility
Atlas Genet Cytogenet Oncol Haematol. 2007;11(3)
184
ENPP2 (ectonucleotide pyrophosphatase/phosphodiesterase 2)
Stracke ML, Clair T
lysophosphatidic acid synthesis, and activates preadipocyte
proliferation. Up-regulated expression with adipocyte
differentiation and obesity. J Biol Chem 2003;278:1816218169.
van Meeteren LA, Ruurs P, Christodoulou E, Goding JW,
Takakusa H, Kikuchi K, Perrakis A, Nagano T, Moolenaar WH.
Inhibition of autotaxin by lysophosphatidic acid and
sphingosine 1-phosphate. J Biol Chem 2005;208:2115521161.
Fox MA, Colello RJ, Macklin WB, Fuss B. PhosphodiesteraseIalpha/autotaxin: a counteradhesive protein expressed by
oligodendrocytes during onset of myelination. Mol Cell
Neurosci 2003;23:507-519.
Koike S, Keino-Masu K, Ohto T, Masu M. The N-terminal
hydrophobic sequence of autotaxin (ENPP2) functions as a
signal peptide. Genes Cells 2006;11:133-142.
Gijsbers R, Aoki J, Arai H, Bollen M. The hydrolysis of
lysophospholipids and nucleotides by autotaxin (NPP2)
involves a single catalytic site. FEBS Lett 2003;538:60-64.
Lee J, Duk Jung I, Gyo Park C, Han JW, Young Lee H.
Autotaxin stimulates urokinase-type plasminogen activator
expression through phosphoinositide 3-kinase-Akt-necrosis
factor kappa B signaling cascade in human melanoma cells.
Melanoma Res 2006;16:445-452.
Koh E, Clair T, Woodhouse EC, Schiffmann E, Liotta L,
Stracke M. Site-directed mutations in the tumor-associated
cytokine, autotaxin, eliminate nucleotide phosphodiesterase,
lysophospholipase D, and motogenic activities. Cancer Res
2003;63:2042-2045.
Noh JH, Ryu SY, Eun JW, Song J, Ahn YM, Kim SY, Lee SH,
Park WS, Yoo NJ, Lee JY, Lee SN, Nam SW. Identification of
large-scale molecular changes of Autotaxin (ENPP2) knockdown by small interfering RNA in breast cancer cells. Mol Cel
Biochem 2006;288:91-106.
Black EJ, Clair T, Delrow J, Neiman P, Gillespie DA.
Microarray analysis identifies Autotaxin, a tumour cell motility
and angiogenic factor with lysophospholipase D activity, as a
specific target of cell transformation by v-Jun. Oncogene
2004;23:2357-2366.
Song J, Jie C, Polk P, Shridhar R, Clair T, Zhang J, Yin L,
Keppler D. The candidate tumor suppressor CST6 alters the
gene expression profile of human breast carcinoma cells:
down-regulation of the potent mitogenic, motogenic, and
angiogenic factor autotaxin. Biochem Biophys Res Commun
2006;340:175-182.
Brindley DN. Lipid phosphate phosphatases and related
proteins: signaling functions in development, cell division, and
cancer. J Cell Biochem 2004;92:900-912. (Review).
Tanaka M, Okudaira S, Kishi Y, Ohkawa R, Iseki S, Ota M,
Noji S, Yatomi Y, Aoki J, Arai H. Autotaxin stabilizes blood
vessels and is required for embryonic vasculature by producing
lysophosphatidic acid. J Biol Chem 2006;281:25822-25830.
Hama K, Aoki J, Fukaya M, Kishi Y, Sakai T, Suzuki R, Ohta
H, Yamori T, Watanabe M, Chun J, Arai H. Lysophosphatidic
acid and autotaxin stimulate cell motility of neoplastic and nonneoplastic cells through LPA1. J Biol Chem 2004;279:1763417639.
Kehlen A, Englert N, Seifert A, Klonisch T, Dralle H, Langner J,
Hoang-Vu C. Expression, regulation and function of autotaxin
in thyroid carcinomas. Int J Cancer 2004;109:833-839.
Tsuda S, Okudaira S, Moriya-Ito K, Shimamoto C, Tanaka M,
Aoki J, Arai H, Murakami-Murofushi K, Kobayashi T. Cyclic
phosphatidic acid is produced by autotaxin in blood. J Biol
Chem 2006;281:26081-26088.
Baumforth KR, Flavell JR, Reynolds GM, Davies G, Pettit TR,
Wei W, Morgan S, Stankovic T, Kishi Y, Arai H, Nowakova M,
Pratt G, Aoki J, Wakelam MJ, Young LS, Murray PG. Induction
of autotaxin by the Epstein-Barr virus promotes the growth and
survival of Hodgkin lymphoma cells. Blood 2005;106:21382146.
van Meeteren LA, Ruurs P, Stortelers C, Bouwman P, van
Rooijen MA, Pradère JP, Pettit TR, Wakelam MJ, SaulnierBlache JS, Mummery CL, Moolenaar WH, Jonkers J.
Autotaxin, a secreted lysophospholipase D, is essential for
blood vessel formation during development. Mol Cell Biol
2006;26:501-522.
Boucher J, Quilliot D, Pradères JP, Simon MF, Grès S, Guigné
C, Prévot D, Ferry G, Boutin JA, Carpéné C, Valet P, SaulnierBlache JS. Potential involvement of adipocyte insulin
resistance in obesity-associated up-regulation of adipocyte
lysophospholipase D/autotaxin expression. Diabetologia
2005;48:569-577.
Pradère JP, Tarnus E, Gres S, Valet P, Saulnier-Blache JS.
Secretion and lysophospholipase D activity of autotaxin by
adipocytes are controlled by N-glycosylation and signal
peptidase. Biochim Biophys Acta 2007;1771:93-102.
Savaskan NE, Rocha L, Kotter MR, Baer A, Lubec G, van
Meeteren LA, Kishi Y, Aoki J, Moolenaar WH, Nitsch R, Bräuer
AU. Autotaxin (NPP-2) in the brain: cell type-specific
expression and regulation during development and after
neurotrauma. Cell Mol Life Sci 2007;64:230-243.
Chen M, O'Connor KL. Integrin alpha6beta4 promotes
expression of autotaxin/ENPP2 autocrine motility factor in
breast carcinoma cells. Oncogene 2005;24:5125-5130.
Corcoran DL, Feingold E, Dominick J, Wright M, Harnaha J,
Trucco M, Giannoukakis N, Benos PV. Footer: a quantitative
comparative genomics method for efficient recognition of cisregulatory elements.TER: a web tool for finding mammalian
DNA regulatory regions using phylogenetic footprinting.
Genome Res 2005;15:840-847.
Atlas Genet Cytogenet Oncol Haematol. 2007;11(3)
This article should be referenced as such:
Stracke ML, Clair T. ENPP2 (ectonucleotide
pyrophosphatase/phosphodiesterase 2).
Atlas Genet Cytogenet Oncol Haematol.2007; 11(3):182-185.
185
Atlas of Genetics and Cytogenetics
in Oncology and Haematology
OPEN ACCESS JOURNAL AT INIST-CNRS
Gene Section
Mini Review
EPHA7 (EPH receptor A7)
Haruhiko Sugimura, Hiroki Mori, Tomoyasu Bunai, Masaya Suzuki
First Department of Pathology, Hamamatsu University School of Medicine, 1-20-1 Handayama, Hamamatsu,
Shizuoka 431-3192, Japan
Published in Atlas Database: February 2007
Online updated version: http://AtlasGeneticsOncology.org/Genes/EPHA7ID40466ch6q16.html
DOI: 10.4267/2042/38435
This work is licensed under a Creative Commons Attribution-Non-commercial-No Derivative Works 2.0 France Licence.
© 2007 Atlas of Genetics and Cytogenetics in Oncology and Haematology
Transcription
Identity
rTanscript of 5,229 bp.
Hugo: EPHA7
Other names: EHK3; HEK11
Location: 6q16.1
Protein
Description
EPHA7 encodes 998 amino acids, theoretical pI is 5.58,
theoretical molecular weight is 112 KDa, tyrosine
kinase, catalytic domain, sterile alpha motif, 2
fibronectin type 3 domains, ephrin receptor ligand
binding domain and tumor necrosis factor receptor
domain.
Probe(s) - Courtesy Mariano Rocchi.
DNA/RNA
Expression
Description
In brain, skeletal muscle,
colorectum and nerve system.
The EPHA7 gene maps on chromosome 6q16.1
spanning 178,134 bp. it contains 17 exons, the
orientation of the gene is complement.
Atlas Genet Cytogenet Oncol Haematol. 2007;11(3)
Localisation
Located in the membrane.
186
lung,
kidney,
liver,
EPHA7 (EPH receptor A7)
Sugimura H et al.
a solid tumor via aberrant 5'CpG island methylation. It
provides the evidence that EphA7 gene is involved in
human colorectal carcinogenesis.
Function
ATP Binding, ephrin receptor activity, nucleotide
binding, protein binding, receptor activity, transferase
activity.
References
Homology
Holmberg J, DL Clarke, and J Frisén. Regulation of repulsion
versus adhesion by different splice forms of an Eph receptor.
Nature 2000;408(6809):203-206.
Homo sapiens: EPHA5 isoform b [NP_872272] (64%),
EPHA5 isoform a [NP_004430] (63%), EPHA4
[NP_004429] (63%), EPHA3 [AAG43576] (63%).
Hafner C.,Schmitz G.,Meyer S.,Bataille F.,Hau P.,Langmann
T.,Dietmaier W.,Landthaler M.,Vogt T. Differential gene
expression of Eph receptors and ephrins in benign human
tissues and cancers. Clin Chem 2004;50(3):490-499.
Implicated in
Wang J,Kataoka H,Suzuki M,Sato N,Nakamura R,Tao
H,Maruyama K, Isogaki J,Kanaoka S,Ihara M,Tanaka
M,Kanamori M, Nakamura T, Shinmura K, Sugimura H.
Downregulation of EphA7 by hypermethylation in colorectal
cancer. Oncogene 2005;24(36):5637-5647.
Colorectal cancer
Note: A significant reduction of EphA7 expression in
human colorectal cancers was shown using
semiquantitative reverse transcription-polymerase
chain reaction analysis in 59 colorectal cancer tissues,
compared to corresponding normal mucosas (P=0.008),
and five colon cancer cell lines. To investigate the
mechanism of EphA7 downregulation in colorectal
cancer, we examined the methylation status of the
5'CpG island around the translation start site in five
colon cancer cell lines using restriction enzymes,
methylation-specific PCR, and bisulfite sequencing and
found evidence of aberrant methylation. The expression
of EphA7 in colon cancer cell lines was restored after
treatment with 5-aza-2'-deoxycytidine. Analysis of
methylation status in totally 75 tumors compared to
clinicopathological
parameters
revealed
that
hypermethylation of colorectal cancers was more
frequent in male than in female, and in moderately
differentiated
than
in
well-differentiated
adenocarcinomas. There was a tendency that
hypermethylation in rectal cancers was more frequent
than in colon cancers. Hypermethylation was also
observed in colorectal adenomas. This is the first report
describing the downregulation of an Eph family gene in
Atlas Genet Cytogenet Oncol Haematol. 2007;11(3)
Figueroa JD, Benton RL, Velazquez I, Torrado AI, Ortiz CM,
Hernandez CM, Diaz JJ, Magnuson DS, Whittemore SR,
Miranda JD. Inhibition of EphA7 up-regulation after spinal cord
injury reduces apoptosis and promotes locomotor recovery. J
Neurosci Res 2006;84(7):1438-1451.
Hafner C.,Becker B.,Landthaler M., Vogt T. Expression profile
of Eph receptors and ephrin ligands in human skin and
downregulation of EphA1 in nonmelanoma skin cancer. Mod
Pathol 2006;19(10):1369-1377.
Shao R. X., Kato N., Lin L. J., Muroyama R., Moriyama M.,
Ikenoue T., Watabe H., Otsuka M., Guleng B., Ohta M.,
Tanaka Y., Kondo S., Dharel N., Chang J. H., Yoshida H.,
Kawabe T., Omata M. Absence of tyrosine kinase mutations in
Japanese colorectal cancer patients. Oncogene 2006;(Epub
ahead of print).
Zhao X, Sun M, Zhao J, Leyva JA, Zhu H, Yang W, Zeng X, Ao
Y, Liu Q, Liu G, Lo WH, Jabs EW, Amzel LM, Shan X, Zhang
X. Mutations in HOXD13 Underlie Syndactyly Type V and a
Novel Brachydactyly-Syndactyly Syndrome. Am J Hum Genet
2007;80(2):361-371.
This article should be referenced as such:
Sugimura H, Mori H, Bunai T, Suzuki M. EPHA7 (EPH receptor
A7). Atlas Genet Cytogenet Oncol Haematol.2007;11(3):186187.
187
Atlas of Genetics and Cytogenetics
in Oncology and Haematology
OPEN ACCESS JOURNAL AT INIST-CNRS
Gene Section
Review
FLCN (folliculin gene)
Laura S Schmidt
Laboratory of Immunobiology, National Cancer Institute Frederick, Bldg 560, Rm 12-69, Frederick, MD
21702, USA
Published in Atlas Database: February 2007
Online updated version: http://AtlasGeneticsOncology.org/Genes/FLCNID789ch17p11.html
DOI: 10.4267/2042/38436
This work is licensed under a Creative Commons Attribution-Non-commercial-No Derivative Works 2.0 France Licence.
© 2007 Atlas of Genetics and Cytogenetics in Oncology and Haematology
Identity
Protein
Hugo: FLCN
Other names: BHD; FLCL; Folliculin
Location: 17p11.2
Note: Putative tumor suppressor gene.
Description
DNA/RNA
The BHD protein, folliculin (FLCN), consists of 579
amino acids with a central glutamic acid-rich coiledcoil domain, one N-glycosylation site and three
myristoylation sites, and an estimated molecular weight
of 64.5 kDa.
Description
Expression
The FLCN/BHD gene consists of a 3717 nt mRNA
(using NM_144997 derived from BQ423946 and
AF517523, the coding sequence extends from nt499 to
nt2238) and contains 14 coding exons. The initiation
codon is located within exon 4.
Expressed in most major adult tissues, including
kidney, lung and skin, which are involved in the BHD
phenotype.
Localisation
Epitope-tagged FLCN expressed in HEK293 cells
localized in both the nucleus and cytoplasm by
fluorescence in situ hybridization.
Transcription
Northern blot analysis revealed a 3.8 kb FLCN/BHD
mRNA transcript expressed in most tissues
Alternate splicing of FLCN/BHD results in two
transcript variants encoding two different isoforms.
Transcript 1 is the full-length isoform. Transcript 2 has
a shorter and distinct C-terminus from Transcript 1.
Atlas Genet Cytogenet Oncol Haematol. 2007;11(3)
Function
FLCN is a novel protein, with no characteristic
domains to suggest function. Coimmunoprecipitation
studies have identified a novel folliculin-binding
partner, FNIP1, which also interacts with 5’AMP-
188
FLCN (folliculin gene)
Schmidt LS
activated protein kinase (AMPK), a key molecule for
energy sensing and a negative regulator of mTOR
(mammalian target of rapamycin). FLCN exists in
signaling including rapamycin and amino acid
starvation, and by an AMPK inhibitor, Compound C.
These data suggest that FLCN and its interacting
partner, FNIP1, may be involved in energy and
nutrient-sensing through the AMPK and mTOR
signaling pathways.
Using a genetic approach in Drosophila, RNA
interference studies to decrease expression of the fly
BHD homolog, DBHD, have established a requirement
for DBHD in male germline stem cell maintenance in
the fly testis. Further genetic studies to examine the
interaction between DBHD and the JAK/STAT
pathway, which is necessary for germline stem cell
self-renewal, suggested that DBHD may regulate
maintenance of germline stem cells downstream of or
in parallel with the JAK/STAT and Dpp (a TGFbeta
family member) signaling pathways. Thus the work
with the Drosophila homolog of FLCN/BHD supports a
potential role for DBHD in stem cell maintenance and
raises the possibility that dysregulation of FLCN in
human tumors may result from aberrant modulation of
stem cells.
with nearly 100% penetrance in family members in
which lung blebs or bullae indicated affected status.
The PSP-associated mutations, including 2 nonsense
and one 4-bp deletion, are predicted to prematurely
truncate the protein and are located in exons 9, 12 and
4, respectively.
Somatic
FLCN/BHD somatic mutations have been found at only
a very low frequency (0-10%) in sporadic renal tumors
and therefore, may not represent a major mechanism
for the development of sporadic renal carcinoma. Loss
of 17p DNA including p53 (36%) or partial
methylation (28%) of the FLCN/BHD promoter were
reported in sporadic renal carcinomas with various
histologies.
Mutations have been identified in the mutational hot
spot in exon 11 of the FLCN/BHD gene in other tumor
types exhibiting microsatellite instability, including
colorectal carcinoma (20%), endometrial carcinoma
(12%) and gastric carcinoma (16%).
Implicated in
Birt-Hogg-Dubé (BHD) syndrome
Disease
Birt-Hogg-Dubé (BHD) syndrome is an inherited
autosomal dominant genodermatosis characterized by
benign tumors of the hair follicle (fibrofolliculoma),
lung cysts, spontaneous pneumothorax and renal
neoplasia. Colon polyps or colon cancer may be part of
the disease manifestations in some BHD cohorts
although no statistically significant association was
found. BHD syndrome is caused by germline mutations
in the FLCN/BHD gene. Any or all of these phenotypic
features may develop in a BHD patient; the phenotype
is variable within and among BHD families inheriting
the identical FLCN/BHD mutation (i.e., Cinsertion/deletion in exon 11).
Prognosis
BHD is a rare disorder occurring in about 1/200,000
individuals. The BHD skin lesions, which develop after
puberty (above 25 years of age) are highly penetrant
(above 85%) and may be disfiguring, but they are
benign and have no health consequences. Lung cysts
detected by thoracic CT scan are very frequent (above
85%) in BHD patients. Episodes of spontaneous
pneumothorax in BHD patients occur with a higher
frequency before the age of 40, and repeat episodes
cease after surgical intervention. The risk for
developing renal neoplasia is about 7-fold higher for
BHD mutation carriers than for their unaffected
siblings. Most commonly, chromophobe renal
carcinoma (34%) and oncocytic hybrid tumors (50%),
develop in about half of BHD families with an average
age at diagnosis of 48-50 and a male/female ratio of
2:1. Tumors may develop bilaterally with multiple foci
Homology
Folliculin shows no strong homology to any known
proteins but is evolutionarily conserved, and orthologs
have been identified in chimpanzee, dog, cow, rat,
mouse, red jungle fowl, frog, fly, and worm.
Mutations
Germinal
All FLCN/BHD germline mutations identified in BirtHogg-Dubé (BHD) patients are predicted to truncate
the
mutant
protein,
including
frameshift
(insertions/deletions),
nonsense
and
splice-site
mutations. To date, no missense germline mutations
have been identified. The mutation detection rate in
BHD families is about 84%. Mutations are located
along the entire length of the coding region, with no
genotype-phenotype correlations noted between type of
mutation, location within the gene and phenotypic
disease manifestations (BHD skin lesions, lung
cysts/spontaneous pneumothorax and renal tumors).
The most frequent mutation found in the germline of
BHD patients is the insertion or deletion of a cytosine
in a C8 tract located in exon 11, predicted to cause a
frameshift and prematurely truncate the mutant protein.
This hot spot mutation occurs in about half of all BHD
patients. Among BHD patients with the exon 11
mutation, significantly fewer renal tumors developed in
patients with the C-deletion than those with the Cinsertion mutation.
Germline FLCN/BHD mutations have been reported in
primary spontaneous pneumothorax (PSP) families
Atlas Genet Cytogenet Oncol Haematol. 2007;11(3)
189
FLCN (folliculin gene)
Schmidt LS
or unilaterally with a single focus, and variable tumor
histology may be seen in a single patient’s kidney and
among BHD family members carrying the same
FLCN/BHD mutation.
Oncogenesis
Patients with BHD syndrome are at a higher risk for the
development of chromophobe renal carcinoma,
oncocytic hybrid renal tumors and clear cell renal
carcinoma, which may be aggressive and metastatic.
Renal oncocytosis, which are small clusters of cells
resembling those found in the larger hybrid tumors,
have been found scattered throughout the kidney of a
majority of BHD patients, suggesting that the entire
renal parenchyma may be at risk for tumor
development. Second hit somatic mutations in the
remaining wild type copy of the FLCN/BHD gene have
been identified in renal tumors from BHD patients with
germline mutations and may contribute to the
progression of renal oncocytosis to renal neoplasia (see
below).
second mutation was observed, suggesting that multiple
tumors arise from independent, clonal events initiated
by the second hit.
Haploinsufficiency, however, may be sufficient for the
development of the benign hair follicle tumors
(fibrofolliculomas), because the wild type copy of the
FLCN/BHD gene is retained in microdissected tissue
from these skin lesions.
References
Khoo SK, Bradley M, Wong FK, Hedblad MA, Nordenskjöld M,
Teh BT. Birt-Hogg-Dubé syndrome: mapping of a novel
hereditary neoplasia gene to chromosome 17p12-q11.2.
Oncogene 2001;20:5239-5242.
Schmidt LS, Warren MB, Nickerson ML, Weirich G, Matrosova
V, Toro JR, Turner ML, Duray P, Merino M, Hewitt S, Pavlovich
CP, Glenn G, Greenberg CR, Linehan WM, Zbar B. Birt-HoggDubé syndrome, a genodermatosis associated with
spontaneous pneumothorax and kidney neoplasia, maps to
chromosome 17p11.2. Am J Hum Genet 2001;69:876-882.
Khoo SK, Giraud S, Kahnoski K, Chen J, Motorna O, Nickolov
R, Binet O, Lambert D, Friedel J, Lévy R, Ferlicot S,
Wolkenstein P, Hammel P. Bergerheim U, Hedblad MA,
Bradley M, Teh BT, Nordenskjöld M, Richard S. Clinical and
genetic studies of Birt-Hogg-Dubé syndrome. J Med Genet
2002;39:906-912.
Primary Spontaneous Pneumothorax
(PSP)
Disease
Primary spontaneous pneumothorax is a condition in
which air is present in the pleural space without a
precipitating event that results in the secondary partial
or complete collapse of the lung. FLCN/BHD
mutations have been found associated with inherited
autosomal
dominant
primary
spontaneous
pneumothorax (PSP) in some PSP families. In these
families PSP was the only phenotypic feature and the
mutation was 100% penetrant with lung bullae.
Nickerson ML, Warren MB, Toro JR, Matrosova V, Glenn G,
Turner ML, Duray P, Merino M, Choyke P, Pavlovich CP,
Sharma N, Walther M, Munroe D, Hill R, Maher E, Greenberg
C, Lerman MI, Linehan WM, Zbar B, Schmidt LS. Mutations in
a novel gene lead to kidney tumors, lung wall defects, and
benign tumors of the hair follicle in patients with the Birt-HoggDubé syndrome. Cancer Cell 2002;2:157-164.
Pavlovich CP, Walther MW, Eyler RA, Hewitt SM, Zbar B,
Linehan WM, Merino MJ. Renal tumors in the Birt-Hogg-Dubé
syndrome. Am J Surg Path 2002;26:1542-1552.
Zbar B, Alvord WG, Glenn G, Turner M, Pavlovich CP, Schmidt
L, Walther M, Choyke P, Weirich G, Hewitt SM, Duray P,
Gabril F, Greenberg C, Merino MJ, Toro J, Linehan WM. Risk
of renal and colonic neoplasms and spontaneous
pneumothorax in the Birt-Hogg-Dubé syndrome. Cancer
Epidemiol. Biomarkers Prev 2002;11:393-400.
To be noted
Note: Animal models of BHD: A germline single
nucleotide insertion in the first coding exon of the rat
Bhd ortholog was found in the Nihon rat, an established
animal model of renal carcinoma, which develops renal
tumors by 8 weeks of age. A germline mutation in the
canine Bhd ortholog, which changes a conserved
histidine to arginine (H255R), gives rise to RCND
(renal cystadenoma nodular dermatofibroma) in the
German Shepherd dog with a renal tumor and skin
nodule phenotype.
Tumor suppressor role for FLCN/BHD: Somatic
mutations in the wild type copy of the FLCN/BHD
gene or loss of heterozygosity at 17p11.2 have been
identified in a majority of renal tumors from BHD
patients who inherit germline mutations, suggesting
that FLCN/BHD may act as a tumor suppressor gene.
Tumors from a single BHD patient have different
second mutations or LOH, but within the same tumor,
even within regions with different histologies, the same
Atlas Genet Cytogenet Oncol Haematol. 2007;11(3)
da Silva NF, Gentle D, Hesson LB, Morton DG, Latif F, Maher
ER. Analysis of the Birt-Hogg-Dube (BHD) tumour suppressor
gene in sporadic renal cell carcinoma and colorectal cancer. J
Med Genet 2003;40:820-824.
Kahnoski K, Khoo SK, Nassif NT, Chen J, Lobo GP, Segelov
E, Teh BT. Alterations of the Birt-Hogg-Dube gene (BHD) in
sporadic colorectal tumours. J Med Genet 2003;40:511-515.
Khoo SK, Kahnoski K, Sugimura J, Petillo D, Chen J, Shockley
K, Ludlow J, Knapp R, Giraud S, Richard S, Nordenskjöld M,
Teh BT. Inactivation of BHD in sporadic renal tumors. Cancer
Res 2003;63:4583-4587.
Lingaas F, Comstock KE, Kirkness EF, Sørensen A, Aarskaug
T, Hitte C, Nickerson ML, Moe L, Schmidt LS, Thomas R,
Breen M, Galibert F, Zbar B, Ostrander EA. A mutation in the
canine BHD gene is associated with hereditary multifocal renal
cystadenocarcinoma and nodular dermatofibrosis in the
German Shepherd dog. Hum Mol Genet 2003;12:3043-3053.
Shin JH, Shin YK, Ku JL, Jeong SY, Hong SH, Park SY, Kim
WH, Park JG. Mutations of the Birt-Hogg-Dube (BHD) gene in
sporadic colorectal carcinomas and colorectal carcinoma cell
lines with microsatellite instability. J Med Genet 2003;40:364367.
190
FLCN (folliculin gene)
Schmidt LS
Nagy A, Zoubakov D, Stupar Z, Kovacs G. Lack of mutation of
the folliculin gene in sporadic chromophobe renal cell
carcinoma and renal oncocytoma. Int J Cancer 2004;109:472475.
Baba M, Hong SB, Sharma N, Warren MB, Nickerson ML,
Iwamatsu A, Esposito D, Gillette WK, Hopkins RF 3rd, Hartley
JL, Furihata M, Oishi S, Zhen W, Burke TR Jr, Linehan WM,
Schmidt LS, Zbar B. Folliculin encoded by the BHD gene
interacts with a binding protein, FNIP1, and AMPK, and is
involved in AMPK and mTOR signaling. Proc Natl Acad Sci
USA 2006;103:15552-15557.
Okimoto K, Sakurai J, Kobayashi T, Mitani H, Hirayama Y,
Nickerson ML, Warren MB, Zbar B, Schmidt LS, Hino O. A
germ-line insertion in the Birt-Hogg-Dube (BHD) gene gives
rise to the Nihon rat model of inherited renal cancer. Proc Natl
Acad Sci USA 2004;101:2023-2027.
Bessis D, Giraud S, Richard S. A novel familial germline
mutation in the initiator codon of the BHD gene in a patient with
Birt-Hogg-Dube syndrome. Br J Dermatol 2006;155:10671069.
Schmidt LS. Birt-Hogg-Dube syndrome, a genodermatosis that
increases risk for renal carcinoma. Curr Mol Med 2004;4:877885. (Review).).
Fujii H, Jiang W, Matsumoto T, Miyai K, Sashara K, Ohtsuji N,
Hino O. Birt-Hogg-Dube gene mutations in human endometrial
carcinomas
with microsatellite instability. J
Pathol
2006;209:328-335.
Warren MB, Torres-Cabala CA, Turner ML, Merino MJ,
Matrosova VY, Nickerson ML, Ma W, Linehan WM, Zbar B,
Schmidt LS. Expression of Birt-Hogg-Dubé gene mRNA in
normal and neoplastic human tissues. Mod Pathol
2004;17:998-1011.
Jiang W, Fujii H, Matsumoto T, Ohtsuji N, Tsurumaru M, Hino
O. Birt-Hogg-Dube (BHD) gene mutations in human gastric
cancer with high frequency microsatellite instability. Cancer
Lett 2006;[Epub ahead of print].
Graham RB, Nolasco M, Peterlin B, Garcia CK. Nonsense
mutations in folliculin presenting as isolated familial
spontaneous pneumothorax in adults. Am J Respir Crit Care
Med 2005;172:39-44.
Singh SR, Zhen W, Zheng Z, Wang H, Oh SW, Liu W, Zbar B,
Schmidt LS, Hou SX. The Drosophila homolog of the human
tumor suppressor gene BHD interacts with the JAK-STAT and
Dpp signaling pathways in regulating male germline stem cell
maintenance. Oncogene 2006;25:5933-5941.
Painter JN, Tapanainen H, Somer M, Tukiainen P, Aittomaki K.
A 4-bp deletion in the Birt-Hogg-Dube gene (FLCN) causes
dominantly inherited spontaneous pneumothorax. Am J Hum
Genet 2005;76:522-527.
Gad S, Lefèvre SH, Khoo SK, Giraud S, Vieillefond A, Vasiliu
V, Ferlicot S, Molinié V, Denoux Y, Thiounn N, Chrétien Y,
Méjean A, Zerbib M, Benoit G, Hervé JM, Allègre G, Bressacde Paillerets B, Teh BT, Richard S. Mutations in BHD and
TP53 genes, but not in HNF1beta gene, in a large series of
sporadic chromophobe renal cell carcinoma. Br J Cancer
2007;96:336-340.
Pavlovich CP, Grubb RL 3rd, Hurley K, Glenn GM, Toro J,
Schmidt LS, Torres-Cabala C, Merino MJ, Zbar B, Choyke P,
Walther MM, Linehan WM. Evaluation and management of
renal tumors in the Birt-Hogg-Dubé syndrome. J Urol
2005;173:1482-1486.
Schmidt LS, Nickerson ML, Warren MB, Glenn GM, Toro JR,
Merino MJ, Turner ML, Choyke PL, Sharma N, Peterson J,
Morrison P, Maher ER, Walther MM, Zbar B, Linehan WM.
Germline BHD-mutation spectrum and phenotype analysis of a
large cohort of families with Birt-Hogg-Dubé syndrome. Am J
Hum Genet 2005;76:1023-1033.
van Steensel MA, Verstraeten VL, Frank J, Kelleners-Smeets
NW, Poblete-Gutiérrez P, Marcus-Soekarman D, Bladergroen
RS, Steijlen PM, van Geel M. Novel mutations in the BHD
gene and absence of loss of heterozygosity in fibrofolliculomas
of Birt-Hogg-Dube patients. J Invest Dermatol 2007;127:588593.
Vocke CD, Yang Y, Pavlovich CP, Schmidt LS, Nickerson ML,
Torres-Cabala CA, Merino MJ, Walther MM, Zbar B, Linehan
WM. High frequency of somatic frameshift BHD gene
mutations in Birt-Hogg-Dube-associated renal tumors. J Natl
Cancer Inst 2005;97:931-935.
This article should be referenced as such:
Schmidt LS. FLCN (folliculin gene). Atlas Genet Cytogenet
Oncol Haematol.2007;11(3):188-191.
Adley BP, Smith ND, Nayar R, Yang XJ. Birt-Hogg-Dube
syndrome: clinicopathologic findings and genetic alterations.
Arch Pathol Lab Med 2006;130:1865-1870. (Review).
Atlas Genet Cytogenet Oncol Haematol. 2007;11(3)
191
Atlas of Genetics and Cytogenetics
in Oncology and Haematology
OPEN ACCESS JOURNAL AT INIST-CNRS
Gene Section
Mini Review
HIC1 (hypermethylated in cancer 1)
Dominique Leprince
Institut de Biologie de Lille, Institut Pasteur de Lille, 1 Rue Calmette, BP 447, 59021 Lille Cedex, France
Published in Atlas Database: February 2007
Online updated version: http://AtlasGeneticsOncology.org/Genes/HIC1ID40819ch17p13.html
DOI: 10.4267/2042/38437
This work is licensed under a Creative Commons Attribution-Non-commercial-No Derivative Works 2.0 France Licence.
© 2007 Atlas of Genetics and Cytogenetics in Oncology and Haematology
Identity
Protein
Hugo: HIC1
Other names: ZBTB29
Location: 17p13.3.
Local order: Close to the D17S5/D17S30/YNZ22
micro satellite marker which is a highly polymorphic
variable number of tandem repeats (VNTR) marker.
Aberrant hypermethylation in tumours of a cluster of
methylation-sensitive NotI restriction sites surrounding
this marker allowed the positional cloning of HIC1 in
1995.
Telomere,
OVCA1/DPH2L1,
OVCA2,
HIC1,
KIAA0732, ....Centromere.
Note: OVCA1/DPH2L1 and OVCA2 are two tumour
suppressor genes deleted in ovarian cancers.
Description
714 amino acids; around 80kDa; Transcription factor
belonging to the BTB/POZ and Krüppel C2H2 zinc
fingers family. There is no experimental evidence for
the existence of a protein initiated by the upstream
ATG (e.g. through the use of antipeptide specific
antibodies).
Expression
Based on Northern Blots and RT-PCR experiments,
HIC1 is widely expressed in various normal tissues.
Localisation
Nucleus. Localized on nuclear dots upon
overexpression by transient transfection assays in COS7 or HEK293 cells.
In human primary fibroblats (WI38), the endogenous
HIC1 proteins are localized in discrete nuclear
structures called 'HIC1 bodies'.
DNA/RNA
Description
The HIC1 gene extends approximately 15 Kbp and
consists of four exons. The first three exons 1a, 1b and
1c are alternative. Note that exon 1a is included in exon
1c. The major transcripts are derived from alternative
promoters associated with exon 1a and 1b. Exon 1c is
conserved in rodent genomes (rat and mice) but
transcripts containing it are very minor.
The fourth exon, exon 2, contains the coding region
and the 3' untranslated region.
An in-frame upstream ATG initiation codon is also
found in exon 1b. This upstream reading frame is
conserved in mice.
Function
HIC1 is a transcriptional repressor belonging to the
BTB/POZ and Krüppel C2H2 family (44 proteins in the
human genome). HIC1 interacts with the corepressor
CtBP through a conserved GLDLSKK motif in the
central region. This central region also contains a
SUMOylation site MK314HEP which is important for
the transcriptional repression potential of HIC1. This
K314
is
also
subject
to
a
reversible
acetylation/deacetylation implicating CBP/P300 and
the NAD+ dependent class III deacetylase SIRT1.
Transcription
Homology
3.0 Kb mRNA.
HIC1 shares distant homology through the conserved
BTB/POZ domain and C2H2 zinc fingers domain with
several BTB/POZ transcriptional repressors.
Pseudogene
No known pseudogene.
Atlas Genet Cytogenet Oncol Haematol. 2007;11(3)
192
HIC1 (hypermethylated in cancer 1)
Leprince D
tumor suppressor gene Hic1 exhibit developmental defects of
structures affected in the Miller-Dieker syndrome. Hum. Mol.
Genet 2000;9:413-419.
Mutations
Germinal
Deltour S, Pinte S, Guérardel C, Leprince D. Characterization
of HRG22, a human homologue of the putative tumor
suppressor gene HIC1. Biochem Biophys Res Commun
2001;287:427-434.
No germinal coding sequence mutations have been
described for HIC1.
Somatic
Guérardel C, Deltour S, Pinte S, Monte D, Begue A, Godwin
AK, Leprince D. Identification in the human candidate tumor
suppressor gene HIC-1 of a new major alternative TATA-less
promoter positively regulated by p53. J Biol Chem
2001;276:3078-3089.
No somatic coding sequence mutations have been
described for HIC1 with one exception. During the
screening of a panel of 68 medulloblastomas using
SSCP analyses, a 12-bp deletion in the second exon of
HIC1 has been identified. This results in a deletion of 4
glycine residues in a stretch of 8 located just after the
BTB/POZ domain. The other regions of the protein
specially the downstream central region and the zinc
fingers domain are not affected by this deletion.
Deltour S, Pinte S, Guérardel C, Wasylyk B, Leprince D. The
human candidate tumor suppressor gene HIC1 recruits CtBP
through a degenerate GLDLSKK motif. Mol Cell Biol
2002;22:4890-4901.
Epigenetics
Chen WY, Zeng X., Carter M., Morrell CN, Chiu-Yen RW,
Esteller M, Watkins DN, Herman JG, Mankowski JL, Baylin SB.
Heterozygous disruption of Hic1 predisposes mice to a genderdependent spectrum of malignant tumors. Nature Genetics
2003;33:197-202.
There are a number of reports highlighting differences
in promoter methylation status in primary human
tumours (breast, ovaries, prostate, ...) compared to
matched normal tissues, hence the name of the gene.
Chen W, Cooper TK, Zahnow CA, Overholtzer
Ladanyi M, Karp JE, Gokgoz N, Wunder JS,
Levine AJ, Mankowski JL, Baylin SB. Epigenetic
loss of Hic1 function accentuates the role
tumorigenesis. Cancer Cell 2004;6:387-398.
Implicated in
Pinte S, Guérardel C, Deltour-Balerdi S, Godwin AK, Leprince
D. Identification of a second G-C-rich promoter conserved in
the human, murine and rat tumor suppressor genes HIC1.
Oncogene 2004;23:4023-4031.
Medulloblastomas, breast tumours,
ovary tumours, prostate tumours
Pinte S, Stankovic-Valentin N, Deltour S, Rood BR, Guérardel
C, Leprince D. The tumor suppressor gene HIC1
(hypermethylated in cancer 1) is a sequence-specific
transcriptional repressor: definition of its consensus binding
sequence and analysis of its DNA binding and repressive
properties. J Biol Chem 2004;279:38313-38324.
Note: (see above).
Breakpoints
Chen WY, Wang DH, Yen RC, Luo J, Gu W, Baylin SB. HIC1
directly regulates SIRT1 to modulate p53-dependent DNAdamage responses. Cell 2005;123:437-448.
Note: No breakpoint in HIC1 identified so far.
To be noted
Britschgi C, Rizzi M, GrobTJ, Tschan MP, Hügli B, Reddy VA,
Andres AC, Torbett BE, Tobler A, Fey MF. Identification of the
p53 family-responsive element in the promoter region of the
tumor suppressor gene hypermethylated in cancer 1.
Oncogene 2006;25:2030-2039.
Note: A paralog called HIC2, HRG22 or KIAA1020 is
found on human chromosome 22. It is located in
22q11.2 in a region subject to translocations (BCRL-2
for Breakpoint Cluster Region-Like 2). But so far, there
is no experimental evidence for a translocation
implicating
HRG22
or
for
its
aberrant
hypermethylation in tumours.
Stankovic-Valentin N, Verger A, Deltour-Balerdi S, Quinlan KG,
Crossley M, Leprince D. A L225A substitution in the human
tumour suppressor HIC1 abolishes its interaction with the
corepressor CtBP. Febs J 2006;273:2879-2890.
Valenta T, Lukas J, Doubravska L, Fafilek B, Korinek V. HIC1
attenuates Wnt signaling by recruitment of TCF-4 and betacatenin to the nuclear bodies. Embo J 2006;25:2326-2337.
References
Stankovic-Valentin N, Deltour S, Seeler J, Pinte S, Vergoten G,
Guérardel
C,
Dejean
A,
Leprince
D.
An
acetylation/deacetylation-SUMOylation switch through a
phylogenetically conserved psiKxEP motif in the tumor
suppressor HIC1 regulates transcriptional repression activity.
Mol Cell Biol 2007;27:in press.
Wales MM, Biel MA, el Deiry W, Nelkin BD, Issa JP, Cavenee
WK, Kuerbitz SJ, Baylin SB. p53 activates expression of HIC1, a new candidate tumour suppressor gene on 17p13.3.
Nature Medicine 1995;1:570-577.
Deltour S, Guérardel C, Leprince D. Recruitment of SMRT/NCoR-mSin3A-HDAC-repressing complexes is not a general
mechanism for BTB/POZ transcriptional repressors: the case
of HIC-1 and gammaFBP-B. Proc Natl Acad Sci (USA)
1999;96:14831-14836.
Zhang Q, Wang SH, Fleuriel C, Leprince D, Rocheleau JV,
Piston DW, Goodman RH. Metabolic regulation of SIRT1
transcription via a HIC1:CtBP corepressor complex. Proc Natl
Acad Sci (USA) 2007;104:829-33.
Grimm C, Spörle R,.Schmid TE, Adler ID, Adamski J,
Schughart K, Graw J. Isolation and embryonic expression of
the novel mouse gene Hic1, the homologue of HIC1, a
candidate gene for the Miller-Dieker syndrome. Hum Mol
Genet 1999;8:697-710.
This article should be referenced as such:
Leprince D. HIC1 (hypermethylated in cancer 1). Atlas Genet
Cytogenet Oncol Haematol.2007;11(3):192-193.
Carter MG, Johns MA, Zeng X, Zhou L, Zink MC, Mankowski
JL, Donovan DM, Baylin SB. Mice deficient in the candidate
Atlas Genet Cytogenet Oncol Haematol. 2007;11(3)
M, Zhao Z,
Andrulis IL,
and genetic
of p53 in
193
Atlas of Genetics and Cytogenetics
in Oncology and Haematology
OPEN ACCESS JOURNAL AT INIST-CNRS
Gene Section
Mini Review
HSPD1 (heat shock 60kDa protein 1)
Ahmad Faried, Leri S Faried
Department of General Surgical Science (Surgery I), Graduate School of Medicine, Gunma University,
Maebashi, Japan
Published in Atlas Database: February 2007
Online updated version: http://AtlasGeneticsOncology.org/Genes/HSPD1ID40888ch2q33.html
DOI: 10.4267/2042/38438
This work is licensed under a Creative Commons Attribution-Non-commercial-No Derivative Works 2.0 France Licence.
© 2007 Atlas of Genetics and Cytogenetics in Oncology and Haematology
HSP60 family have the ring-shape oligomeric protein
complex with a large central cavity, and composed of
14 proteins which organized into two 7-protein ring
that are stacked on each other like double donut. This
structure is reversible dissociate in the presence of
Mg2+ and ATP, ATPase activity, and have role in
folding and assembly of oligomeric protein structures.
Identity
Hugo: HSPD1
Other names: HSP60; HSP65; HuCHA60; Chaperonin
60kDa (CPN60); GROEL; SPG13
Location: 2q33.1
DNA/RNA
Expression
HSP60 expression is ubiquitous in the pre-natal,
different organ system, immune system, blood,
epithelial tissue and cells.
Description
The HSP60 gene contains 12 exons and 11 introns and
was predicted to span over approximately 13 kb of the
genomic DNA. The first exon is non-coding region.
Localisation
Mainly in the mitochondria, but growing body of
evidence showed that there are also extra-mitochondrial
such as in the cell surface, peroxisomes and the
endoplasmic reticulum.
Transcription
Two transcript variants encoding the same protein have
been identified for HSP60 gene. This variant which
was named HSP60s1 and HSP60s2 (s for short)
comparing it to the much longer regular HSP60 gene.
Function
Assisting mitochondrial protein folding, unfolding, and
degradation.
HSP60 also have anti-apoptosis and pro-apoptosis
roles.
Pseudogene
Twelve pseudogenes located on chromosome 3, 4, 5, 6,
8 and 12 have been associated with HSP60.
Protein
Homology
Up to now more than 150 homologues of HSP60
sequences with pair-wise similarity extending from 40100% at the amino acid level. Among them: in rat
(Rattus norvegicus), pufferfish (Fugu rubripes),
zebrafish (Danio rerio), the nematode Caenorhabditis
elegans and the mouse (Mus musculus).
Description
The HSP60 consists of 573 amino acids corresponding
to a molecular weight of 61.05 kDa. The HSP60
proteins are ubiquitous abundant proteins of eubacterial
genomes and also known as the Chaperonin. The
Chapenonins divided into 2 subfamilies:
Type I (HSP60/GROEL) and type II (TCP-1 ring
complex).
Type I are present in prokaryotes (eubacteria) and
organelles (mitochondria and chloroplast).
Type II are presents in archabacteria and in the
eukaryotic cytosol.
Atlas Genet Cytogenet Oncol Haematol. 2007;11(3)
Mutations
Germinal
Not known in Homo sapiens.
194
HSPD1 (heat shock 60kDa protein 1)
Faried A, Faried LS
Somatic
References
Hereditary spastic paraplegia (SPG13) is associated
with a mutation in the HSP60 gene: The amino acid 72
Valine is changed to Isoleucin.
In Sudden Death Infant Syndrome (SIDS), there are
two mutations reported in the coding region of HSP60:
N158S and G573A.
Jindal S, Dudani A K, Singh B, Harley C B, Gupta RS. Primary
structure of a human mitochondrial protein homologous to the
bacterial and plant chaperonins and to the 65-kilodalton
mycobacterial antigen. Mol Cell Biol 1989;9:2279-2283.
Cheng MY, Hartl FU, Horwich AL. The mitochondrial
chaperonin HSP60 is required for its own assembly. Nature
1990;348:455-458.
Implicated in
Venner TJ, Singh B, Gupta RS. Nucleotide sequences and
novel structural features of human and Chinese hamster
HSP60 (chaperonin) gene families. DNA Cell Biol 1990;9:545:
52.
Various carcinomas
Disease
HSP60 reported to be over-expressed in exo-cervix
cancer, colorectal cancer and prostate carcinoma. But
down-regulate its expression in bladder cancer and lung
carcinoma.
Prognosis
Controversy; worse prognosis in bladder cancer and
acute myeloid leukemia. Others shows favorable
prognosis, such as in ovarian cancer, osteo sarcoma and
esophageal cancer.
Oncogenesis
The discrepancy of HSP60 expression and/or prognosis
during carcinogenesis might be due to its pro- and antiapoptotic roles in the cancer cells. The cytosolic and
organellar forms of HSP60 might explain the anti- and
pro-apoptotic roles.
Koll H, Guiard B, Rassow J, Ostermann J, Horwich AL,
Neupert W, Hartl FU. Antifolding activity of HSP60 couples
protein import into the mitochondrial matrix with export to the
intermembrane space. Cell 1992;68:1163-1175.
Diseases linked to deficiency of HSP60
Ranford JC, Coates AR, Henderson B. Chaperonins are cellsignaling proteins: the unfolding biology of molecular
chaperones. Expert Rev Mol Med 2000;15:1-17.
Gupta RS. Evolution of the chaperonin families (HSP60,
HSP10 and TCP-1) of proteins and the origin of eukaryotic
cells. Mol Microbiol 1995;15:1-11.
Pochon NA, Mach B. Genetic complexity of the human HSP60
gene. Int Immunol 1996;8:221-230.
Ryan MT, Herd SM, Sberna G, Samuel MM, Hoogenraad NJ,
Høj PB. The genes encoding mammalian chaperonin60 and
chaperonin10 are linked head-to-head and share a
bidirectional promoter. Gene 1997;196:9-17.
Bukau B, Horwich AL. The HSP70 and HSP60 chaperone
machine. Cell 1998;92:351-366.
Fink AL. Chaperone-mediated protein folding. Physiol Rev
1999;70:425-449.
Soltys BJ, Gupta RS. Mitochondrial-matrix proteins at
unexpected locations: are they exported?. Trends Biochem Sci
1999;24:174-177.
Disease
There is a few reports on HSP60 deficiency in human.
Studies reported a patient with systemic mitochondrial
encephalopathy, which had lower HSP60 concentration
than normal person.
Another HSP60 deficient patient presented with
congenital lactic acidemia.
In short chain acyl-CoA dehydrogenase, SCAD.
HSP deficiency also reported in fibroblast derived from
a patient with a fatal systemic mitochondrial disease
leading to deficiency of multiple mitochondrial enzyme
and mitochondrial abnormality.
Bross P., et al. Absence of prevalent sequence variations in
the HSP60 and HSP10 chaperonin genes in 65 cases of
Sudden Infant Death Syndrome (SIDS). Am J Hum Genet
2001;69 (Suppl):pp2193.
Slavotinek AM, Biesecker LG. Unfolding the role of chaperones
and chaperonins in human disease. Trends Genet
2001;17:528-535.
Srivastava PK, Amato RJ. Heat shock proteins: the 'Swiss
Army Knife' vaccines against cancers and infectious agents.
Vaccine 2001;19:2590-2597.
Thirumalai D, Lorimer GH. Chaperonin-mediated protein
folding. Annu Rev Biophys Biomol Struct 2001;30:245-269.
Hansen JJ, Dürr A, Cournu-Rebeix I, Georgopoulos C, Ang D,
Nielsen MN, Davoine CS, Brice A, Fontaine B, Gregersen N,
Bross P. Hereditary Spastic Paraplegia SPG13 is associated
with a mutation in the gene encoding the mitochondrial
chaperonin HSP60. Am J Hum Genet 2002;70:1328-1332.
Autoimmune diseases
Note: First clinical trials using HSP60 (peptide 277)
has been tested in type-2 diabetes.
Disease
HSP60 have been implicated in T cell activation and
cause inflammatory reaction. It involved in the
pathogenesis of a number of autoimmune diseases in
inflammatory conditions such as type-1 diabetes,
juvenile chronic arthritis, atherosclerosis, Cohn disease,
autoimmunity in women, rheumatoid arthritis, systemic
lupus erythematodes, Sjogren syndrome and mix
connective tissue diseases.
Atlas Genet Cytogenet Oncol Haematol. 2007;11(3)
Maguire M, Coates AR, Henderson B. Chaperonin60 unfolds
its secrets of cellular communication. Cell Stress Chaperones
2002;7:317-329.
Ranford JC, Henderson B. Chaperonins in diseases:
mechanisms, models, and treatment. Mol Pathol 2002;55:209213.
Teske A., et al. Investigating a possible relation between the
amino acid variation N158S of the human heat shock protein
HSP60 and increased susceptibility to Sudden Infant Death
Syndrome (SIDS). Am J Hum Genet 2002;71 (Suppl):pp503.
195
HSPD1 (heat shock 60kDa protein 1)
Faried A, Faried LS
Hansen JJ, Bross P, Westergaard M, Nielsen MN, Eiberg H,
Børglum AD, Mogensen J, Kristiansen K, Bolund L, Gregersen
N. Genomic structure of the human mitochondrial chaperonin
genes: HSP60 and HSP10 are localized head to head on
chromosome 2 separated by a bidirectional promoter. Hum
Genet 2003;112:71-77.
Bross P, Li Z, Hansen J, Hansen JJ, Nielsen MN, Corydon TJ,
Georgopoulos C, Ang D, Lundemose JB, Niezen-Koning K,
Eiberg H, Yang H, Kølvraa S, Bolund L, Gregersen N. Singlenucleotide variations in the genes encoding the mitochondrial
Hsp60/Hsp10 chaperone system and their disease-causing
potential. J Hum Genet 2007;52:56-65.
Czarnecka AM, Campanella C, Zummo G, Cappello F.
Mitochondrial chaperones in cancer: from molecular biology to
clinical diagnostics. Cancer Biol Ther 2006;5:714-720.
Atlas Genet Cytogenet Oncol Haematol. 2007;11(3)
This article should be referenced as such:
Faried A, Faried LS. HSPD1 (heat shock 60kDa protein 1).
Atlas Genet Cytogenet Oncol Haematol.2007;11(3):194-196.
196
Atlas of Genetics and Cytogenetics
in Oncology and Haematology
OPEN ACCESS JOURNAL AT INIST-CNRS
Gene Section
Mini Review
HSPH1 (heat shock 105kDa/110kDa protein 1)
Takumi Hatayama, Nobuyuki Yamagishi
Department of Biochemistry, Kyoto Pharmaceutical University, Misasagi, Yamashina, Kyoto 607-8414,
Japan
Published in Atlas Database: February 2007
Online updated version: http://AtlasGeneticsOncology.org/Genes/HSPH1ID40891ch13q12.html
DOI: 10.4267/2042/38439
This work is licensed under a Creative Commons Attribution-Non-commercial-No Derivative Works 2.0 France Licence.
© 2007 Atlas of Genetics and Cytogenetics in Oncology and Haematology
Identity
DNA/RNA
Hugo: HSPH1
Other names: HSP105alpha; HSP105beta; HSP110;
HSP105; KIAA0201; NY-CO-25
Location: 13q12.3
Description
18 exons on 22 kb.
Transcription
Hsp105alpha is transcribed constitutively and also by a
variety of stresses. 4 kb mRNA Hsp105beta is an
alternative spliced isoform only produced during heat
shock at 42 degree.
Genomic organization of the mouse HSP105 gene. The linear map of the exon-intron structure is shown schematically. Exons are
represented as numbered boxes. Two alternative splicing patterns gave rise to HSP105alpha and HSP105beta transcripts. ATG and
TAG indicate the positions of initiation and termination codons, respectively. (DDBJ/EMBL/GenBank DNA databases with accession
Nos. AB005267-AB005282).
Shematic structures of HSP105alpha and HSP105beta proteins. Shaded box represents the spliced out region of HSP105alpha which is
lacking in HSP105beta.
Atlas Genet Cytogenet Oncol Haematol. 2007;11(3)
197
HSPH1 (heat shock 105kDa/110kDa protein 1)
Hatayama T, Yamagishi N
Protein
References
Description
Yasuda K, Nakai A, Hatayama T, Nagata K. Cloning and
expression of murine high molecular mass heat shock proteins,
HSP105. J. Biol. Chem 1995;270:29718-29723.
Hsp105alpha: 858 amino acids, 105 kDa; contains an
ATP binding domain (residues 1-383), b-sheet domain
(residues 384-511), loop domain (residues 512-607)
and alpha-helix domain (residues 608-858).
Hsp105beta: 814 amino acids, 90 kDa; contains an
ATP binding domain (residues 1-383), b-sheet domain
(residues 384-511), loop domain (residues 512-563)
and alpha-helix domain (residues 564-814).
Ishihara K, Yasuda K, Hatayama T. Molecular cloning,
expression and localization of human 105 kDa heat shock
protein, hsp105. Biochim Biophys Acta 1999;1444:138-142.
Yasuda K, Ishihara K, Nakashima K, Hatayama T. Genomic
cloning and promoter analysis of mouse 105-kda heat shock
protein (HSP105) gene. Biochem Biophys Res Commun
1999;256:7580.
Nakatsura T, Senju S, Yamada K, Jotsuka T, Ogawa M,
Nishimura Y. Gene cloning of immunogenic antigens
overexpressed in pancreatic cancer. Biochem Biophys Res
Commun 2001;281:936-944.
Expression
Wide, highly expressed in brain.
Hwang TS, Han HS, Choi HK, Lee YJ, Kim YJ, Han MY, Park
YM. Differential, stage-dependent expression of Hsp70,
Hsp110 and Bcl-2 in colorectal cancer. J. Gastroenterol.
Hepatol 2003;18:690-700.
Localisation
Hsp105alpha, cytoplasmic; Hsp105beta, nuclear.
Function
Kai M, Nakatsura T, Egami H, Senju S, Nishimura Y, Ogawa
M. Heat shock protein 105 is overexpressed in a variety of
human tumors. Oncol Rep 2003;10:1777-1782.
Hsp105alpha and Hsp105beta suppress the aggregation
of denatured proteins; function as a substitute for
Hsp70 family proteins to suppress the aggregation of
denatured proteins in cells under severe stress; regulate
substrate binding cycle of Hsp70/Hsc70 by inhibiting
the ATPase activity of Hsp70/Hsc70.
Yamagishi N, Ishihara K, Saito Y, Hatayama T. Hsp105 but not
Hsp70 family proteins suppress the aggregation of heatdenatured protein in the presence of ADP. FEBS Lett
2003;555:390-396.
Yamagishi, N, Ishihara, K, Hatayama T. Hsp105alpha
suppresses Hsc70 chaperone activity by inhibiting Hsc70
ATPase activity. J. Biol. Chem 2004;279:41727-41733.
Homology
With mouse apg-1, mouse apg-2, sea urchin egg
receptor, C. elegans 86.9-kDa protein, A. thaliana
hsp91 and S. cerevisiae SSE1, human hsp70 and human
hsc70.
Miyazaki M, Nakatsura T, Yokomine K, Senju S, Monji M,
Hosaka S, Komori H, Yoshitake Y, Motomura Y, Minohara M,
Kubo T, Ishihara K, Hatayama T, Ogawa M, Nishimura Y. DNA
vaccination of HSP105 leads to tumor rejection of colorectal
cancer and melanoma in mice through activation of both CD4+
T cells and CD8+ T cells. Cancer Sci 2005;96:695-705.
Implicated in
Yamagishi, N, Ishihara, K, Saito, Y, Hatayama T. Hsp105
family proteins suppress staurosporine-induced apoptosis by
inhibiting the translocation of Bax to mitochondria in HeLa
cells. Exp. Cell Res 2006;312:3215-3223.
Lung cancers
Prognosis
Poor.
Oncogenesis
Low expression of hsp105 was identified as predictors
of survival in lung adenocarcinomas.
Hosaka S, Nakatsura T, Tsukamoto H, Hatayama T, Baba H,
Nishimura Y. Synthetic small interfering RNA targeting heat
shock protein 105 induces apoptosis of various cancer cells
both in vitro and in vivo. Cancer Sci 2006;97:623-632.
Muchemwa FC, Nakatsura T, Ihn H, Kageshita T. Heat shock
protein 105 is overexpressed in squamous cell carcinoma and
extramammary Paget disease but not in basal cell carcinoma.
Br J Dermatol 2006;155:582-585.
Colorectal cancers
Prognosis
Survival is not much more than 50% after 5 years.
Oncogenesis
Overexpression of hsp105 is a late event in the
colorectal adenoma-carcinoma sequence.
Atlas Genet Cytogenet Oncol Haematol. 2007;11(3)
This article should be referenced as such:
Hatayama T, Yamagishi N. HSPH1 (heat shock
105kDa/110kDa protein 1). Atlas Genet Cytogenet Oncol
Haematol.2007;11(3):197-198.
198
Atlas of Genetics and Cytogenetics
in Oncology and Haematology
OPEN ACCESS JOURNAL AT INIST-CNRS
Gene Section
Mini Review
JAG2 (human jagged2)
Pushpankur Ghoshal, Lionel J Coignet
Department of Cancer Genetics, Roswell Park Cancer Institute, Elm & Carlton Streets, Buffalo, NY 14263,
USA
Published in Atlas Database: February 2007
Online updated version: http://AtlasGeneticsOncology.org/Genes/JAG2ID41030ch14q32.html
DOI: 10.4267/2042/38440
This work is licensed under a Creative Commons Attribution-Non-commercial-No Derivative Works 2.0 France Licence.
© 2007 Atlas of Genetics and Cytogenetics in Oncology and Haematology
Expression
Identity
In human, JAG2 is expressed at high levels in the heart,
the skeletal muscle and the pancreas.
Hugo: JAG2
Other names: HJ2; Jagged2
Location: Human Jagged2 (jag2), a ligand for Notch
receptor, was mapped in the chromosomal region
14q32.
Implicated in
Multiple Myeloma
Disease
The NOTCH ligand, JAG2, has been found to be
overexpressed in malignant plasma cells from multiple
myeloma (MM) patients and cell lines but not in
nonmalignant plasma cells from tonsils, bone marrow
from healthy individuals, or patients with other
malignancies. Since MM cells have been shown to
induce IL-6 expression in stromal cells in a largely cell
contact-dependent manner, it has been concluded that
MM cells induce production of IL-6 in stromal cells
through overexpression of JAG2. Once secreted, IL-6
enhances proliferation of myeloma cells in a paracrine
fashion.
Oncogenesis
The induction of IL-6 secretion has been blocked in
vitro by interference with anti-Notch-1 monoclonal
antibodies raised against the binding sequence of
Notch-1 with JAG2. Taken together, these results
indicate that JAG2 over expression may be an early
event in the pathogenesis of multiple myeloma
involving IL-6 production.
DNA/RNA
Description
Human Jagged2 gene contains approximately 5,077 bps
including 26 exons and a putative promoter region. In
addition to a TATA box and a CAC binding site, the
promoter region also contains several transcription
factor binding sites like NF-kappaB, E47, E12, E2F etc.
JAG2 gene has a structural similarity (overall 62% at
nucleotide level) with JAG1, though JAG1 is located at
chromosomal region 20p12.
Protein
Description
The predicted JAG2 protein is approximately 1,238amino acid long. It has several recognizable motifs,
including a signal peptide, 16 EGF-like repeats, a
transmembrane domain, and a short cytoplasmic
domain.
Atlas Genet Cytogenet Oncol Haematol. 2007;11(3)
199
JAG2 (human jagged2)
Ghoshal P, Coignet LJ
Schematic representation of the physiological activation of NOTCH, with Cell 1 (MM plasma cell) expressing JAG2 and Cell 2 (Stromal
cell) NOTCH.
A: JAG2 binds NOTCH via cell-to-cell contact.
B: Binding of JAG2 induces a proteolytic cleavage of the intracellular part of NOTCH (NOTCH-IC).
C: Once cleaved, NOTCH-IC is translocated into the nucleus.
D: Once in the nucleus, NOTCH-IC will be able to bind to downstream effectors such as CBF1, to activate, for example, the IL-6 gene
transcription.
and promotes the survival and proliferation of hematopoietic
progenitors by direct cell-to-cell contact. Blood 2000;96:950957.
References
Lan Y, Jiang R, Shawber C, Weinmaster G, Gridley T. The
Jagged2 gene maps to chromosome 12 and is a candidate for
the lgl and sm mutations. Mammalian Genome 1997;8:875876.
Ikeuchi T, Sisodia SS. The notch ligands, delta-1 and jagged-2,
are substrates for presenilin-dependent gamma-secretase
cleavage. J. Biol. Chem 2003;278:7751-7754.
Houde C, Li Y, Song L, Barton K, Zhang Q, Godwin J, Nand S,
Toor A, Alkan S, Smadja NV, Avet-Loiseau H, Lima CS, Miele
L, Coignet LJ. Overexpression of the NOTCH ligand JAG2 in
malignant plasma cells from multiple myeloma patients and cell
lines. Blood 2004;104:(12), 3697-3704.
Gray GE, Mann RS, Mitsiadis E, Henrique D, Carcangiu ML,
Banks A, Leiman J, Ward D, Ish-Horowitz D, ArtavanisTsakonas S. Human ligands of the Notch receptor. Am. J. Path
1999;154:785-794.
Deng Y, Madan A, Banta AB, Friedman C, Trask BJ, Hood L,
Li L. Characterization, chromosomal localization, and the
complete 30-kb DNA sequence of the human Jagged2 (JAG2)
gene. Genomics 2000;63:133-138.
This article should be referenced as such:
Ghoshal P, Coignet LJ. JAG2 (human jagged2). Atlas Genet
Cytogenet Oncol Haematol.2007;11(3):199-200.
Tsai S, Fero J, Bartelmez S. Mouse Jagged2 is differentially
expressed in hematopoietic progenitors and endothelial cells
Atlas Genet Cytogenet Oncol Haematol. 2007;11(3)
200
Atlas of Genetics and Cytogenetics
in Oncology and Haematology
OPEN ACCESS JOURNAL AT INIST-CNRS
Gene Section
Review
MUC4 (mucin 4, cell surface associated)
Nicolas Moniaux, Pallavi Chaturvedi, Isabelle Van Seuningen, Nicole Porchet, Ajay P Singh,
Surinder K Batra
Department of Biochemistry and Molecular Biology, College of Medicine, Eppley Cancer Institute, 7052
DRC, University of Nebraska Medical Center, 985870 Nebraska Medical Center, Omaha, NE 68198-5870,
USA
Published in Atlas Database: February 2007
Online updated version: http://AtlasGeneticsOncology.org/Genes/MUC4ID41459ch3q29.html
DOI: 10.4267/2042/38441
This work is licensed under a Creative Commons Attribution-Non-commercial-No Derivative Works 2.0 France Licence.
© 2007 Atlas of Genetics and Cytogenetics in Oncology and Haematology
Identity
transcripts have been identified for MUC4 gene, coding
for membrane-anchored and secreted forms.
Hugo: MUC4
Other names: sv0-MUC4
Location: 3q29
Note: MUC4 belongs to the human mucin family, and
more specifically to the subgroup of the membraneanchored mucin. It is an O-glycoprotein that can extend
up to 2 micrometer over the cell membrane. It is
suggested that MUC4 is translated as a single precursor
polypeptide, which is further cleaved at a GDPH site in
two subunits, MUC4a and MUC4b. MUC4a is the
mucin type subunit and MUC4b is the membranebound growth factor like subunit. Both subunits remain
non-covalently associated. MUC4 is also found in
several secretions such as in the milk. MUC4 along
with other mucins is part of the mucus, the viscous gel
that covers, moisturizes, and protects all epithelial
surfaces.
Description
MUC4 gene spans on a 70 kb-long DNA fragment
located in 3q29 at the position 196959310-197023545.
This position varies from individual to individual due
to VNTR polymorphism of several sequences repeated
in tandem. The largest domain repeated in tandem is
localized in exon 2 and is composed of a motif of 48
bp, repeated up to 400 times. This domain varies from
7 to 19 kb. Three other sequences repeated in tandem
with a motif of 15 bp, 26 to 32 bp and 32 bp are
positioned in introns 3, 4, and 5 respectively. Theses
sequences present also VNTR polymorphism.
Various SNPs are reported for MUC4 coding sequence;
however, either VNTR or SNP polymorphism have
been associated with specific physiological condition or
disease.
Transcription
DNA/RNA
MUC4 is transcribed in at least 24 distinct splice
variant forms in normal and malignant human tissues.
Twenty-two of these variants are generated by
alternative splicing of the exons at the 3'-extremity and
are referred sv1- to sv21-MUC4. Two splice forms are
generated by alternative splicing of exon 2 and are
called MUC4/X and MUC4/Y. So far, it is unknown if
these splice forms are translated, however their
deduced amino acid composition leads to secreted and
membrane-anchored proteins. The main isoform of
MUC4 (up to 27.5 kb in size), referred to as sv0MUC4, encodes for full-length MUC4 protein.
MUC4 5'-flanking region (over 3.7 kb upstream of the
first ATG) has been characterized.
Note: MUC4 gene is located on the chromosome 3 in
the region q29, oriented from telomere to centromere
and clustered with another mucin gene MUC20. MUC4
is highly polymorphic, harboring numerous sequences
repeated in tandem and presenting variable number of
tandem repeat (VNTR) polymorphism. The sequence
repeated in tandem is localized in exon 2 and is
composed of a 48 bp repetitive unit. Due to this highly
variable region 27 distinct alleles have been identified
for MUC4. Among these, three alleles represent 78.6%
of all alleles detected: the 19 kb, 10.5 kb, and 15 kb
that present a prevalence of 47%, 18%, and 13.6 %
respectively. In addition, 24 alternatively splice
Atlas Genet Cytogenet Oncol Haematol. 2007;11(3)
201
MUC4 (mucin 4, cell surface associated)
Moniaux N et al.
A: Schematic representation of MUC4 gene and mRNA. The representation is not drawn to scale.
B: Example of VTNR polymorphism associated with MUC4 gene. The gDNA of 18 healthy individuals was extracted from the PBMCs
and digested by ECORI and PstI endonucleases. Southern blot was hybridized with [32] P-radiolabeled probes of each sequence
repeated in tandem.
Atlas Genet Cytogenet Oncol Haematol. 2007;11(3)
202
MUC4 (mucin 4, cell surface associated)
Moniaux N et al.
Two transcriptionally active units drive MUC4
expression. The proximal promoter is TATA-less,
possesses a transcription initiation site at -199, and is
mainly composed of GC-rich domains that are potential
binding sites for Sp1 and the CACCC box binding
protein. Furthermore, a very high density of binding
sites for factors known to initiate transcription in
TATA-less promoters (Sp1, CACCC box, GRE, AP-1,
PEA3 and Med-1) was found within that promoter. The
distal promoter is flanked by a TATA box located at 2672/-2668 and three transcriptional initiation sites at 2603, -2604 and -2605. Responsive regions and ciselements for transcription factors involved in Protein
Kinase A, Protein Kinase C, cAMP signaling pathways,
in inflammation (NF-kB) and in intestinal (HNF-1,
HNF-3, HNF4A, GATA4, GATA-6, CDX1, CDX2)
and respiratory (TITF1, GATA-6, HNF-3b) epithelial
cell differentiation have also been identified.
Altogether, these results suggest that MUC4
transcription is complex, tightly regulated and involves
many signaling pathways.
transmembrane sequence, and a small 22 amino acids
long cytoplasmic tail.
Expression
MUC4 expression is developmentally regulated. In
normal physiologic conditions, MUC4 is expressed in
the epithelium of the respiratory, digestive and
urogenital tracts, with level that varies from tissue to
tissues. In the respiratory tract, MUC4 is strongly
expressed in the trachea and the lung. In the digestive
tract, its main pattern of expression is the oesophagus
and the colon. However, MUC4 is not expressed by the
annex of the digestive tract such as the liver, the
pancreas, and the gallbladder. MUC4 is also expressed
by the epithelial cells of the ocular and auditory
systems.
MUC4 is overexpressed or aberrantly expressed in
several diseases, such as inflammatory bowel diseases
(Crohn or ulcerative colitis) and malignancy. For
instance, MUC4 is overexpressed in lung, oesophagus,
and colon cancer and is aberrantly expressed in
pancreatic cancer. Neoexpression of MUC4 is observed
early in precancerous pancreatic intraepithelial
neoplastic lesions that further correlates with the
disease progression stages.
Many studies has been conducted on human pancreatic
or other cancer cell lines in order to elucidate molecular
mechanisms responsible for aberrant expression of
MUC4 in diseased condition. Initial studies about
MUC4 transcriptional regulation showed that Sp1 and
Sp3 were important regulators of MUC4 basal
expression. EGF and TGF-b growth factors and PKC
signaling pathway stimulation results in up regulation
of the promoter activity. Whereas TNF-a and IFN-g
inflammatory cytokines alone had no effect on MUC4
transcriptional activity, a strong synergistic effect
between IFN-g and TNF-a or IFN-g and TGF-b was
observed. Activation by IFN-g was then showed to be
mediated by STAT-1. More recently, Th1 (IL-2) and
Th2 (IL-12, IL-10) cytokines were shown to interfere
with pancreatic tumorigenic environment and possibly
modulate MUC4 expression. Subsequent studies aimed
at deciphering MUC4 regulation by TGF-b pathway
showed that it could be either Smad4-dependent,
Smad4-independent (MAPK, PKA, PKC). Retinoic
acid induced MUC4 expression was mediated by TGFb2 and involved RAR-a. TGF-b2 expression in vivo also
correlated with that of MUC4 in pancreatic tumors.
Interestingly, recent data have shown that MUC4 is
negatively regulated by cystic fibrosis transmembrane
regulator (CFTR), a chloride channel that is defective
in CF.
In oesophageal cancer cells, MUC4 is regulated by bile
acids via activation of phosphatidylinositol 3-kinase
pathway or activation of HNF-1a.
Studies in lung adenocarcinoma cell lines focused on
cytokines involved in airway inflammation showed that
MUC4 is regulated by IL-4 via JAK-3 and IL-9.
Protein
Note: MUC4 is a high molecular weight Oglycoprotein. Molecular weight for precursor fulllength MUC4 protein may range between 550-930 kDa
depending upon the VNTR polymorphism.
Classically, the protein moiety represents 20% of the
mucin mature molecular weight, leading to a fully
glycosylated protein of 4,650 kDa.
Description
MUC4 is synthesized as a precursor cleaved in two
subunits that remain non-covalently link to each other:
the mucin type subunit MUC4a of 850 kDa and the
membrane-bound growth factor like subunit MUC4b of
80 kDa. MUC4 is a modular protein, composed of very
distinct domains.
MUC4a is rich in serine, threonine, and proline
residues and present a central domain composed of 16
amino acids repeated in tandem up to 400 times. This
repetitive domain is the hallmark of the mucin family.
The carboxy-extremity of MUC4a harbors a NIDO and
an AMOP domain. The NIDO domain is a domain
identified in the nidogen protein and present in several
proteins such as the tumor endothelial marker TEM7.
TEM7 plays a role in angiogenesis via its NIDO
domain. The AMOP domain (adhesion-associated
domain in MUC4 and other proteins) is suggested to
have a role in cell adhesion. In addition to the AMOP
and NIDO domains, analysis of the MUC4a sequence
reveals a high degree of similarity with a von
Willebrand factor (vWF) D domain. However, none of
the cysteine residues that characterized a vWF D
domain are conserved in the MUC4 sequence.
The MUC4b subunit contains two domains rich in Nglycosylation sites, 3 EGF-like domains, a
Atlas Genet Cytogenet Oncol Haematol. 2007;11(3)
203
MUC4 (mucin 4, cell surface associated)
Moniaux N et al.
A: Schematic representation of the modular structure of MUC4.
B: Schematic representation of MUC4 protein. The representation is not drawn to scale.
Identification of the molecular mechanisms governing
MUC4 expression will be very informative to assign
direct roles to that mucin in carcinogenesis and on the
biological properties of the tumor cell and should
provide new tools in the future for therapeutic
intervention.
MUC4 is also the putative ligand of ERBB2 oncogenic
receptor and thus may participate in cell signalling,
influence cell proliferation, tumor progression, tumor
cell morphology, cell polarity and escape to immune
surveillance. Moreover, its over-expression in
numerous cancers (lung, oesophagus, intestine,
pancreas, etc.) is often associated with a poor
prognosis. Functional role of MUC4 in pancreatic
tumor growth and metastasis has also been recently
demonstrated.
MUC4 consists of two subunits, the extracellular highly
glycosylated mucin subunit (MUC4-a) and a
transmembrane subunit containing three EGF-like
domains (MUC4-b). These subunits of MUC4 may
confer diverse functions to MUC4. The large sized
extracellular subunit may provide the anti-adhesive or
adhesive functions. The anti-adhesive function of
MUC4 may aid in loosening the tumor cell-ECM
interactions and facilitating the dissemination of tumor
cells. Whereas, the high degree of glycosylation present
Localisation
In normal physiologic situation, MUC4 is localized in
the membrane at the apical region of the cells and in
the mucus secretion. During cancer development,
MUC4 exhibits diffuse expression in both the
membrane and cytoplasm. Furthermore, due to loss of
cell polarity, defined apical localization of MUC4 is
disrupted.
Function
MUC4 transmembrane mucin is a highly glycosylated
protein with an extended rigid extracellular domain that
may confer a role for MUC4 as a molecular sensor
between the extracellular milieu and the epithelial cell.
Atlas Genet Cytogenet Oncol Haematol. 2007;11(3)
204
MUC4 (mucin 4, cell surface associated)
Moniaux N et al.
in tandem repeat domain of MUC4 mucin can help in
the adhesion of tumor cells to secondary sites and
hence promote metastasis.
Another important function provided by MUC4 mucin
is modulation of HER-2/ERBB2 mediated signaling.
MUC4, an interaction partner of the proto-oncogene
HER2, induces its localization at the cell membrane
and triggers the signaling pathways downstream to
HER-2 activation. The consequences of such
interactions and signaling activation lead to malignant
transformation. Hence, dysregulation of MUC4
expression, a protective cell surface protein, may have
deleterious effects. The association of MUC4 with
ERBB2 involves its translocation from the basolateral
toward the apical membrane and increasing the
membrane stability. Regulation of MUC4 and ERBB2
by PEA3 transcription factor was found to be
conversely correlated, stressing the fact that balance
between MUC4 and ErbB2 will orientate the tumor cell
toward either differentiation or proliferation.
Under normal physiological conditions, MUC4
provides protection, lubrication and moisturization to
the epithelial surfaces by trapping the foreign particles
and preventing their accessibility to the cells. Being
expressed in fetus tissue before differentiation, MUC4
is also suggested to play role in morphogenic functions.
Oncogenesis
In in vivo model, MUC4 was shown to promote tumor
progression and metastasis. On clinical sample, patients
negative for MUC4 expression has a better prognosis
and a longer life time.
References
Gross MS, Guyonnet-Duperat V, Porchet N, Bernheim A,
Aubert JP, Nguyen VC. Mucin 4 (MUC4) gene: regional
assignment (3q29) and RFLP analysis. Ann Genet 1992;35:2126.
Buisine MP, Devisme L, Savidge TC, Gespach C, Gosselin B,
Porchet N, Aubert JP. Mucin gene expression in human
embryonic and fetal intestine. Gut 1998;43(4):519-524.
Nollet S, Moniaux N, Maury J, Petitprez D, Degand P, Laine A,
Porchet N, Aubert JP. Human mucin gene MUC4: organization
of its 5'-region and polymorphism of its central tandem repeat
array. Biochem J 1998;332:739-748.
Buisine MP, Devisme L, Copin MC, Durand-Réville M,
Gosselin B, Aubert JP, Porchet N. Developmental mucin gene
expression in the human respiratory tract. Am J Respir Cell
Mol Biol 1999;20(2):209-218.
Gipson IK, Spurr-Michaud S, Moccia R, Zhan Q, Toribara N,
Ho SB, Gargiulo AR, Hill JA. MUC4 and MUC5B transcripts
are the prevalent mucin messenger ribonucleic acids of the
human endocervix. Biol Reprod 1999;60:58-64.
Moniaux N, Nollet S, Porchet N, Degand P, Laine A, Aubert
JP. Complete sequence of the human mucin MUC4: a putative
cell membrane-associated mucin. Biochem J 1999;338:325333.
Homology
Several orthologues of MUC4 are totally or partially
characterized. Mouse (mMuc4) and rat (rMuc4 or SMC
for sialomucin complex) are fully identified and present
60 to 70% homology with human MUC4. Mouse
mMuc4 is localized on the chromosome 16. Partial
cDNA sequences of porcine, chinchilla, monkey, and
dog Muc4 were also recently identified.
Buisine MP, Devisme L, Degand P, Dieu MC, Gosselin B,
Copin MC, Aubert JP, Porchet N. Developmental mucin gene
expression in the gastroduodenal tract and accessory digestive
glands. II. Duodenum and liver, gallbladder, and pancreas. J
Histochem Cytochem 2000;48(12):1667-1676.
Buisine MP, Devisme L, Maunoury V, Deschodt E, Gosselin B,
Copin MC, Aubert JP, Porchet N. Developmental mucin gene
expression in the gastroduodenal tract and accessory digestive
glands. I. Stomach. A relationship to gastric carcinoma. J
Histochem Cytochem 2000;48(12):1657-1666.
Implicated in
Choudhury A, Singh RK, Moniaux N, El-Metwally TH, Aubert
JP, Batra SK. Retinoic Acid Dependent Transforming Growth
Factor-beta2-Mediated Induction of MUC4 Mucin Expression in
Human Pancreatic Tumor Cells Follows Retinoic Acid
Receptor-alpha
Signaling
Pathway.
J
Biol
Chem
2000;275:33929-33936.
Pancreatic adenocarcinoma
Disease
Worldwide, pancreatic cancer is the eleventh most
common cancer and the fourth leading cause of cancer
related death among men and women. Pancreatic
cancer presents a 5-years survival rate of 5%. The
incidence and age-adjusted mortality rate are almost
equal, underscoring the aggressive nature of the
disease.
Prognosis
The DU-PAN-2 antibody that recognizes a tumorassociated antigen carries by the MUC4 protein is in
clinical used in Japan for diagnostic of pancreatic
adenocarcinoma. MUC4 is aberrantly expressed by
80% of the adenocarnicoma of the pancreatic gland
while not expressed in the normal pancreas or in
pancreatitis. In addition, MUC4 is expressed early in
the onset of pancreatic cancer, already detected in the
pancreatic intraepithelial neoplasia (PanIN) of stage I.
Atlas Genet Cytogenet Oncol Haematol. 2007;11(3)
Moniaux N, Escande F, Batra SK, Porchet N, Laine A, Aubert
JP. Alternative splicing generates a family of putative secreted
and membrane-associated MUC4 mucins. Eur J Biochem
2000;267:4536-4544.
Andrianifahanana M, Moniaux N, Schmied BM, Ringel J, Friess
H, Hollingsworth MA, Büchler MW, Aubert JP, Batra SK. Mucin
(MUC) gene expression in human pancreatic adenocarcinoma
and chronic pancreatitis: a potential role of MUC4 as a tumor
marker of diagnostic significance. Clin Cancer Res
2001;7:4033-4040.
Choudhury A, Moniaux N, Ringel J, King J, Moore E, Aubert
JP, Batra SK. Alternate splicing at the 3'-end of the human
pancreatic
tumor-associated
mucin
MUC4
cDNA.
Teratogenesis,Carcinogenesis, and Mutagenesis 2001;21:8396.
Perrais M, Pigny P, Ducourouble MP, Petitprez D, Porchet N,
Aubert JP, Van SI. Characterization of human mucin gene
MUC4 promoter: importance of growth factors and
205
MUC4 (mucin 4, cell surface associated)
Moniaux N et al.
proinflammatory cytokines for its regulation in pancreatic
cancer cells. J Biol Chem 2001;276:30923-30933.
Andrianifahanana M, Agrawal A, Singh AP, Moniaux N, Van S,
I, Aubert JP, Meza J, Batra SK. Synergistic induction of the
MUC4 mucin gene by interferon-gamma and retinoic acid in
human pancreatic tumour cells involves a reprogramming of
signalling pathways. Oncogene 2005;24:6143-6154.
Carraway KL, Perez A, Idris N, Jepson S, Arango M, Komatsu
M, Haq B, Price-Schiavi SA, Zhang J, Carraway CA.
Muc4/sialomucin complex, the intramembrane ErbB2 ligand, in
cancer and epithelia: to protect and to survive. Prog Nucleic
Acid Res Mol Biol 2002;71:149-185.
Andrianifahanana M, Chauhan SC, Choudhury A, Moniaux N,
Brand RE, Sasson AA, Pour PM, Batra SK. MUC4-expressing
pancreatic adenocarcinomas show elevated levels of both T1
and T2 cytokines: potential pathobiologic implications. Am J
Gastroenterol 2006;101(10):2319-2329.
Escande F, Lemaitre L, Moniaux N, Batra SK, Aubert JP,
Buisine MP. Genomic organization of MUC4 mucin gene.
Towards the characterization of splice variants. Eur J Biochem
2002;269:3637-3644.
Chauhan SC, Singh AP, Ruiz F, Johansson SL, Jain M, Smith
LM, Moniaux N, Batra SK. Aberrant expression of MUC4 in
ovarian carcinoma: diagnostic significance alone and in
combination with MUC1 and MUC16 (CA125). Mod Pathol
2006;19(10):1386-1394.
Swart MJ, Batra SK, Varshney GC, Hollingsworth MA, Yeo CJ,
Cameron JL, Willentz RE, Hruban RH, Argani P. MUC4
Expression increases progressively in pancreatic intraepithelial
neoplasia (PanIN). Am J Clin Pathol 2002;117:791-796.
Damera G, Xia B, Ancha HR, Sachdev GP. IL-9 modulated
MUC4 gene and glycoprotein expression in airway epithelial
cells. Biosci Rep 2006;26(1):55-67.
Park HU, Kim JW, Kim GE, Bae HI, Crawley SC, Yang SC,
Gum J, Jr., Batra SK, Rousseau K, Swallow DM, Sleisenger
MH, Kim YS. Aberrant Expression of MUC3 and MUC4
Membrane-Associated Mucins and Sialyl Lex Antigen in
Pancreatic Intraepithelial Neoplasia. Pancreas 2003;26:48-54.
Damera G, Xia B, Sachdev GP. IL-4 induced MUC4
enhancement in respiratory epithelial cells in vitro is mediated
through JAK-3 selective signaling. Respir Res 2006;7:39.
Ramsauer VP, Carraway CA, Salas PJ, Carraway KL.
Muc4/sialomucin complex, the intramembrane ErbB2 ligand,
translocates ErbB2 to the apical surface in polarized epithelial
cells. J Biol Chem 2003;278(32):30142-30147.
Funes M, Miller JK, Lai C, Carraway KL 3rd, Sweeney C. The
mucin Muc4 potentiates neuregulin signaling by increasing the
cell-surface populations of ErbB2 and ErbB3. J Biol Chem
2006;281(28):19310-19319.
Bax DA, Haringsma J, Einerhand AW, van DH, Blok P,
Siersema PD, Kuipers EJ, Kusters JG. MUC4 is increased in
high grade intraepithelial neoplasia in Barrett's oesophagus
and is associated with a proapoptotic Bax to Bcl-2 ratio. J Clin
Pathol 2004;57:1267-1272.
Pino V, Ramsauer VP, Salas P, Carothers Carraway CA,
Carraway KL. Membrane mucin Muc4 induces densitydependent changes in ERK activation in mammary epithelial
and tumor cells: role in reversal of contact inhibition. J Biol
Chem 2006;281(39):29411-29420.
Choudhury A, Moniaux N, Ulrich AB, Schmied BM, Standop J,
Pour PM, Gendler SJ, Hollingsworth MA, Aubert JP, Batra SK.
MUC4 mucin expression in human pancreatic tumours is
affected by organ environment: the possible role of TGFbeta2.
Br J Cancer 2004;90:657-664.
Ramsauer VP, Pino V, Farooq A, Carothers Carraway
Salas PJ, Carraway KL. Muc4-ErbB2 complex formation
signaling in polarized CACO-2 epithelial cells indicate
Muc4 acts as an unorthodox ligand for ErbB2. Mol Biol
2006;17(7):2931-2941.
Hollingsworth MA, Swanson BJ. Mucins in cancer: protection
and control of the cell surface. Nat Rev Cancer 2004;4(1):4560.
Singh AP, Chauhan SC, Bafna S, Johansson SL, Smith LM,
Moniaux N, Lin MF, Batra SK. Aberrant expression of
transmembrane mucins, MUC1 and MUC4, in human prostate
carcinomas. Prostate 2006;66(4):421-429.
Jonckheere N, Perrais M, Mariette C, Batra SK, Aubert JP,
Pigny P, Van Seuningen I. A role for human MUC4 mucin
gene, the ErbB2 ligand, as a target of TGF-beta in pancreatic
carcinogenesis. Oncogene 2004;23(34):5729-5738.
Singh AP, Chaturvedi P, Batra SK. Emerging roles of MUC4 in
cancer: a novel target for diagnosis and therapy. Cancer Res
2007;67(2):433-436.
Mariette C, Perrais M, Leteurtre E, Jonckheere N, Hémon B,
Pigny P, Batra S, Aubert JP, Triboulet JP, Van Seuningen I.
Transcriptional regulation of human mucin MUC4 by bile acids
in oesophageal cancer cells is promoter-dependent and
involves activation of the phosphatidylinositol 3-kinase
signalling pathway. Biochem J 2004;377:701-708.
Singh AP, Chauhan SC, Andrianifahanana M, Moniaux N,
Meza JL, Copin MC, van Seuningen I, Hollingsworth MA,
Aubert JP, Batra SK. MUC4 expression is regulated by cystic
fibrosis transmembrane conductance regulator in pancreatic
adenocarcinoma cells via transcriptional and post-translational
mechanisms. Oncogene 2007;26(1):30-41.
Moniaux N, Andrianifahanana M, Brand RE, Batra SK. Multiple
roles of mucins in pancreatic cancer, a lethal and challenging
malignancy. Br J Cancer 2004;91(9):1633-1638.
Piessen G, Jonckheere N, Vincent A, Hémon B, Ducourouble
MP, Copin MC, Mariette C, Van Seuningen I. Regulation of the
human
mucin
MUC4
by
taurodeoxycholic
and
taurochenodeoxycholic bile acids in oesophageal cancer cells
is mediated by hepatocyte nuclear factor 1alpha. Biochem J
2007;402(1):81-91.
Moniaux N, Varshney GC, chauhan SC, Copin MC, jain M,
Wittel UA, Andrianifahanana M, Aubert JP, Batra SK.
Generation and Characterization of Anti-MUC4 Monoclonal
Antibodies Reactive with Normal and Cancer Cells in Humans.
J Histochem Cytochem 2004;52:253-261.
This article should be referenced as such:
Moniaux N, Chaturvedi P, Van Seuningen I, Porchet N, Singh
AP, Batra SK. MUC4 (mucin 4, cell surface associated). Atlas
Genet Cytogenet Oncol Haematol.2007;11(3):201-206.
Singh AP, Moniaux N, chauhan SC, Meza JL, Batra SK.
Inhibition of MUC4 Expression Suppresses Pancreatic Tumor
Cell Growth and Metastasis. Cancer Res 2004;64:622-630.
Atlas Genet Cytogenet Oncol Haematol. 2007;11(3)
CA,
and
that
Cell
206
Atlas of Genetics and Cytogenetics
in Oncology and Haematology
OPEN ACCESS JOURNAL AT INIST-CNRS
Gene Section
Mini Review
NUT (nuclear protein in testis)
Anna Collin
Department of Clinical Genetics, Lund University Hospital, 221 85 Lund, Sweden
Published in Atlas Database: February 2007
Online updated version: http://AtlasGeneticsOncology.org/Genes/NUTID41595ch15q14.html
DOI: 10.4267/2042/38442
This work is licensed under a Creative Commons Attribution-Non-commercial-No Derivative Works 2.0 France Licence.
© 2007 Atlas of Genetics and Cytogenetics in Oncology and Haematology
Identity
Implicated in
Hugo: NUT
Other names: DKFZp434O192; MGC138683
Location: 15q14 (position 32425358-32437221 on the
chromosome 15 genomic sequence).
Note: the gene name NUT has not been approved by
the HUGO Gene Nomenclature Committee.
Carcinoma with t(15;19)(q14;p13)
translocation
Prognosis
Carcinoma with t(15;19) translocation is invariably
fatal with a rapid clinical course when located to the
midline thoracic, head and neck structures. One tumor,
displaying the cytogenetic and molecular cytogenetic
features of carcinoma with t(15;19) translocation, but
located to the iliac bone has been reported successfully
cured.
It has been suggested that a critical prognostic
difference exists between BRD4-NUT/t(15;19) positive
tumors and tumors where NUT is rearranged but fused
to an as yet unknown partner.
Cytogenetics
t(15;19)(q14;p13) [reported breakpoints: t(15;19)(q1115;p13)].
Hybrid/Mutated Gene
The t(15;19)(q14;p13) results in an BRD4-NUT
chimeric gene where exon 10 of BRD4 is fused to exon
2 of NUT.
Abnormal Protein
The BRD4-NUT fusion is composed of the N-terminal
of BRD4 (amino acids 1-720 out of 1372) and almost
the entire protein sequence of NUT (amino acids 61127). The N-terminal of BRD4 includes
bromodomains 1 and 2 and other, less well
characterized functional domains.
Oncogenesis
It has been suggested that the oncogenic effect of the
NUT-BRD4 fusion is caused not only by the abnormal
regulation of NUT by BRD4 promoter elements but
also by the consequent ectopic expression of NUT in
non-germinal tissues.
DNA/RNA
Description
The gene consists of 7 exons that span approximately
12 kb of genomic DNA in the centromere-to-telomere
orientation. The translation initiation codon and the
stop codon are predicted to exon 1 and exon 7,
respectively.
Transcription
The corresponding 'wildtype' mRNA transcript is 3.6
kb.
Protein
Description
The open reading frame is predicted to encode an 1127
amino acid protein with an estimated molecular weight
of 120 kDa.
Expression
Northern blot analysis has indicated that the normal
expression of the NUT gene is highly restricted to the
testis. No investigations have yet been made at the
protein level.
Localisation
Nuclear.
Function
Unknown.
Atlas Genet Cytogenet Oncol Haematol. 2007;11(3)
207
NUT (nuclear protein in testis)
Collin A
Breakpoints
JA. Midline carcinoma of children and young adults with NUT
rearrangement. J Clin Oncol 2004;22:4135-4139.
Note: The vast majority of reported breakpoints in
carcinoma with t(15;19) translocation were assigned to
band 19p13, the exception being the cytogenetic
interpretation of a 19q13 breakpoint reported once. The
reported breakpoints on chromosome 15 have varied
(15q11-q15).
Marx A, French CA, Fletcher JA. Carcinoma with t(15;19)
translocation. In:World Health Organization classification of
tumours. Pathology and genetics of tumours of the lung,
thymus, pleura and heart. Travis WD, Brambilla E, M?llerHermelink K, Harris CC, editors. Oxford University Press 2004.
pp185-186.
Engleson J, Soller M, Panagopoulos I, Dahlén A, Dictor M,
Jerkeman M. Midline carcinoma with t(15;19) and BRD4-NUT
fusion oncogene in a 30-year-old female with response to
docetaxel and radiotherapy. BMC Cancer 2006;6:69.
References
Mertens F, Wiebe T, Adlercreutz C, Mandahl N, French CA.
Successful treatment of a child with t(15;19)-positive tumor.
Pediatr Blood Cancer 2006.
Kees UR, Mulcahy MT, Willoughby MLN. Intrathoracic
carcinoma in an 11-year-old girl showing a translocation
t(15;19). Am J Pediatr Hematol Oncol 1991;13:459-464.
French CA, Miyoshi I, Kubonishi I, Grier HE, Perez-Atayde AR,
Fletcher JA. BRD4-NUT fusion oncogene: a novel mechanism
in aggressive carcinoma. Cancer Res 2003;63:304-307.
This article should be referenced as such:
Collin A. NUT (nuclear protein in testis). Atlas Genet Cytogenet
Oncol Haematol.2007;11(3):207-208.
French CA, Kutok JL, Faquin WC, Toretsky JA, Antonescu CR,
Griffin CA, Nose V, Vargas SO, Moschovi M, TzortzatouStathopoulo F, Miyoshi I, Perez-Atayde AR, Aster JC, Fletcher
Atlas Genet Cytogenet Oncol Haematol. 2007;11(3)
208
Atlas of Genetics and Cytogenetics
in Oncology and Haematology
OPEN ACCESS JOURNAL AT INIST-CNRS
Gene Section
Review
RAC3 (ras-related C3 botulinum toxin substrate 3
(rho family, small GTP binding protein Rac3))
Nora C Heisterkamp
Section of Molecular Carcinogenesis, Division of Hematology/Oncology, Saban Research Institute,
Childrens Hospital Los Angeles and the Keck School of Medicine, University of Southern California, Los
Angeles, California, USA
Published in Atlas Database: February 2007
Online updated version: http://AtlasGeneticsOncology.org/Genes/RAC3ID42022ch17q25.html
DOI: 10.4267/2042/38443
This work is licensed under a Creative Commons Attribution-Non-commercial-No Derivative Works 2.0 France Licence.
© 2007 Atlas of Genetics and Cytogenetics in Oncology and Haematology
Identity
36, exon 3 residues 37-75, exon 4 residues 76-96, exon
5 residues 97-149 and exon 6 residues 150-192.
Hugo: RAC3
Other names: Location: 17q25.3 with 5’ end towards the centromere.
Nucleotide 203731-2061912 of contig NT_010663
Local order: Located telomeric to the BROV region.
Centromeric to LRRC45 - Rac3 - DCXR telomeric
Transcription
Human Rac3 mRNA is a single species of around 1 kb.
No splice variants have been reported. Factors that
would regulate gene expression on a transcriptional
level have not yet been reported.
Pseudogene
DNA/RNA
No pseudogenes of Rac3 are reported in human.
Note: 6 exons, spread out over approximately 2.4 kb
Protein
Description
Note: The Rac3 gene encodes a single protein of 192
amino acid residues.
The Rac3 gene encompasses 6 exons on chromosome
17. Exon 1 encodes residues 1-12, exon 2 residues 13-
Schematic representation of the Rac3 protein (not to scale). Mutations that generate mutants that are locked in a certain conformation constitutively active or dominant negative - are shown. The C-terminal end contains the CTVM motif that is post-translationally modified
the three last amino acid residues are removed and the C residue is geranyl-geranylated.
Atlas Genet Cytogenet Oncol Haematol. 2007;11(3)
209
RAC3 (ras-related C3 botulinum toxin substrate 3 (rho family, small GTP binding protein Rac3))
Rac2 differ in 22/192 residues (89% identical). Rac
belongs to the extended Rho family of small Gproteins. Biochemically, Rac1 and Rac3 are closely
related.
Description
Rac3 is a small 21 kDa GTPase that acts as a molecular
switch. In its active form, it is bound to GTP, whereas
it is inactive in its GDP-bound form. Racs are
controlled by guanidine activating proteins (GEFs) that
exchange bound GDP for GTP and by GTPase
activating proteins (GAPs) that promote GTP
hydrolysis. Because of the hydrophobic isoprenyl
moiety at the C-terminal end, it is associated with
membranes. In the cytoplasm it associates with the
chaperone RhoGDI.
Implicated in
Breast cancer
Note: Using in situ hybridization, Rac3 was reported to
lies outside of the BROV region commonly deleted in
Breast and Ovarian Cancer.
Activated Rac3 protein was reported in MDA-435,
T47D and MCF7 breast cancer cell lines and 1 of 3
patient samples using a GST-Pak pull-down assay to
detect activated Rac.
siRNA against Rac3 inhibits SNB19 glioblastoma and
BT549 breast cancer cell line invasion in an in vitro
assay.
It was showed that introduction of a constitutively
active Rac3 into the MDA-MB-435 breast cancer cell
line caused increased invasion and motility in vitro.
Transgenic mice with tissue specific expression of
constitutively active (V12)Rac3 in the mammary gland
were generated. Post-lactational female mice had
delayed involution.
Expression
Rac3 mRNA was reported in human cell lines
including GM04155 (lymphoblastic leukemia), K562
(CML), 5838 (Ewing sarcoma), HL60 (promyelocytic
leukemia) and DU4475 (breast cancer). Rac3
expression was reported using semi-quantitative
RT/PCR in gastric tumor and adjacent normal tissue as
well as gastric cancer cell lines. Expression of Rac3
using RT/PCR (38 cycles) was reported in human
brain, liver, kidney and pancreas poly A RNA and also
19% of brain tumors expressed Rac3 mRNA. Rac3specific polyclonal antibodies were used to show Rac3
protein in the brain (deep cerebellar nuclei and the
pons) in 7 day old mice. Low level expression of
mouse rac3 has been reported in bone-marrow-derived
monocytes and in B-lineage lymphoblasts using
standard and RealTime RT/PCR.
Gastric cancer
Note: Semi-quantitative RT/PCR was used to examine
Rac3 mRNA expression in gastric cancer tissues and 7
gastric cell lines. Rac3 expression was detected in the
tumor samples but there was no statistically significant
difference between the expression levels in gastric
cancer and adjacent non-tumorous tissues. The cell
lines had a varying but detectable Rac3 expression.
Localisation
The Rac3 protein is located on endomembranes and
cell membranes.
Function
Brain tumors
Rac proteins regulate a variety of functions including
cytoskeletal organization, cell cycle, reactive oxygen
species production, and vesicle trafficking. In cultured
cells they also are involved in cellular transformation.
Studies of null mutant Rac3 mice showed that Rac3
regulates cerebellar functions and in a mouse model
plays a role in leukemia development caused by the
Bcr/Abl oncogene. Point mutations (N26D, F37L,
Y40C, N43D) were introduced into different critical
residues of the effector domain of Rac3 and the effects
of these were investigated on the ability of Rac3 to
regulate membrane ruffles, c-jun activation and
transformation. Transformation was assayed as the
ability to cooperate with activated Raf in focus
formation of NIH3T3 cells and the ability to promote
growth of these cells in soft agar.
Note: RT-PCR was used to evaluate Rac3 mRNA
expression in human brain tumor tissues. Expression of
rac3 was reported in 3/9 meningiomas, 1/11
astrocytomas, 1/6 pituitary adenomas. The PCR
fragments were subcloned and sequenced, and
mutations were reported in Rac3 in 12/19 brain tumors
including E10V, V14E, D35N, P35S, N43D, V46A,
D57V, R57P, L67V, S83F, V85A, E100G, H104L,
P109H, R120H, T125P, S158P, P180T, V182E,
V182A, H184L and G186E.
To be noted
Note: There is a second gene that is named RAC3 in
some publications. This protein is functionally and
structurally unrelated to the small GTPase Rac3. This is
the steroid receptor coactivator-3, or nuclear receptor
coactivator SRC-3/AIB1/ACTR/pCIP/RAC3/TRAM-1.
Probes 1-12 from NM_005052-links-probes
1: ProbeTaqMan gene expression (TaqMan) probe
Hs00414037_g1 for Homo sapiens gene ras-related C3
botulinum toxin substrate 3 (rho family, small GTP
Homology
Rac3 is most closely related to Rac1 and Rac2. On a
nucleotide level human Rac3 has 77% identity with
Rac1, 83% identity with Rac2 and 69% identity with
RhoG. On an amino acid level, Rac3 and Rac1 differ in
14/192 residues (92% identical), whereas Rac3 and
Atlas Genet Cytogenet Oncol Haematol. 2007;11(3)
Heisterkamp NC
210
RAC3 (ras-related C3 botulinum toxin substrate 3 (rho family, small GTP binding protein Rac3))
12: ProbeResequencing amplicon (RSA) probe
RSA001458005 for Homo sapiens gene ras-related C3
botulinum toxin substrate 3 (rho family, small GTP
binding protein Rac3) (RAC3). Developed for SNP
discovery.
13: Chan et al. (2005) reported TaqMan primers useful
in quantifying human Rac3 expression.
14: Pan et al. (2004) reported primers for semiquantitative RT/PCR for human Rac3 that yielded a
249 bp
15: Hwang et al. (2005) reported primers for RT-PCR
of
human
RNA.
Fw
primer
was
5’AATTCATGCAGGCCATCAAGT-3’ and the reverse
primer 5’-CTAGAAGACGGTGCACTT-3’.
binding protein Rac3) (RAC3). Developed for real time
qRT-PCR gene expression profiling. Reagent is
available from Applied Biosystems.
2: ProbeSmall interfering RNA (siRNA) probe for
Homo sapiens gene ras-related C3 botulinum toxin
substrate 3 (rho family, small GTP binding protein
Rac3) (RAC3). Has been used for RNA interference
(RNAi). Reference Chan et al., 2005
3: ProbeSmall interfering RNA (siRNA) probe for
Homo sapiens gene ras-related C3 botulinum toxin
substrate 3 (rho family, small GTP binding protein
Rac3) (RAC3). Has been used for RNA interference
(RNAi). Reference Chan et al., 2005
4: ProbeResequencing amplicon (RSA) probe
RSA001057586 for Homo sapiens gene ras-related C3
botulinum toxin substrate 3 (rho family, small GTP
binding protein Rac3) (RAC3). Developed for SNP
discovery.
5: ProbeResequencing amplicon (RSA) probe
RSA001057592 for Homo sapiens gene ras-related C3
botulinum toxin substrate 3 (rho family, small GTP
binding protein Rac3) (RAC3). Developed for SNP
discovery.
6: ProbeResequencing amplicon (RSA) probe
RSA001229136 for Homo sapiens genes ras-related C3
botulinum toxin substrate 3 (rho family, small GTP
binding protein Rac3) (RAC3) and leucine rich repeat
containing 45 (LRRC45). Developed for SNP
discovery.
7. ProbeResequencing amplicon (RSA) probe
RSA001400685 for Homo sapiens genes ras-related C3
botulinum toxin substrate 3 (rho family, small GTP
binding protein Rac3) (RAC3) and leucine rich repeat
containing 45 (LRRC45). Developed for SNP
discovery.
8: ProbeResequencing amplicon (RSA) probe
RSA001401207 for Homo sapiens genes ras-related C3
botulinum toxin substrate 3 (rho family, small GTP
binding protein Rac3) (RAC3) and leucine rich repeat
containing 45 (LRRC45). Developed for SNP
discovery.
9: ProbeResequencing amplicon (RSA) probe
RSA001457703 for Homo sapiens gene ras-related C3
botulinum toxin substrate 3 (rho family, small GTP
binding protein Rac3) (RAC3). Developed for SNP
discovery.
10: ProbeResequencing amplicon (RSA) probe
RSA001457859 for Homo sapiens gene ras-related C3
botulinum toxin substrate 3 (rho family, small GTP
binding protein Rac3) (RAC3). Developed for SNP
discovery.
11: ProbeResequencing amplicon (RSA) probe
RSA001458006 for Homo sapiens gene ras-related C3
botulinum toxin substrate 3 (rho family, small GTP
binding protein Rac3) (RAC3). Developed for SNP
discovery.
Atlas Genet Cytogenet Oncol Haematol. 2007;11(3)
Heisterkamp NC
References
Courjal F, Chuchana P, Theillet C, Fort P. Structure and
chromosomal assignment to 22q12 and 17qter of the rasrelated Rac2 and Rac3 human genes. Genomics 1997;44:242246.
Haataja L, Groffen J, Heisterkamp N. Characterization of
RAC3, a novel member of the Rho family. J Biol Chem
1997;272:20384-20388.
Mira,J.P., Benard,V., Groffen,J., Sanders,L.C. and Knaus,
U.G.Proc. Endogenous, hyperactive Rac3 controls proliferation
of breast cancer cells by a p21-activated kinase-dependent
pathway. Proc. Natl. Acad. Sci. U.S.A 2000;97; 185-189.
Morris CM, Haataja L, McDonald M, Gough S, Markie D,
Groffen J, Heisterkamp N. The small GTPase RAC3 gene is
located within chromosome band 17q25.3 outside and
telomeric of a region commonly deleted in breast and ovarian
tumours. Cytogenet Cell Genet 2000;89:18-23.
Bolis A, Corbetta S, Cioce A, de Curtis I. Differential
distribution of Rac1 and Rac3 GTPases in the developing
mouse brain: implications for a role of Rac3 in Purkinje cell
differentiation. Eur J Neurosci 2003;18:2417-2424.
Haeusler LC, Blumenstein L, Stege P, Dvorsky R, Ahmadian
MR. Comparative functional analysis of the Rac GTPases.
FEBS Lett 2003;555:556-560.
Leung K, Nagy A, Gonzalez-Gomez I, Groffen J, Heisterkamp
N, Kaartinen V. Targeted expression of activated Rac3 in
mammary epithelium leads to defective postlactational
involution and benign mammary gland lesions. Cells Tissues
Organs 2003;175:72-83.
Pan Y, Bi F, Liu N, Xue Y, Yao X, Zheng Y, Fan D. Expression
of seven main Rho family members in gastric carcinoma.
Biochem Biophys Res Commun 2004;315:686-691.
Baugher PJ, Krishnamoorthy L, Price JE, Dharmawardhane
SF. Rac1 and Rac3 isoform activation is involved in the
invasive and metastatic phenotype of human breast cancer
cells. Breast Cancer Res 2005;7:R965-R974.
Chan AY, Coniglio SJ, Chuang YY, Michaelson D, Knaus UG,
Philips MR, Symons M. Roles of the Rac1 and Rac3 GTPases
in human tumor cell invasion. Oncogene 2005;24:7821-7829.
Cho YJ, Zhang B, Kaartinen V, Haataja L, de Curtis I, Groffen
J, Heisterkamp N. Generation of rac3 null mutant mice: role of
Rac3 in Bcr/Abl-caused lymphoblastic leukemia. Mol Cell Biol
2005;25:5777-5785.
Corbetta S, Gualdoni S, Albertinazzi C, Paris S, Croci L,
Consalez GG, de Curtis I. Generation and characterization of
Rac3 knockout mice. Mol Cell Biol 2005;25:5763-5776.
211
RAC3 (ras-related C3 botulinum toxin substrate 3 (rho family, small GTP binding protein Rac3))
Hwang SL, Chang JH, Cheng TS, Sy WD, Lieu AS, Lin CL,
Lee KS, Howng SL, Hong YR. Expression of Rac3 in human
brain tumors. J Clin Neurosci 2005;12:571-574.
This article should be referenced as such:
Heisterkamp NC. RAC3 (ras-related C3 botulinum toxin
substrate 3 (rho family, small GTP binding protein Rac3)).
Atlas Genet Cytogenet Oncol Haematol.2007;11(3):209-212.
Keller PJ, Gable CM, Wing MR, Cox AD. Rac3-mediated
transformation requires multiple effector pathways. Cancer Res
2005;65:9883-9890.
Atlas Genet Cytogenet Oncol Haematol. 2007;11(3)
Heisterkamp NC
212
Atlas of Genetics and Cytogenetics
in Oncology and Haematology
OPEN ACCESS JOURNAL AT INIST-CNRS
Gene Section
Review
RBM5 (RNA binding motif protein 5)
Mirna Mourtada-Maarabouni
School of Life Sciences, Keele University, Keele ST5 5BG, UK
Published in Atlas Database: February 2007
Online updated version: http://AtlasGeneticsOncology.org/Genes/RBM5ID42069ch3p21.html
DOI: 10.4267/2042/38444
This work is licensed under a Creative Commons Attribution-Non-commercial-No Derivative Works 2.0 France Licence.
© 2007 Atlas of Genetics and Cytogenetics in Oncology and Haematology
Transcription
Identity
Full length RBM5 has 3.1 Kb, 2448 bp open reading
frame. The gene encodes a number of alternative splice
variants, identified by reverse transcription polymerase
chain reaction. One splice variant lacks exon 6,
RBM5delta6. Three other RNA splice variants retain
intronic sequences, RBM5+5+6 retains introns 5 and 6,
RBM5+6 retains intron 6 and clone 26 which is a
partial cDNA containing an open reading frame and
terminates within intron 6. A 326 bp antisense cDNA
that maps to the intronic region of RBM5, je2, has also
been identified. Both, RBM5delta6 and clone 26
cDNAs have been cloned.
Hugo: RBM5
Other names: LUCA-15; H37; G15
Location: 3p21.3
Note: 3p21.3 is a putative human lung cancer tumor
suppressor region. RBM5/LUCA-15 is a putative tumor
suppressor gene.
DNA/RNA
Description
The gene spans about 30.03 Kb. Orientation plus
strand. At least 25 exons.
RBM5/LUCA-15 splice variants. Boxes represent the exons, intronic sequences are represented by horizontal lines. The arrows point to
the STOP codon in the protein coding sequence.
Atlas Genet Cytogenet Oncol Haematol. 2007;11(3)
213
RBM5 (RNA binding motif protein 5)
Mourtada-Maarabouni M
Function
Protein
RBM5/LUCA-15 is among the 35 genes located within
the 370 kb overlapping lung cancer homozygous
deletion region at 3p21.3. RBM5 has been implicated
in the control of cell death by apoptosis and cell
proliferation. RBM5's involvement in apoptosis and
malignancy has been the focus of many recent studies,
with all results converging on a role for RBM5/LUCA15 as a Tumor Suppressor Gene (TSG). RBM5 splice
variants have been shown to function as regulators of
apoptosis. Stable expression of Je2, in human T-cell
lines CEM-C7 and Jurkat produced marked inhibition
of Fas-mediated apoptosis and conferred protection
from apoptosis induced by other stimuli. RBM5delta6
inhibits CD95-mediated apoptosis as well as
accelerating cell proliferation.
Overexpression of the full length RBM5 in CEM-C7
and Jurkat T-cell lines suppressed cell proliferation
both by inducing apoptosis and by inducing cell cycle
arrest in G1. Consistently, RBM5/LUCA-15
overexpression also inhibited human lung cancer cell
growth (A549 non-small cell lung cancer line) by
increasing apoptosis and inducing cell cycle arrest in
G1. This inhibition of cell growth was reported to be
associated with decreased cyclin A and phosphorylated
RB and an increase in the level of the proapototic
protein Bax. Introducing RBM5/LUCA-15 into breast
cancer cells that had 3p21-22 deletions reduced both
anchorage-dependent
and
anchorage-independent
growth. RBM5/LUCA-15 also is reported to suppress
anchorage-dependent
and
anchorage-independent
growth in A9 mouse fibrosarcoma cells and to inhibit
their tumour forming activity in nude mice.
RBM5/LUCA-15 was one of the nine genes downregulated in metastasis and it has been included in the
17 common gene signature associated with metastasis
identified in multiple solid tumour types. Solid tumours
carrying this gene expression signature had high rates
of metastasis and poor clinical outcome. Microarraybased analysis of changes in gene expression caused by
the modulation of the level of RBM5/LUCA-15 were
carried out. Among 5603 genes on cDNA microarray,
35 genes, well known for their roles in the cell cycle as
well as in apoptosis, were found to be differentially
expressed as a result of RBM5/LUCA-15
overexpression in CEM-C7 cells.
These RBM5/LUCA-15 modulated genes include a
number of cyclin-dependent kinase complexes, most
notably CDK2 and three putative oncogenes which are
down-regulated by RBM5/LUCA-15. These are Pim-1,
a serine/threonine kinase, ITPA (inosine triphosphate
pyrophosphatase) and Amplified in Breast cancer 1
(AIB1). Other functionally important genes modulated
by RBM5/LUCA-15 are well established to play
specific anti apoptotic roles such as BIRC4 (AIP3),
Description
Full length RBM5 encodes a protein with a molecular
mass of about 90 kDa (815 amino acids). The protein
has two RNA Binding Domains (RBD), also
recognized as RNA Recognition Motif (RRM). RBM5
structure also features other functional motifs, which
includes two putative zinc-finger DNA binding motifs,
two bipartite nuclear localisation signals and a G-patch
domain (a conserved domain in eukaryotic RNAprocessing proteins and type D retroviral polyproteins),
suggesting a role for RBM5/LUCA-15 in RNA
processing. In addition, the C-terminal region of
RBM5/LUCA-15 contains several domains including a
glutamine rich domain (362-385), which is thought to
serve as protein-protein interaction site in certain RNAand DNA- binding proteins.
RBM5delta6 encodes a protein of 17 kDa, due to a
frameshift mutation caused by the deletion of exon 6.
The only functional motif retained by this truncated
protein is the arginine/glycine-rich amino terminal
region. A putative 21 kDa is reported to be encoded by
RBM5+5+6 and clone 26, as revealed by an in vitro
transcription/translation study in rabbit reticulocyte
lysate.
Expression
Full length RBM5 and its alternative splice variants
RNA are widely expressed in both primary tissue and
cell lines. Northern blot analysis revealed higher
expression in skeletal and heart muscles and pancreas.
The expression of the full length RBM5 mRNA is
reported to be high in adult thymus and low in the
foetal thymus, suggesting that its expression is
developmentally regulated. Full length RBM5/LUCA15 is reported to be down-regulated in breast cancer
specimens, in 82% of primary non-small-cell lung
carcinoma specimens and in many lung cancer cell
lines and in vestibular schwannomas (27 fold
reduction). The expression of RBM5delta6 RNA is
highest in transformed cells. The full length RBM5
protein is ubiquitously expressed in human tissues. It
was found to be downregulated in 73% of primary nonsmall-cell lung carcinoma specimens compared to
normal adjacent tissue. RBM5/LUCA-15 was one of
the antigens identified by autologous antibody in
patients with renal carcinoma. Overexpression of je2,
the 326 bp antisense sequence, resulted in the
downregulation of the RBM5 protein (95 kDa) and the
upregulation of the 17 kDa protein (RBM5delta6).
Localisation
RBM5 protein includes bipartite nuclear localisation
signals suggesting its localisation to the nucleus.
Atlas Genet Cytogenet Oncol Haematol. 2007;11(3)
214
RBM5 (RNA binding motif protein 5)
Mourtada-Maarabouni M
BIRC3 (cIAP2, MIHC), Mcl-1, a member of the Bcl-2
family of apoptosis suppressors, and TRAF1,
supporting a role for RBM5/LUCA-15 in apoptosis.
Other genes upregulated by RBM5/LUCA-15 include
Stat5b, Annexin I and Bone Morphogenetic Protein 5
(BMP5), implicated in apoptosis, immunosuppression
and organ development respectively.
References
Daly MC, Xiang RH, Buchhagen D, Hensel CH, Garcia DK,
Killary AM, Minna JD, Naylor SL. A homozygous deletion on
chromosome 3 in a small cell lung cancer cell line correlates
with a region of tumour suppressor activity. Oncogene
1993;8:1721-1729.
Burd C.G. and Dreyfuss G. Conserved structures and diversity
of
functions
of
RNA-binding
proteins.
Science
1994;265(5172):615-621.
Homology
RBM5 shares 30% amino acid sequence homology
with its immediate telomeric neighbor, the putative
tumor suppressor gene RBM6. Another RNA Binding
Motif protein that shares high homology with RBM5
(53% at the amino acid level) is RBM10. The RBM10
gene is located on the X chromosome at p11.23. No
function has yet been determined for RBM10. The
mouse RBM5 gene is 90% identical on cDNA level
and 97% on protein level. The fly proteome contain
three similar proteins, of which CG4887 gene product
shows 43% similarity. The rat binding protein S1-1 has
similar domain structure and is close in amino acid
sequence to RBM5.
Kashuba VI, Szeles A, Allikmets R, Nilsson AS, Bergerheim
US, Modi W, Grafodatsky A, Dean M, Stanbridge EJ, Winberg
G, klein G., Zabarovsky E.R., and Kisselev L. A group of NotI
jumping and linking clones cover 2.5 Mb in the 3p21-p22
region suspected to contain a tumour suppressor gene. Cancer
Genet Cytogenet 1995;81(2):144-150.
Daigo Y., Nishiwaki T., Kawasoe T., Tamari M., Suchiya E.,
and Nakamura Y. Molecular cloning of a candidate tumour
suppressor gene, DLC1, from chromosome 3p21.3. Cancer
Res 1996;59:1966-1972.
Wei MH, Latif F, Bader S, Kashuba V, Chen JY, Duh FM,
Sekido Y, Lee C.C, Geil L, Kuzmin I, Zabarovsky E, Klein G,
Zbar B, Minna JD, and Lerman MI. Construction of a 600kilobase cosmid clone contig and generation of a
transcriptional map surrounding the lung cancer tumour
suppressor gene (TSG) locus on human chromosome 3p21.3:
progress toward the isolation of a lung cancer TSG. Cancer
Res 1996;56:1487-1492.
Mutations
Imreh S, Kost-Alimova M, Kholodnyuk I, Yang Y,Szeles A, Kiss
H, Liu F, Foster K, Zabarovsky E, Stanbridge E, and Klein G.
Differential elimination of 3p and retention of 3q segments in
human/mouse microcell hybrids during tumour growth. Genes
Chrom. Cancer 1997;20:224-233.
Note: Mutations in the RMB5 gene have not been
found in lung cancer. RBM5 is reported to be
downregulated in RAS-transformed Rat-1 cells, in
samples from breast cancer, in human schwannomas
and in about 75% of primary lung cancers specimens.
RBM5 was one of the nine genes down-regulated in
metastasis in primary tumors and it has been included
in the 17 common gene signature associated with
metastasis identified in multiple solid tumour types.
Solid tumours carrying this gene expression signature
had high rates of metastasis and poor clinical outcomes.
Kok K, Naylor SL, Buys CH. Deletion of the short arm of
chromosome 3 in solid tumours and the search for suppressor
genes. Adv Cancer Res 1997;71:27-92.
Güre AO, Altorki NK, Stockert E, Scanlan MJ, Old LJ, Chen
YT. Human lung cancer antigens recognized by autologous
antibodies: definition of a novel cDNA derived from the tumour
suppressor gene locus on chromosome 3p21.3. Cancer Res
1998;58(5):1034-1041.
Aravind L and Koonin EV. G-patch: a new conserved domain
in eukaryotic RNA-processing proteins and type D retroviral
polyproteins. Trends Biochem. Sci 1999;24:342-344.
Implicated in
Drabkin HA, West JD, Hotfilder M, Heng YM, Erickson P,
Calvo R, Dalmau J, Gemmill RM, Sablitzky F. DEF-3(g16/NYLU-12), an RNA binding protein from the 3p21.3 homozygous
deletion region in SCLC. Oncogene 1999;18(16):2589-2597.
Lung cancer and many other cancers
Disease
RBM5 is located at the human chromosomal locus
3p21.3, which is strongly associated with lung cancer
and many other cancers, including head and neck,
renal, breast and female genital tract. More than 90% of
freshly microdissected primary lung cancers display
loss of heterozygosity (LOH) of 3p21.3. RBM5 is
implicated in apoptosis and in cell cycle regulation.
Oncogenesis
The ability of RBM5/LUCA-15 to inhibit the growth of
transformed cells fulfils one of the criteria for a tumor
suppressor. The simultaneous changes in proliferation
and inhibition of apoptosis brought about by
dysregulation of the RBM5/LUCA-15 locus are likely
to be of major significance in oncogenesis.
Atlas Genet Cytogenet Oncol Haematol. 2007;11(3)
Hotfilder M, Baxendale S, Cross MA, and Sablitzky F. Def-2, 3, -6 and -8, novel mouse genes differentially expressed in the
haemopoietic system. Br. J. Haematol 1999;106:335-344.
Scanlan MJ, Gordan JD, Williamson B, Stockert E, Bander NH,
Jongeneel V, Güre AO, Jäger D, Jäger E, Knuth A, Chen YT,
Old LJ. Antigens recognized by autologous antibody in patients
with renal-cell carcinoma. Int J Cancer 1999;83(4):456-464.
Timmer T, Terpstra P, van den Berg A, Veldhuis PM, Ter Elst
A, Voutsinas G, Hulsbeek MM, Draaijers TG, Looman MW,
Kok K, Naylor SL, Buys CH. A comparison of genomic
structures and expression patterns of two closely related
flanking genes in a critical lung cancer region at 3p21.3. Eur J
Hum Genet 1999;7(4):478-486.
Edamatsu H, Kaziro Y, Itoh H. LUCA15, a putative tumour
suppressor gene encoding an RNA-binding nuclear protein, is
down-regulated in ras-transformed Rat-1 cells. Genes Cells
2000;5:849-858.
215
RBM5 (RNA binding motif protein 5)
Mourtada-Maarabouni M
Lerman MI, Minna JD. The 630-kb lung cancer homozygous
deletion region on human chromosome 3p21.3: identification
and evaluation of the resident candidate tumour suppressor
genes. Cancer Res 2000;60:6116-6133.
Ramaswamy S, Ross KN, Lander ES, Golub TR. A molecular
signature of metastasis in primary solid tumours. Nat Genet
2003;33(1):49-53.
Sutherland LC, Rintala-Maki ND, White RD, Morin CD. RNA
Binding Motif (RBM) proteins: A novel family of apoptosis
modulators?. J Cell Biochem 2005;94(1):5-24. (Review).
Sutherland LC, Edwards SE, Cable HC, Poirier GG, Miller BA,
Cooper CS, Williams GT. LUCA-15-encoded sequence
variants regulate CD95-mediated apoptosis. Oncogene
2000;19(33):3774-3781.
Mourtada-Maarabouni M, Keen J, Clark J, Cooper CS,
Williams
GT. Candidate tumor suppressor LUCA15/RBM5/H37 modulates expression of apoptosis and cell
cycle genes. Exp Cell Res 2006;312(10):1745-1752.
Mourtada-Maarabouni M, Sutherland LC, Williams GT.
Candidate tumour suppressor LUCA-15 can regulate multiple
apoptosis pathways. Apoptosis 2002;7:421-432.
Maarabouni MM, Williams GT. The antiapoptotic RBM5/LUCA15/H37 gene and its role in apoptosis and human cancer
research update. ScientificWorldJournal 2006;6:1705-1712.
(Review).
Mourtada-Maarabouni M and Willimas GT. RBM5/LUCA-15-tumour suppression by control of apoptosis and the cell cycle?.
ScientificWorldJournal 2002;4(2):1885-1890. (Review).
Oh JJ, West AR, Fishbein MC, Slamon DJ. A candidate tumour
suppressor gene, H37, from the human lung cancer tumour
suppressor locus 3p21.3. Cancer Res 2002;62(11):3207-3213.
Oh JJ, Razfar A, Delgado I, Reed RA, Malkina A, Boctor B,
Slamon
DJ.
3p21.3
Tumour
suppressor
gene
H37/Luca15/RBM5 inhibits growth of human lung cancer cells
through cell cycle arrest and apoptosis. Cancer Res
2006;66(7):3419-3427.
Welling DB, Lasak JM, Akhmametyeva E, Ghaheri B, Chang
LS. cDNA microarray analysis of vestibular schwannomas.
Otol Neurotol 2002;23(5):736-748.
This article should be referenced as such:
Mourtada-Maarabouni M. RBM5 (RNA binding motif protein 5).
Atlas Genet Cytogenet Oncol Haematol.2007; 11(3):213-216.
Mourtada-Maarabouni M, Sutherland LC, Meredith JM,
Williams GT. Simultaneous acceleration of the cell cycle and
suppression of apoptosis by splice variant delta-6 of the
candidate tumour suppressor LUCA-15/RBM5. Genes Cells
2003;8(2):109-119.
Atlas Genet Cytogenet Oncol Haematol. 2007;11(3)
216
Atlas of Genetics and Cytogenetics
in Oncology and Haematology
OPEN ACCESS JOURNAL AT INIST-CNRS
Gene Section
Mini Review
RHOB (ras homolog gene family, member B)
Minzhou Huang, Lisa D Laury-Kleintop, George Prendergast
Lankenau Institute for Medical Research, 100 Lancaster Avenue, Wynnewood PA 19096, USA
Published in Atlas Database: February 2007
Online updated version: http://AtlasGeneticsOncology.org/Genes/RHOBID42108ch2p24.html
DOI: 10.4267/2042/38445
This work is licensed under a Creative Commons Attribution-Non-commercial-No Derivative Works 2.0 France Licence.
© 2007 Atlas of Genetics and Cytogenetics in Oncology and Haematology
Function
Identity
Regulator of protein signaling and trafficking:
Plays a pivotal role in the dynamic regulation of the
actin cytoskeleton. Involved in intracellular protein
trafficking of a number of proteins. Targets PRK1 to
endosomes and is involved in trafficking of the EGF
receptor from late endosomes to lysosomes. Also
required for stability and nuclear trafficking of Akt
which promotes endothelial cell survival during
vascular development. Identified as a component of
outside-in signaling pathways that coordinate Src
activation with its translocation to transmembrane
receptors.
Negative modifier of cancer progression:
Affects cell adhesion and growth factor signaling in
transformed cells. Plays a negative role in
tumorigenesis as RhoB deletion increases tumor
formation initiated by Ras mutation. Limits the
proliferation of transformed cells by facilitating
turnover of oncogene c-Myc. Expression levels are
dramatically decreased in lung, head and neck, and
brain cancer, when tumors become more aggressive.
Modulator of cancer cell apoptosis:
Promotes proapoptotic signaling of regulators involved
in cell cycle checkpoints, cell adhesion, vesicle
trafficking, MAPK signaling, transcription, and
immunity. Mediates apoptosis in neoplastically
transformed cells after DNA damage. Is essential for
apoptosis
and
antineoplastic
activity
of
farnesyltransferase inhibitors in a mouse model. Is one
of the targets of farnesyltransferase inhibitors which are
currently under investigation as cancer therapeutics.
Hugo: RHOB
Other names: ARH6; ARHB; H6; RHOH6
Location: 2p24.1
DNA/RNA
Description
The gene encompasses 2,366 bps (chr2:20,510,31620,512,681); 1 exon.
Transcription
The coding sequence (CDS) region is 395.983 bp (588
bp) encoding a protein of 196 aa long.
Protein
Description
Length 196 aa, molecular weight 22123 Da
(unprocessed precursor). RhoB protein exists in
different
geranylgeranylated
(RhoB-GG)
or
farnesylated (RhoB-F) isoforms in cells.
Expression
Widely expressed.
Localisation
Endosome; Late endosome; late endosomal membrane;
cell membrane; Also detected at the nuclear margin and
in the nucleus. Prenylation specifies the subcellular
location of RHOB. In general, the farnesylated form is
localized to the plasma membrane while the
geranylgeranylated form is localized to the endosome.
Atlas Genet Cytogenet Oncol Haematol. 2007;11(3)
Homology
Member of the ras gene superfamily; rho family; GTPbinding proteins. The RhoA, RhoB, and RhoC proteins
form a closely related subgroup that are about 90%
identical in amino acid sequence. The sequences of
RHOB are highly-conserved between species (from
217
RHOB (ras homolog gene family, member B)
Huang M et al.
Prendergast GC. Actin' up: RhoB in cancer and apoptosis. Nat
Rev Cancer 2001;1(2):162-168. (Review).
human to fly). Amino acid sequences of human, mouse
and rat are 100% identical while sequence homology
between human and chicken is 97% identical.
Adnane J, Muro-Cacho C, Mathews L, Sebti SM, MuñozAntonia T. Suppression of rho B expression in invasive
carcinoma from head and neck cancer patients. Clin Cancer
Res 2002;8(7):2225-2232.
Implicated in
Adini I, Rabinovitz I, Sun JF, Prendergast GC, Benjamin LE.
RhoB controls Akt trafficking and stage-specific survival of
endothelial cells during vascular development. Genes Dev
2003;17(21):2721-2732.
Lung cancer
Note: RhoB expression is frequently downregulated in
lung cancer by multiple mechanisms. Low or no
expression of RhoB is more frequently observed in
poorly- or moderately-differentiated adenocarcinomas,
and indicative of poor patient prognosis.
Jiang K, Delarue FL, Sebti SM. EGFR, ErbB2 and Ras but not
Src suppress RhoB expression while ectopic expression of
RhoB
antagonizes
oncogene-mediated
transformation.
Oncogene 2004;23(5):1136-1145.
Jiang K, Sun J, Cheng J, Djeu JY, Wei S, Sebti S. Akt
mediates Ras downregulation of RhoB, a suppressor of
transformation, invasion, and metastasis. Mol Cell Biol
2004;24(12):5565-5576.
Head and neck cancer
Note: RhoB expression decreases to undetectable level
as tumors become more invasive and poorly
differentiated. In contrast, Ki67 (proliferation marker)
and RhoA protein levels increase with tumor
progression.
Wherlock
M,
Gampel
A,
Futter
C,
Mellor
H.
Farnesyltransferase inhibitors disrupt EGF receptor traffic
through modulation of the RhoB GTPase. J Cell Sci
2004;117(Pt 15):3221-3231.
Mazieres J, Antonia T, Daste G, Muro-Cacho C, Berchery D,
Tillement V, Pradines A, Sebti S, Favre G. Loss of RhoB
expression in human lung cancer progression. Clin Cancer
Res 2004;10(8):2742-2750.
References
Madaule P, Axel R. A novel ras-related gene family. Cell
1985;41(1):31-40.
Sandilands E, Cans C, Fincham VJ, Brunton VG, Mellor H,
Prendergast GC, Norman JC, Superti-Furga G, Frame MC.
RhoB and actin polymerization coordinate Src activation with
endosome-mediated delivery to the membrane. Dev Cell
2004;7(6):855-869.
Chardin P, Madaule P, Tavitian A. Coding sequence of human
rho cDNAs clone 6 and clone 9. Nucleic Acids Res
1988;25;16(6):2717.
Cannizzaro LA, Madaule P, Hecht F, Axel R, Croce CM,
Huebner K. Chromosome localization of human ARH genes, a
ras-related gene family. Genomics 1990;6(2):197-203.
Huang M, Kamasani U, Prendergast GC. RhoB facilitates cMyc turnover by supporting efficient nuclear accumulation of
GSK-3. Oncogene 2006;25(9):1281-1289.
Adamson P, Marshall CJ, Hall A, Tilbrook PA. Posttranslational modifications of p21rho proteins. J Biol Chem
1992;267(28):20033-20038.
Huang M, Prendergast GC. RhoB in cancer suppression. Histol
Histopathol 2006;21(2):213-218. (Review).
Armstrong SA, Hannah VC, Goldstein JL, Brown MS. CAAX
geranylgeranyl transferase transfers farnesyl as efficiently as
geranylgeranyl to RhoB. J Biol Chem 1995;270(14):7864-7868.
ISato N, Fukui T, Taniguchi T, Yokoyama T, Kondo M,
Nagasaka T, Goto Y, Gao W, Ueda Y, Yokoi K, Minna JD,
Osada H, Kondo Y, Sekido Y. RhoB is frequently
downregulated in non-small-cell lung cancer and resides in the
2p24 homozygous deletion region of a lung cancer cell line. Int
J Cancer 2006;[Epub ahead of print].
Gampel A, Parker PJ, Mellor H. Regulation of epidermal
growth factor receptor traffic by the small GTPase rhoB. Curr
Biol 1999;9(17):955-958.
Liu A, Du W, Liu JP, Jessell TM, Prendergast GC. RhoB
alteration is necessary for apoptotic and antineoplastic
responses to farnesyltransferase inhibitors. Mol Cell Biol
2000;20(16):6105-6113.
This article should be referenced as such:
Huang M, Laury-Kleintop LD, Prendergast G. RHOB (ras
homolog gene family, member B). Atlas Genet Cytogenet
Oncol Haematol.2007;11(3):217-218.
Liu Ax, Cerniglia GJ, Bernhard EJ, Prendergast GC. RhoB is
required to mediate apoptosis in neoplastically transformed
cells after DNA damage. Proc Natl Acad Sci USA
2001;98(11):6192-6197.
Atlas Genet Cytogenet Oncol Haematol. 2007;11(3)
218
Atlas of Genetics and Cytogenetics
in Oncology and Haematology
OPEN ACCESS JOURNAL AT INIST-CNRS
Gene Section
Mini Review
RNASET2 (ribonuclease T2)
Francesco Acquati, Paola Campomenosi
Dipartimento di Biotecnologie e Scienze Molecolari, Universita degli Studi dell'Insubria, I-21100 Varese,
Italy
Published in Atlas Database: February 2007
Online updated version: http://AtlasGeneticsOncology.org/Genes/RNASET2ID518ch6q27.html
DOI: 10.4267/2042/38446
This work is licensed under a Creative Commons Attribution-Non-commercial-No Derivative Works 2.0 France Licence.
© 2007 Atlas of Genetics and Cytogenetics in Oncology and Haematology
kb of genomic DNA. The translation initiation codon is
located to exon 1 and the stop codon to exon 9. Exons
III and VI encode the two CAS motifs (Catalytic
Active Sites) responsible for the ribonuclease activity
of the RNASET2 protein.
Identity
Hugo: RNASET2
Other
names:
RNASE6PL;
RP11-514O12.3;
bA514O12.3
Location: 6q27
Local order: Telomeric to RPS6KA2, centromeric to
FGFR1OP.
Note: This gene is the first human member of the
Rh/T2/S-glycoprotein
family
of
extracellular
ribonucleases. It is a putative class II tumor suppressor
gene potentially involved in the pathogenesis of several
solid and haematologic human neoplasias such as
ovarian cancer, melanoma and non-Hodgkin
lymphoma.
Transcription
The RNASET2 gene is transcribed in the telomere-tocentromere orientation to produce an ubiquitously
expressed mRNA approximately 1,4 kb in length. EST
clones representing splice variants of the same gene
have been described.
Pseudogene
A processed pseudogene showing 85% identity with
RNASET2 mRNA maps to chromosome 7p11.2. The
expression pattern of this pseudogene is not known.
DNA/RNA
Description
This gene is split in 9 exons spanning approximatly 27
I-IX: RNASET2 exons.
Atlas Genet Cytogenet Oncol Haematol. 2007;11(3)
219
RNASET2 (ribonuclease T2)
Acquati F, Campomenosi P
tumorigenicity and metastasis when overexpressed in
the same ovarian cancer cell lines. Such results have
been recently confirmed in a human melanoma cell
line.
Protein
Description
The full-length RNASET2 protein contains 256
aminoacids and displays an apparent MW of 36 kDa in
its secreted form. Two 31 and 27 kDa C-terminal
proteolytic products have also been observed
intracellularly in several human cancer cell lines and
localize to the lysosome.
Homology
The primary sequenze of RNASET2 shows strong
homology to the Rh/T2/S family of secreted
ribonucleases.
Mutations
Expression
Expression of the RNASET2 protein has been detected
in several human ovarian cancer cell lines and in some
melanoma, prostate, pancreatic and breast carcinoma
cell lines.
Germinal
A common exon-9 missense C708T germline mutation
has been described but no evidence for an association
of this allele with human cancer was found.
Localisation
Somatic
The RNASET2 protein can be detected either
intracellularly within lysosomes and secretory pathway,
or extracellularly in a secreted form (in cell culture
supernatants).
A few common polymorphisms in exons 1, 8 and 9
have been described.
Implicated in
Function
Human ovarian carcinoma
Biochemical function: RNASET2 is an acid
ribonuclease with optimal activity at pH 5 and
preferential cleavage of poly-A and poly-U homopolyribonucleotides.
Biological function: RNASET2 behaves as a class II
tumor suppressor gene for ovarian cancer, since
experimental overexpression of this gene in human
ovarian cancer cell lines is associated with a significant
decrease of their tumorigenic and metastasizing
potential in vivo. Strikingly, the ribonuclease catalytic
activity is apparently dispensable for RNASET2 to play
such antioncogenic role. Indeed, a double CAS mutant
cDNA construct encoding an almost inactive
RNASET2 protein is still able to suppress
Atlas Genet Cytogenet Oncol Haematol. 2007;11(3)
Disease
Loss of expression of RNASET2 occurs in a significant
fraction of human ovarian cancer cell lines and primary
ovarian tumours. When overexpressed by gene transfer
experiments in human ovarian cancer cell lines
displaying a low level of endogenous mRNA,
RNASET2 strongly suppresses the tumorigenic and
metastatic potential of these cell lines in vivo.
Cytogenetics
The RNASET2 genes maps in a genomic region (6q27)
which is frequently deleted or otherwise rearranged in a
wide range of human neoplasias, including ovarian
cancer.
220
RNASET2 (ribonuclease T2)
Acquati F, Campomenosi P
References
localization of the human homolog of the R2/Th/Stylar
ribonuclease gene family. Methods Mol Biol 2001;160:87-101.
Trubia M, Sessa L, Taramelli R. Mammalian Rh/T2/Sglycoprotein ribonuclease family genes: cloning of a human
member located in a region of chromosome 6 (6q27) frequently
deleted in human malignancies. Genomics 1997;42:342-344.
Acquati F, Possati L, Ferrante L, Campomenosi P, Talevi S,
Bardelli S, Margiotta C, Russo A, Bortoletto E, Rocchetti R,
Calza R, Cinquetti R, Monti L, Salis S, Barbanti-Brodano G,
Taramelli R. Tumor and metastasis suppression by the human
RNASET2 gene. Int J Oncol 2005;26:1159-1168.
Acquati F, Morelli C, Cinquetti R, Bianchi MG, Porrini D,
Varesco L, Gismondi V, Rocchetti R, Talevi S, Possati L,
Magnanini C, Tibiletti MG, Bernasconi B, Daidone MG,
Shridhar V, Smith DI, Negrini M, Barbanti-Brodano G,
Taramelli R. Cloning and characterization of a senescence
inducing and class II tumor suppressor gene in ovarian
carcinoma at chromosome region 6q27. Oncogene
2001;20:980-988.
Campomenosi P, Salis S, Lindqvist C, Mariani D, Nordström T,
Acquati F, Taramelli R. Characterization of RNASET2, the first
human member of the Rh/T2/S family of glycoproteins. Arch
Biochem Biophys 2006;449:17-26.
This article should be referenced as such:
Acquati F, Campomenosi P. RNASET2 (ribonuclease T2).
Atlas Genet Cytogenet Oncol Haematol.2007;11(3):219-221.
Acquati F, Nucci C, Bianchi MG, Gorletta T, Taramelli R.
Molecular cloning, tissue distribution, and chromosomal
Atlas Genet Cytogenet Oncol Haematol. 2007;11(3)
221
Atlas of Genetics and Cytogenetics
in Oncology and Haematology
OPEN ACCESS JOURNAL AT INIST-CNRS
Gene Section
Review
ALOX12 (arachidonate 12-lipoxygenase) Homo
sapiens
Sreeparna Banerjee, Asli Erdog
Department of Biology, Middle East Technical University, Ankara 06531, Turkey (SB); Department of
Biotechnology, Middle East Technical University, Ankara 06531 Turkey (AE)
Published in Atlas Database: March 2007
Online updated version: http://AtlasGeneticsOncology.org/Genes/ALOX12ID620ch17p13.html
DOI: 10.4267/2042/38447
This work is licensed under a Creative Commons Attribution-Non-commercial-No Derivative Works 2.0 France Licence.
© 2007 Atlas of Genetics and Cytogenetics in Oncology and Haematology
genes, including ALOX12, are clustered on the short
arm of chromosome 17 within a few megabases of each
other. ALOX15, which has 86% sequence homology to
ALOX12, is in closest proximity (17p13.2). Since
chromosome 17 is known for gene duplications, the
multiple LOX genes on the same chromosome may be
as a result of such duplications.
Identity
Hugo: ALOX12
Other names: 12-LOX; 12S-type; 12(S)-lipoxygenase;
EC 1.13.11.31; LOG12
Location: 17p13.1
Local order: According to NCBI Map Viewer, genes
flanking ALOX15 in centromere to telomere direction
on 17p13 are: GABARAP 17p13.1 GABA(A) receptorassociated protein, ASGR2 asialoglycoprotein receptor
2, ALOX12 17p13.1 arachidonate 12-lipoxygenase
(Homo sapiens), ALOX12P2 17p13 arachidonate 12lipoxygenase pseudogene 2, TEKT1 tektin 1, FBXO39
F-box protein 39.
Note: Arachidonate 12-Lipoxygenase (12-LOX) is one
of several LOX isoforms that has iron as a cofactor and
oxygenates polyunsaturated fatty acids. This particular
isoform was also the first documented LOX in the
animal kingdom.
Description
According to Entrez-Gene, ALOX12 gene maps to
NC_000017.9 and spans a region of 16.1 kilo bases.
According to Spidey (mRNA to genomic sequence
alignment tool), ALOX15 has 14 exons, the sizes being
168, 202, 82, 123, 104, 161, 144, 210, 87, 170, 122,
101, 171 and 490 bp.
Transcription
ALOX12
mRNA
NM_000697
has
2335bp.
Characterization of the 5' flanking region of the human
ALOX12 in epidermoid carcinoma A431 cells
indicated the presence of two Sp1 recognition motifs
residing at -158 to -150 bp and -123 to -114 bp which
are essential for gene expression.
DNA/RNA
Note: With the exception of ALOX5, all human LOX
Diagram of the ALOX12 gene. Exons are represented by grey boxes (in scale) untranscribed sequences in black, with exon numbers on
the bottom.
Atlas Genet Cytogenet Oncol Haematol. 2007;11(3)
222
ALOX12 (arachidonate 12-lipoxygenase) Homo sapiens
Banerjee S, Erdog A
The proposed mechanism of action is as follows:
epidermal growth factor induces MAPK activation in
cells, followed by the activation of JUN/AP1. The
biosynthesis of c-Jun is thereby increased. Sp1 recruits
HDAC1 together with c-Jun to the gene promoter.
When Sp1 is deacetylated it interacts with acetylate
histone 3, following which p300 is recruited to the gene
promoter leading to the enhancement of the expression
of 12(S)-lipoxygenase.
Function
12-LOX is a member of the inflammatory leukotriene
biosynthesis pathway where, in presence of molecular
oxygen, it converts arachidonic acid to 12hydroxyeicosatetraenoic
acid
(12-HETE).
The
leukocyte type 12-LOX can, in addition, effectively
oxygenate linoleic acid and phospholipids. This
isoform can also generate significant amounts of the
15-LOX product in addition to 12-HETE.
Pseudogene
Homology
According to Entrez Gene the arachidonate 12lipoxygenase pseudogene (ALOX12P2) (HGNC:
13742) is located on 17p13.1. This is the 'epidermal
type' 12-LOX (e-12LO) that was cloned using a murine
e-LO12 probe. Humans express this functional
pseudogene in the skin and hair follicles.
C. familiaris: LOC479476 similar to arachidonate 12lipoxygenase, P. troglodytes: ALOX12, R. norvegicus:
Alox12 (predicted), M. musculus: Alox12 arachidonate
12-lipoxygenase (12/15LOX), D. rerio: wufb72a11.
Implicated in
Protein
Inflammation and cancer
Note: End product of arachidonic acid metabolism by
the
platelet-type
12-LOX
12(S)-Hydroxy
eicosatetraenoic acid (12(S)-HETE) is shown to induce
invasion, motility, and angiogenesis and protect tumour
cells from apoptosis. Great many biological activities
of 12(S)-HETE appear to be partly mediated by the
activation of NF-kappaB. NF-kappaB is a family of
five DNA binding proteins that regulate the expression
of a variety of genes involved in host immune
responses and inflammation. A direct relationship
between platelet-type 12-LOX overexpression and NFkappaB activation is reported in prostate cancer cells.
Note: 12S-lipoxygenases has three isoforms, named
after their site of initial identification: platelet,
leukocyte and epidermis. The leukocyte-type enzyme is
expressed widely, while the platelet and epidermal
enzymes are present in only a relatively limited number
of cell types. Owing to the similarities in their genetic
location, sequence and biological activities, leukocyte
12-LOX and 15-LOX-1 are often referred to as 12/15
lipoxygenase.
Description
12-LOX protein consists of 662 amino acids, with a
molecular weight of 75536 Da and contains non heme
iron as a cofactor. According to the NCBI conserved
domain
search,
the
presence
of
a
polycystin/lipoxygenase/alpha-toxin (PLAT) domain in
the 12-LOX protein allows it access and enables it to
catalyze enzymatic lipid peroxidation in complex
biological structures via direct dioxygenation of
phospholipids and cholesterol esters of biomembranes
and plasma lipoproteins. The same conserved domain
in 15-LOX-1 also enables it to oxidize complex lipids.
Although cytosolic, both types of enzymes need this
domain to access their sequestered membrane or
micelle bound substrates.
Polymorphisms associated with
diseases
Note: Aberrant arachidonic acid metabolism by 12lipoxygenase (12-LOX) is implicated in carcinogenesis.
Genetic polymorphisms 12-LOX is therefore thought to
influence its function and/or expression and may
modify the risk for colorectal adenoma. One of the
single nucleotide polymorphisms (SNPs) reported in
the 12-LOX gene located in exon 6 resulting in an Arg
to Gln substitution at amino acid 261 of 12-LOX is in a
highly conserved region of the lipoxygenase domain.
Data from a community-based, case-control study of
incident, sporadic colorectal adenoma that included 162
cases and 211 controls have shown an inverse
association between the Arg261Gln polymorphism in
12-LOX and colorectal adenoma (OR, 0.63; 95% CI,
0.40-1.00). A significant interaction also is observed
between the 12-LOX polymorphism (Arg261Gln) and
the use of nonsteroidal anti-inflammatory drugs.
Another study argues that Gln261Arg in ALOX12 does
not appear to be associated with colon cancer risk.
Studies have shown higher urinary excretion of the
arachidonic
acid-derived
metabolite
12(S)hydroxyeicosatetraenoic acid (12(S)-HETE) in
essential hypertension. For analysis of the association
Expression
The platelet type 12-LOX is expressed in the platelets
and skin in humans. Based on structural and enzymatic
properties, 15-LOX-1 is said to be a homolog of
leukocyte type 12-LOX and are both expressed in mast
cells, eosinophils, activated monocytes or dendritic
cells, and bronchial epithelial cells.
Localisation
All 12-LOX isoforms have been localized to the
cytoplasm. In addition, the platelet-type 12Slipoxygenase was found in both cytosol and
microsomal fractions of epidermal cells of human skin.
Atlas Genet Cytogenet Oncol Haematol. 2007;11(3)
223
ALOX12 (arachidonate 12-lipoxygenase) Homo sapiens
Banerjee S, Erdog A
of polymorphisms in ALOX12 with hypertension and
urinary levels of 12(S)-HETE, a study with 200
patients with essential hypertension and 166 matched
controls is performed and as a result, the distribution of
genotypes of the R261Q (Arg to Gln) polymorphism is
found to be significantly different between patients and
controls. These results indicate that a nonsynonymous
polymorphism in ALOX12 is associated to essential
hypertension and to urinary levels of 12(S)-HETE.
Peak BMD is a major determinant of osteoporosis
which is a complex disease with both genetic and
environmental risk factors. In a population - and family
- based association study of ALOX15 and ALOX12,
SNPs distributed across the two genes are genotyped.
Moderate evidence of association is found between
spine BMD and six SNPs in the ALOX12 gene in both
men and women. These data conclude that
polymorphisms in the ALOX12 gene may contribute to
normal variation in spine BMD.
increase in PI3-kinase activity in 12-LOX-transfected
PC-3 cells.
The expression of 12-LOX is detected to be low in
benign prostatic hyperplasia and normal prostate
tissues, whereas marked expression of 12-lipoxygenase
is detected in prostatic intraepithelial neoplasia and
prostate cancer tissues. The LOX inhibitors cause
marked cellular death through apoptosis in prostate
cancer cells in a concentration and time-dependent
manner.
Another effect of 12-LOX in prostate cancer cells is
that increase in 12-LOX expression enhances the
metastatic potential of human prostate cancer cells. 12LOX transfected PC-3 cells show a significant change
in cell adhesiveness, spreading, motility, and
invasiveness.
Breast cancer
Note: Total cellular RNA extraction from 64 frozen
tissue samples of breast carcinoma and their
corresponding normal adjacent tissues is performed for
expression analysis of cyclooxygenase-2 and 12lipooxygenase using RT-PCR. 62.5% of carcinoma
samples showed over-expression of 12-lipooxygenase
as compared to normal breast tissues. Results also
reveal that and 12-lipooxygenase mRNA expressions
are associated with TNM staging in human breast
cancer.
A second study indicates that levels of 12lipoxygenases together with 5-lipoxygenase are also
particularly high in tumours from patients who died of
breast cancer. Therefore raised level of 12lipoxygenase might have prognostic value in patients
with breast cancer.
Alzheimer's disease
Note: Alzheimer's disease (AD) is a chronic
neurodegenerative disorder that impairs cognition and
behavior. Although the initiating molecular events are
not known, increasing evidence suggests that 12/15LOX is a major source of oxidative stress which could
play a functional role in pathogenesis. Quantitative
Western
blot
analysis
confirmed
by
immunohistochemical studies demonstrate that in
affected frontal and temporal regions of AD brains, the
amount of 12/15-LOX is higher compared to controls.
Also metabolic products of 12/15-LOX are markedly
elevated in AD brains compared to controls.
Bladder cancer
Note: 12-LOX expression is shown to be induced in
bladder cancer tissues by an immunohistochemistry
analysis. Also lipoxygenase inhibitors cause marked
inhibition of bladder cancer cells in a concentration and
time dependent manner. Cells treated with
lipoxygenase inhibitors show chromatin condensation,
cellular shrinkage, small membrane bound bodies
(apoptotic bodies) and cytoplasmic condensation.
References
Testicular cancer
Liu YW, Arakawa T, Yamamoto S, Chang WC. Transcriptional
activation of human 12-lipoxygenase gene promoter is
mediated through Sp1 consensus sites in A431 cells. Biochem
J 1997;324 (1):133-140.
Takahashi Y, Glasgow WC, Suzuki H, Taketani Y, Yamamoto
S, Anton M, Kühn H, Brash AR. Investigation of the
oxygenation of phospholipids by the porcine leukocyte and
human platelet arachidonate 12-lipoxygenases. Eur J Biochem
1993;218:165-171.
Yoshimoto T, Yamamoto S. Arachidonate 12-lipoxygenase. J
Lipid Mediat Cell Signal 1995;12(2-3):195-212.
Note: 12-LOX is only slightly expressed in normal
testis tissues, however, 12-LOX expression is found to
be significant in testicular cancer tissues by
immunohistochemistry
studies.
Specific
LOX
inhibitors have also been shown to inhibit the growth of
testicular cancer in cell lines.
Sun D, Elsea SH, Patel PI, Funk CD. Cloning of a human
epidermal-type
12-lipoxygenase-related
gene
and
chromosomal localization to 17p13. Cytogenet Cell Genet
1998;81(1):79-82.
McDonnell M, Li H, Funk CD. Characterization of epidermal
12(S) and 12(R) lipoxygenases. Adv Exp Med Biol
2002;507:147-153.
Prostate cancer
Note: Research focusing on mechanisms of action of
12-lipoxygenase in prostate cancer cells revealed that
overexpression of 12-lipoxygenase in PC-3 cells results
in a 3-fold increase in VEGF protein level when
compared with vector control cells and there is an
Atlas Genet Cytogenet Oncol Haematol. 2007;11(3)
Jiang WG, Douglas-Jones A, Mansel RE. Levels of expression
of lipoxygenases and cyclooxygenase-2 in human breast
cancer. Prostaglandins Leukot Essent Fatty Acids
2003;69:275-281.
Kandouz M, Nie D, Pidgeon GP, Krishnamoorthy S, Maddipati
KR, Honn KV. Platelet-type 12-lipoxygenase activates NF-
224
ALOX12 (arachidonate 12-lipoxygenase) Homo sapiens
Banerjee S, Erdog A
kappaB in prostate cancer cells. Prostaglandins Other Lipid
Mediat 2003;71:189-204.
Ichikawa S, Koller DL, Johnson ML, Lai D, Xuei X, Edenberg
HJ, Klein RF, Orwoll ES, Hui SL, Foroud TM, Peacock M,
Econs MJ. Human ALOX12, but not ALOX15, is associated
with BMD in white men and women. J Bone Miner Res
2006;21:556-564.
Nie D, Nemeth J, Qiao Y, Zacharek A, Li L, Hanna K, Tang K,
Hillman GG, Cher ML, Grignon DJ, Honn KV. Increased
metastatic potential in human prostate carcinoma cells by
overexpression of arachidonate 12-lipoxygenase. Clin Exp
Metastasis 2003;20:657-663.
Mohammad AM, Abdel HA, Abdel W, Ahmed AM, Wael T,
Eiman G. Expression of cyclooxygenase-2 and 12lipoxygenase in human breast cancer and their relationship
with HER-2/neu and hormonal receptors: impact on prognosis
and therapy. Indian J Cancer 2006;43:163-168.
Yoshimura R, Matsuyama M, Tsuchida K, Kawahito Y, Sano H,
Nakatani T. Expression of lipoxygenase in human bladder
carcinoma and growth inhibition by its inhibitors. J Urol
2003;170:1994-1999.
Goodman JE, Bowman ED, Chanock SJ, Alberg AJ, Harris
CC. Arachidonate lipoxygenase (ALOX) and cyclooxygenase
(COX) polymorphisms and colon cancer risk. Carcinogenesis
2004;25:2467-2472.
Nie D, Krishnamoorthy S, Jin R, Tang K, Chen Y, Qiao Y,
Zacharek A, Guo Y, Milanini J, Pages G, Honn KV.
Mechanisms regulating tumor angiogenesis by 12lipoxygenase in prostate cancer cells. J Biol Chem 2006
;281:18601-18609.
Matsuyama M, Yoshimura R, Mitsuhashi M, Hase T, Tsuchida
K, Takemoto Y, Kawahito Y, Sano H, Nakatani T. Expression
of lipoxygenase in human prostate cancer and growth
reduction by its inhibitors. Int J Oncol 2004;24:821-827.
Quintana LF, Guzmán B, Collado S, Clària J, Poch E. A coding
polymorphism in the 12-lipoxygenase gene is associated to
essential hypertension and urinary 12(S)-HETE. Kidney Int
2006;69:526-530.
Praticò D, Zhukareva V, Yao Y, Uryu K, Funk CD, Lawson JA,
Trojanowski JQ, Lee VM. 12/15-lipoxygenase is increased in
Alzheimer's disease: possible involvement in brain oxidative
stress. Am J Pathol 2004;164:1655-1662.
Tan W, Wu J, Zhang X, Guo Y, Liu J, Sun T, Zhang B, Zhao D,
Yang M, Yu D, Lin D. Associations of functional polymorphisms
in cyclooxygenase-2 and platelet 12-lipoxygenase with risk of
occurrence and advanced disease status of colorectal cancer.
Carcinogenesis 2006 Dec 6.
Yoshimura R, Matsuyama M, Mitsuhashi M, Takemoto Y,
Tsuchida K, Kawahito Y, Sano H, Nakatani T. Relationship
between lipoxygenase and human testicular cancer. Int J Mol
Med 2004;13:389-393.
Gong Z, Hebert JR, Bostick RM, Deng Z, Hurley TG, Dixon
DA, Nitcheva D, Xie D. Common polymorphisms in 5lipoxygenase and 12-lipoxygenase genes and the risk of
incident, sporadic colorectal adenoma. Cancer 2007;109:849857.
Chang WC, Chen BK. Transcription factor Sp1 functions as an
anchor protein in gene transcription of human 12(S)lipoxygenase.
Biochem
Biophys
Res
Commun
2005;338(1):117-121.
This article should be referenced as such:
Banerjee S, Erdog A. ALOX12 (arachidonate 12-lipoxygenase)
Homo sapiens. Atlas Genet Cytogenet Oncol Haematol.2007;
11(3):222-225.
Hung JJ, Wang YT, Chang WC. Sp1 deacetylation induced by
phorbol ester recruits p300 to activate 12(S)-lipoxygenase
gene transcription. Mol Cell Biol 2006;26(5):1770-1785.
Atlas Genet Cytogenet Oncol Haematol. 2007;11(3)
225
Atlas of Genetics and Cytogenetics
in Oncology and Haematology
OPEN ACCESS JOURNAL AT INIST-CNRS
Gene Section
Review
IL6 (interleukin 6 (interferon beta 2))
Stefan Nagel, Roderick AF MacLeod
DSMZ - Deutsche Sammlung von Mikroorganismen und Zellkulturen, Mascheroder Weg 1b 38124,
Braunschweig, Germany
Published in Atlas Database: March 2007
Online updated version: http://AtlasGeneticsOncology.org/Genes/IL6ID519ch7p15.html
DOI: 10.4267/2042/38448
This work is licensed under a Creative Commons Attribution-Non-commercial-No Derivative Works 2.0 France Licence.
© 2007 Atlas of Genetics and Cytogenetics in Oncology and Haematology
Homology
Identity
IL6 shares sequence homology with IL23 (IL23A) and
G-CSF (CSF3).
Hugo: IL6
Other names: interleukin 6; interferon beta 2; IL-6;
HSF; HGF; CDF; BSF2; IFNB2
Location: 7p15.3
Local order: cen. - RAPGEF5- LOC221838 - IL6 TOMM7 - DRCTNNB1A - tel.
Mutations
Note: G/C polymorphism at nucleotide -174 (promoter
region)
Breast cancer prognosis differs between populations.
Despite its lower incidence in Blacks when compared
to Caucasians, mortality among the former is higher.
Genetic factors involved in the molecular pathways
regulating tumor development have been adduced to
explain these differences, and it has been suggested that
the IL-6 gene is a susceptibility factor underlying
ethnic differences in breast cancer survival. Reports of
a G/C polymorphism at nucleotide -174 within the
promoter region of the IL-6 gene support this
contention. This polymorphism modulates IL-6
expression and allele/genotype frequencies at the -174
site differ significantly between ethnic groups.
DNA/RNA
The gene for IL6 is shown in light blue and comprizes 6 exons
(with 375 bp, 103 bp, 191 bp, 114 bp, 147 bp and 542 bp in
length) and 5 introns (with 920 bp, 162 bp, 1058 bp, 707 bp
and 1745 bp in length). The coding part is shown in dark blue.
Description
6 exons.
Transcription
Implicated in
1472 bp transcript with a 639 bp of coding sequence.
Various cancers
Protein
Note: Although IL6 necessary to support growth of
multiple myeloma cells, and is upregulated in certain
tumor types, notably lung (squamous), bladder and
prostate carcinomas, no recurrent chromosome
rearrangements at 7p21 or IL6 rearrangements have
been observed in these neoplasms.
Breast cancer
Cytogenetics
No rearrangements reported.
Oncogenesis
Some cytokines, including IL-6, stimulate breast cancer
proliferation or invasion and serve as negative
The IL6 protein (shown in light green) shares C-terminal a
homologous region (shown in dark green) also found in IL23A
and CSF3.
Description
212 amino acids, 23.7 kd, containing 4 alpha-helices.
Atlas Genet Cytogenet Oncol Haematol. 2007;11(3)
226
IL6 (interleukin 6 (interferon beta 2))
Nagel S, MacLeod RAF
prognostic indicators. Hitherto IL-2, IFNalpha, IFNbeta
IFNgamma, IL-6, IL-12 have been used for anti tumour
treatment of advanced breast cancer either to induce or
increase hormone sensitivity and/or to stimulate
cellular immunity. Cytokines, such as IL-6 play a key
role in regulating estrogen synthesis in normal and
malignant breast tissues. The activities of estradiol
17beta-hydroxysteroid dehydrogenase and estrone
sulfatase are all increased by IL-6. Prostaglandin E2
may also be an important regulator of estradiol activity
in breast tumors while invading macrophages and
lymphocytes may also stimulate estrogen synthesis in
breast cancers.
Prostate cancer
Cytogenetics
No rearrangements reported.
Oncogenesis
IL-6 induces divergent proliferative responses in
prostate cells. IL-6 is expressed in benign and
malignant prostate tissue and levels of both IL-6 and
IL-6R increase during prostate carcinogenesis. Serum
levels of IL-6 are elevated in patients with treatmentrefractory prostate carcinoma.IL-6 has also been shown
to promote prostate cell growth, except in LNCaP cells,
in which arrest and differentiation are produced. IL-6
induces activation of the androgen receptor (AR) in the
absence of androgen. IL-6 also modulates vascular
endothelial
growth
factor
expression
and
neuroendocrine differentiation in prostate cells. AntiIL-6 antibodies showed an inhibitory effect on PC-3
xenografts. Hence, IL-6 is widely considered a
promising potential therapeutic target in prostate
cancer.
Androgen receptor (AR), which is generally expressed
in prostate cancers, promotes tumor progression in
various ways, including ligand-independent activation.
IL-6 is among the most important nonsteroidal
regulators of AR activity reaching about half the
maximum levels achieved by AR alone. At low
concentrations of androgen, IL-6 and androgen operate
synergistically to activate AR.
In prostate carcinoma cells homeodomain protein
GBX2 was identified to contribute directly to IL6
expression by binding within the promoter region
containing the consensus sequence for GBX2.
Multiple myeloma
Cytogenetics
No rearrangements reported.
Oncogenesis
Although interleukin-6 (IL-6) is considered as a key
growth factor for myeloma cells, only a few
subpopulations of tumor cells, such as CD45(+)
immature cells, proliferate in response to IL-6.
However,
increasing
numbers
of cytokines,
chemokines and cell-to-cell contacts been support
growth of MM cells. It has repeatedly shown that
oncogenic mutations as well as the bone marrow matrix
(BMM)
stimulate
IL-6-independent
signalling
pathways
that
protect
MM
cells
from
apoptosis.Hyperdiploid MM tumors contain multiple
trisomies involving chromosomes 3, 5, 7, 9, 11, 15, 19,
and 21, but rarely have IgH translocations, although
CCND-1/CCND-2/CCND-3 dysregulation appears to
occur as an early event. This may sensitize these cells
to proliferative stimuli, resulting in selective expansion
as a result of interaction with BMM that produce IL-6
and other cytokines.
Three types of growth factors have been identified in
plasma cells:
- The IL-6 family cytokines, which activate the Janus
kinase-signal transducer and activator of transcription
(JAK/STAT) and mitogen-activated protein (MAP)
kinase pathways;
- Growth factors activating the phosphatidylinositol
(PI)-3 kinase/AKT and MAP kinase pathways, and
- B-cell-activating factor (BAFF) or proliferationinducing ligand (APRIL).
These growth factors may operate synergetically being
co-localized together with cytoplasmic transduction
elements in membrane caveolae.
Proteasome inhibitors are emerging as a promising
class of anti-cancer therapeutic agents in MM, e.g.
bortezomib
which
inhibits
NF-kappaB
translocation/transcription and critical signalling
pathways, notably IL-6-induced proliferation and/or
survival.
Atlas Genet Cytogenet Oncol Haematol. 2007;11(3)
Hodgkin lymphoma
Cytogenetics
No rearrangements detected.
Oncogenesis
Hodgkin lymphoma (HL) cells express multiple
cytokines, notably IL6, which contributes to the
immunoreactive phenotype and of which high levels
are associated with bad prognosis. Both transcription
factors, NFkB and AP1 are constitutively activated in
in HL cells driving expression of IL6 and also
disturbing the pro/anti-apoptotic balance. Additionally,
homeodomain protein HLXB9 contributes to the IL6
expression. HLXB9 is closely related to homeodomain
protein GBX2 contributing to IL6 expression in
prostate carcinoma cells. So, tumor type specific
homeobox genes are involved in high level expression
of IL6.
Cancer cachexia
Cytogenetics
No rearrangements reported.
227
IL6 (interleukin 6 (interferon beta 2))
Nagel S, MacLeod RAF
kinases in myeloma cell proliferation. Leuk Lymphoma
2003;44(9):1477-1481. (Review).
Oncogenesis
Unlike acute inflammation which is a defense response,
chronic inflammation may promote cancer. Several
pro-inflammatory gene products modulate apoptosis,
proliferation, angiogenesis, invasion, and metastasis,
including IL-6, which is subject to regulation by NFkB, which is constitutively active in most tumors.
About one-in-three cancer deaths are due to cachexia
(wasting) following the hypercatabolism of the body's
carbon sources. Tumor-inflammatory responses
encompass synthesis of cytokines, including IL-6
which induces cachexia by altering lipids and protein
metabolism. IL-6-like cytokines inhibit lipid
biosynthesis by adipocytes and cause the atrophy and
increased catabolism of muscle protein. Reduced serum
IL-6 levels induced by medroxyprogesterone acetate
has been reported to exert an anti-cachectic effect in
advanced breast cancer.
Klein B, Tarte K, Jourdan M, Mathouk K, Moreaux J, Jourdan
E, Legouffe E, De Vos J, Rossi JF. Survival and proliferation
factors of normal and malignant plasma cells. Int J Hematol
2003;78(2):106-113. (Review).
Otsuki T, Sakaguchi H, Hatayama T, Wu P, Takata A, Hyodoh
F. Effects of all-trans retinoic acid (ATRA) on human myeloma
cells. Leuk Lymphoma 2003;44(10):1651-1656. (Review).
Trikha M, Corringham R, Klein B, Rossi JF. Targeted antiinterleukin-6 monoclonal antibody therapy for cancer: a review
of the rationale and clinical evidence. Clin Cancer Res
2003;9(13):4653-4665. (Review).
Berger FG. The interleukin-6 gene: a susceptibility factor that
may contribute to racial and ethnic disparities in breast cancer
mortality. Breast Cancer Res Treat 2004;88(3):281-285.
(Review).
Hideshima T, Bergsagel PL, Kuehl WM, Anderson KC.
Advances in biology of multiple myeloma: clinical applications.
Blood 2004;104(3):607-618. (Review).
Tohnya TM, Figg WD. Immunomodulation of multiple
myeloma. Cancer Biol Ther 2004;3(11):1060-1061. (Review).
References
Atreya R, Neurath MF. Involvement of IL-6 in the pathogenesis
of inflammatory bowel disease and colon cancer. Clin Rev
Allergy Immunol 2005;28(3):187-196. (Review).
Van Damme J, Opdenakker G, Simpson RJ, Rubira MR,
Cayphas S, Vink A, Billiau A, Van Snick J. Identification of the
human 26-kD protein, interferon beta 2 (IFN-beta 2), as a B
cell hybridoma/plasmacytoma growth factor induced by
interleukin 1 and tumor necrosis factor. J Exp Med
1987;165(3):914-919.
Culig Z, Steiner H, Bartsch G, Hobisch A. Interleukin-6
regulation of prostate cancer cell growth. J Cell Biochem
2005;95(3):497-505. (Review).
Goranov SE, Goranova-Marinova VS. Bortezomib (Velcade)--a
new therapeutic strategy for patients with refractory multiple
myeloma. Folia Med (Plovdiv) 2005;47(3-4):11-9. (Review).
Bazan JF. Haemopoietic receptors and helical cytokines.
Immunol. Today 1990;11:350-354. (Review).
Hodge DR, Hurt EM, Farrar WL. The role of IL-6 and STAT3 in
inflammation and cancer. Eur J Cancer 2005;41(16):25022512. (Review).
Akira S. IL-6-regulated transcription factors. Int J Biochem Cell
Biol 1997;29(12):1401-1418. (Review).
Simpson RJ, Hammacher A, Smith DK, Matthews JM, Ward
LD. Interleukin-6: structure-function relationships. Protein Sci
1997;6(5):929-955. (Review).
Kishimoto T. Interleukin-6: from basic science to medicine--40
years in immunology. Annu Rev Immunol 2005;23:1-21.
(Review).
Gao AC, Lou W, Isaacs JT. Enhanced GBX2 expression
stimulates growth of human prostate cancer cells via
transcriptional up-regulation of the interleukin 6 gene. Clin
Cancer Res 2000;6(2):493-497.
Nagel S, Scherr M, Quentmeier H, Kaufmann M, Zaborski M,
Drexler HG, MacLeod RA. HLXB9 activates IL6 in Hodgkin
lymphoma cell lines and is regulated by PI3K signalling
involving E2F3. Leukemia 2005;19(5):841-846.
Kurebayashi J. Regulation of interleukin-6 secretion from
breast cancer cells and its clinical implications. Breast Cancer
2000;7(2):124-129. (Review).
Bommert K, Bargou RC, Stühmer T. Signalling and survival
pathways
in
multiple
myeloma.
Eur
J
Cancer
2006;42(11):1574-1580. (Review).
Barton BE. IL-6-like cytokines and cancer cachexia:
consequences of chronic inflammation. Immunol Res
2001;23(1):41-58. (Review).
Culig Z, Bartsch G. Androgen axis in prostate cancer. J Cell
Biochem 2006;99(2):373-381. (Review).
Culig Z, Bartsch G, Hobisch A. Interleukin-6 regulates
androgen receptor activity and prostate cancer cell growth. Mol
Cell Endocrinol 2002;197(1-2):231-238. (Review).
Ishikawa H, Tsuyama N, Obata M, Kawano M. Related
Mitogenic signals initiated via interleukin-6 receptor complexes
in cooperation with other transmembrane molecules in
myelomas. J Clin Exp Hematop 2006;46(2):55-66. (Review).
Dalton WS. Drug resistance and drug development in multiple
myeloma. Semin Oncol 2002;29(6 Suppl 17):21-25. (Review).
Nicolini A, Carpi A, Rossi G. Cytokines in breast cancer.
Cytokine Growth Factor Rev 2006;17(5):325-337. (Review).
Purohit A, Newman SP, Reed MJ. The role of cytokines in
regulating estrogen synthesis: implications for the etiology of
breast cancer. Breast Cancer Res 2002;4(2):65-69. (Review).
Scheller J, Ohnesorge N, Rose-John S. Interleukin-6 transsignalling in chronic inflammation and cancer. Scand J
Immunol 2006;63(5):321-329. (Review).
Culig Z. Role of the androgen receptor axis in prostate cancer.
Urology 2003;62(5 Suppl 1):21-26. (Review).
Scheller J, Rose-John S. Interleukin-6 and its receptor: from
bench to bedside. Med Microbiol Immunol (Berl)
2006;195(4):173-183. (Review).
Heinrich PC, Behrmann I, Haan S, Hermanns HM, MüllerNewen G, Schaper F. Principles of interleukin (IL)-6-type
cytokine signalling and its regulation. Biochem J 2003;374(Pt
1):1-20.
This article should be referenced as such:
Nagel S, MacLeod RAF. IL6 (interleukin 6 (interferon beta 2)).
Atlas Genet Cytogenet Oncol Haematol.2007;11(3):226-228.
Ishikawa H, Tsuyama N, Abroun S, Liu S, Li FJ, Otsuyama K,
Zheng X, Kawano MM. Interleukin-6, CD45 and the src-
Atlas Genet Cytogenet Oncol Haematol. 2007;11(3)
228
Atlas of Genetics and Cytogenetics
in Oncology and Haematology
OPEN ACCESS JOURNAL AT INIST-CNRS
Gene Section
Mini Review
KLF6 (Krüppel like factor 6)
Scott L Friedman, Goutham Narla, John A Martignetti
Division of Liver Diseases, Box 1123, Mount Sinai School of Medicine, 1425 Madison Ave., Room 11-70C,
New York, NY 10029-6574, USA
Published in Atlas Database: March 2007
Online updated version: http://AtlasGeneticsOncology.org/Genes/KLF6ID44002ch10p15.html
DOI: 10.4267/2042/38449
This work is licensed under a Creative Commons Attribution-Non-commercial-No Derivative Works 2.0 France Licence.
© 2007 Atlas of Genetics and Cytogenetics in Oncology and Haematology
Identity
Localisation
Hugo: KLF6
Other names: BCD1; COPEB (Core promoter binding
protein); CPBP; GBF; PAC1; ST12; Zf9
Location: 10p15.1
Found in both nucleus and cytoplasm, but
predominantly nuclear. Splice variants SV1 and SV2
primarily cytoplasmic and believed to be the result of
loss of nuclear localization signal (NLS). Splice variant
3 retains the NLS.
DNA/RNA
Function
Description
Tumor suppressor gene, immediate early gene in tissue
injury and fibrosis, during adenoviral and pseudomonas
infections and during ischemic reperfusion in kidney.
Transactivator of multiple target genes including p21,
TGFbeta1, TGFbeta receptors type II and TGFbeta
receptors type III, human keratin 4 and 12 genes:
inducible nitric oxide synthase, endoglin, insulin-like
growth factor receptor 1, multi-drug resistance
transporters, E-cadherin, leukotriene C(4)(LTC4S),
laminin 111, acid ceramidase, alpha 1 proteinase
inhibitor.
Suppresses growth by inducing p21, sequestering
cyclin D1 and/or inhibiting c-jun oncogene.
Promotes differentiation of preadipocytes to adipocytes
in culture and hepatocytes in vivo.
Contributes to fetal development of mouse cornea and
lens; and immune and hematopoietic systems by
contributing to hemangioblast phenotype.
Interacts with the core promoter element of a TATA
box-less gene.
Induces apoptosis of lung cancer cells.
Spans 11 kb; five exons; 4 CDS exons.
Transcription
Full length transcript of 4.1 kb, open reading frame 849
bp. There are at least three alternative splice transcripts.
Protein
Description
Full length transcript encodes a 283 amino acids
protein, 42 kDa, with a 201 amino acids transactivation
domain and an 82 amino acids DNA binding domain
with 3 C2H2 zinc fingers. There is at least one putative
nuclear localization signal immediately 5' to the DNA
binding domain.
There are at least three alternative splice transcripts
encoding proteins of 195 (KLF6-SV1), 237 (KLF6SV3), and 241 amino acids (KLF6-SV2).
Several post-translational modifications including
phosphorylation, ubiquitinylation, acetylation are
suggested based on encoded protein sequence motifs.
Homology
The 47 N-terminal amino acids are identical to KLF7,
and the 82 amino acids DNA binding domain highly
homologous to other members of the KLF family. Also
homologous to the Drosophila Luna gene.
Expression
Ubiquitously expressed in adult tissues, restricted
during embryogenesis but includes placenta, neural and
non-neural tissues, and cornea. Full-length KLF6
downregulated in many human cancers (see below).
Expression pattern of KLF6 splice variants may be
upregulated.
Atlas Genet Cytogenet Oncol Haematol. 2007;11(3)
229
KLF6 (Kruppel like factor 6)
Friedman SL et al.
Mutations
between Sp1 and KLF6: their potential role in the response to
vascular injury. Blood 2002;100(12):4001-4010.
Germinal
Chiambaretta F, Blanchon L, Rabier B, Kao WW, Liu JJ,
Dastugue B, Rigal D, Sapin V. Regulation of corneal keratin-12
gene expression by the human Krüppel-like transcription factor
6. Invest Ophthalmol Vis Sci 2002;43(11):3422-3429.
None identified to date. However, a germline single
nucleotide intronic polymorphism (IVS1-27 G > A) has
been identified that creates a novel SRp40 DNA
binding site, therby increasing the generation of three
alternatively spliced mRNAs, and which is associated
with an increased risk of prostate cancer. Other low
frequency coding and non-coding SNPs have been
identified.
Yasuda K, Hirayoshi K, Hirata H, Kubota H, Hosokawa N,
Nagata K. The Krüppel-like factor Zf9 and proteins in the Sp1
family regulate the expression of HSP47, a collagen-specific
molecular chaperone. J Biol Chem 2002;277(47):44613-44622.
Chen C, Hyytinen ER, Sun X, Helin HJ, Koivisto PA, Frierson
HF Jr, Vessella RL, Dong JT. Deletion, mutation, and loss of
expression of KLF6 in human prostate cancer. Am J Pathol
2003;162(4):1349-1354.
Somatic
De Graeve F, Smaldone S, Laub F, Mlodzik M, Bhat M,
Ramirez F. Identification of the Drosophila progenitor of
mammalian Krüppel-like factors 6 and 7 and a determinant of
fly development. Gene 2003;314:55-62.
A number of somatic mutations were originally
identified in prostate cancer and shown to result in loss
of function. These include Trp64Arg, Ser116Pro,
Ala123Asp and Ser137X.
Jeng YM, Hsu HC. KLF6, a putative tumor suppressor gene, is
mutated in astrocytic gliomas. Int J Cancer 2003;105(5):625629.
References
Warke VG, Nambiar MP, Krishnan S, Tenbrock K, Geller DA,
Koritschoner NP, Atkins JL, Farber DL, Tsokos GC.
Transcriptional activation of the human inducible nitric-oxide
synthase promoter by Krüppel-like factor 6. J Biol Chem
2003;278(17):14812-14819.
Kim Y, Ratziu V, Choi SG, Lalazar A, Theiss G, Dang Q, Kim
SJ, Friedman SL. Transcriptional activation of transforming
growth factor beta1 and its receptors by the Krüppel-like factor
Zf9/core promoter-binding protein and Sp1. Potential
mechanisms for autocrine fibrogenesis in response to injury. J
Biol Chem 1998;273(50):33750-33758.
Benzeno S, Narla G, Allina J, Cheng GZ, Reeves HL, Banck
MS, Odin JA, Diehl JA, Germain D, Friedman SL. Cyclindependent kinase inhibition by the KLF6 tumor suppressor
protein through interaction with cyclin D1. Cancer Res
2004;64(11):3885-3891.
Ratziu V, Lalazar A, Wong L, Dang Q, Collins C, Shaulian E,
Jensen S, Friedman SL. Zf9, a Krüppel-like transcription factor
up-regulated in vivo during early hepatic fibrosis. Proc Natl
Acad Sci USA 1998;95(16):9500-9505.
Ito G, Uchiyama M, Kondo M, Mori S, Usami N, Maeda O,
Kawabe T, Hasegawa Y, Shimokata K, Sekido Y. Krüppel-like
factor 6 is frequently down-regulated and induces apoptosis in
non-small
cell
lung
cancer
cells.
Cancer
Res
2004;64(11):3838-3843.
Kojima S, Hayashi S, Shimokado K, Suzuki Y, Shimada J,
Crippa MP, Friedman SL. Transcriptional activation of
urokinase by the Krüppel-like factor Zf9/COPEB activates
latent TGF-beta1 in vascular endothelial cells. Blood
2000;95(4):1309-1316.
Kimmelman AC, Qiao RF, Narla G, Banno A, Lau N, Bos PD,
Nuñez Rodriguez N, Liang BC, Guha A, Martignetti JA,
Friedman SL, Chan AM. Suppression of glioblastoma
tumorigenicity by the Krüppel-like transcription factor KLF6.
Oncogene 2004;23(29):5077-5083.
Okano J, Opitz OG, Nakagawa H, Jenkins TD, Friedman SL,
Rustgi AK. Krüppel-like transcriptional factors Zf9 and GKLF
coactivate the human keratin 4 promoter and physically
interact. FEBS Lett 2000;473(1):95-100.
Kremer-Tal S, Reeves HL, Narla G, Thung SN, Schwartz M,
Difeo A, Katz A, Bruix J, Bioulac-Sage P, Martignetti JA,
Friedman SL. Frequent inactivation of the tumor suppressor
Krüppel-like factor 6 (KLF6) in hepatocellular carcinoma.
Hepatology 2004;40(5):1047-1052.
Zhao JL, Austen KF, Lam BK. Cell-specific transcription of
leukotriene C(4) synthase involves a Krüppel-like transcription
factor and Sp1. J Biol Chem 2000;275(12):8903-8910.
Blanchon L, Bocco JL, Gallot D, Gachon AM, Lémery D,
Déchelotte P, Dastugue B, Sapin V. Co-localization of KLF6
and KLF4 with pregnancy-specific glycoproteins during human
placenta development. Mech Dev 2001;105(1-2):185-189.
Nakamura H, Chiambaretta F, Sugar J, Sapin V, Yue BY.
Developmentally regulated expression of KLF6 in the mouse
cornea and lens. Invest Ophthalmol Vis Sci 2004;45(12):43274332.
Fischer EA, Verpont MC, Garrett-Sinha LA, Ronco PM,
Rossert JA. Klf6 is a zinc finger protein expressed in a cellspecific manner during kidney development. J Am Soc Nephrol
2001;12(4):726-735.
Reeves HL, Narla G, Ogunbiyi O, Haq AI, Katz A, Benzeno S,
Hod E, Harpaz N, Goldberg S, Tal-Kremer S, Eng FJ, Arthur
MJ, Martignetti JA, Friedman SL. Krüppel-like factor 6 (KLF6)
is a tumor-suppressor gene frequently inactivated in colorectal
cancer. Gastroenterology 2004;126(4):1090-1103.
Laub F, Aldabe R, Ramirez F, Friedman S. Embryonic
expression of Krüppel-like factor 6 in neural and non-neural
tissues. Mech Dev 2001;106(1-2):167-170.
Rubinstein M, Idelman G, Plymate SR, Narla G, Friedman SL,
Werner H. Transcriptional activation of the insulin-like growth
factor I receptor gene by the Krüppel-like factor 6 (KLF6) tumor
suppressor protein: potential interactions between KLF6 and
p53. Endocrinology 2004;145(8):3769-3777.
Narla G, Heath KE, Reeves HL, Li D, Giono LE, Kimmelman
AC, Glucksman MJ, Narla J, Eng FJ, Chan AM, Ferrari AC,
Martignetti JA, Friedman SL. KLF6, a candidate tumor
suppressor gene mutated in prostate cancer. Science
2001;294(5551):2563-2566.
Slavin DA, Koritschoner NP, Prieto CC, Lopez-Diaz FJ,
Chatton B, Bocco JL. A new role for the Krüppel-like
transcription factor KLF6 as an inhibitor of c-Jun protooncoprotein function. Oncogene 2004;23(50):8196-8205.
Botella LM, Sánchez-Elsner T, Sanz-Rodriguez F, Kojima S,
Shimada J, Guerrero-Esteo M, Cooreman MP, Ratziu V, Langa
C, Vary CP, Ramirez JR, Friedman S, Bernabeu C.
Transcriptional activation of endoglin and transforming growth
factor-beta signaling components by cooperative interaction
Atlas Genet Cytogenet Oncol Haematol. 2007;11(3)
Cho YG, Kim CJ, Park CH, Yang YM, Kim SY, Nam SW, Lee
SH, Yoo NJ, Lee JY, Park WS. Genetic alterations of the KLF6
gene in gastric cancer. Oncogene 2005;24(28):4588-4590.
230
KLF6 (Kruppel like factor 6)
Friedman SL et al.
Gehrau RC, D'Astolfo DS, Prieto C, Bocco JL, Koritschoner
NP. Genomic organization and functional analysis of the gene
encoding the Krüppel-like transcription factor KLF6. Biochim
Biophys Acta 2005;1730(2):137-146.
DiFeo A, Narla G, Camacho-Vanegas O, Nishio H, Rose SL,
Buller RE, Friedman SL, Walsh MJ, Martignetti JA. E-cadherin
is a novel transcriptional target of the KLF6 tumor suppressor.
Oncogene 2006;25(44):6026-6031.
Li D, Yea S, Dolios G, Martignetti JA, Narla G, Wang R, Walsh
MJ, Friedman SL. Regulation of Krüppel-like factor 6 tumor
suppressor
activity
by
acetylation.
Cancer
Res
2005;65(20):9216-9225.
DiFeo A, Narla G, Hirshfeld J, Camacho-Vanegas O, Narla J,
Rose SL, Kalir T, Yao S, Levine A, Birrer MJ, Bonome T,
Friedman SL, Buller RE, Martignetti JA. Roles of KLF6 and
KLF6-SV1 in ovarian cancer progression and intraperitoneal
dissemination. Clin Cancer Res 2006;12(12):3730-3739.
Li D, Yea S, Li S, Chen Z, Narla G, Banck M, Laborda J, Tan
S, Friedman JM, Friedman SL, Walsh MJ. Krüppel-like factor-6
promotes preadipocyte differentiation through histone
deacetylase 3-dependent repression of DLK1. J Biol Chem
2005;280(29):26941-26952.
Matsumoto N, Kubo A, Liu H, Akita K, Laub F, Ramirez F,
Keller G, Friedman SL. Developmental regulation of yolk sac
hematopoiesis
by
Krüppel-like
factor
6.
Blood
2006;107(4):1357-1365.
Narla G, Difeo A, Reeves HL, Schaid DJ, Hirshfeld J, Hod E,
Katz A, Isaacs WB, Hebbring S, Komiya A, McDonnell SK,
Wiley KE, Jacobsen SJ, Isaacs SD, Walsh PC, Zheng SL,
Chang BL, Friedrichsen DM, Stanford JL, Ostrander EA,
Chinnaiyan AM, Rubin MA, Xu J, Thibodeau SN, Friedman SL,
Martignetti JA. A germline DNA polymorphism enhances
alternative splicing of the KLF6 tumor suppressor gene and is
associated with increased prostate cancer risk. Cancer Res
2005;65(4):1213-1222.
Spinola M, Leoni VP, Galvan A, Korsching E, Conti B,
Pastorino U, Ravagnani F, Columbano A, Skaug V, Haugen A,
Dragani TA. Genome-wide single nucleotide polymorphism
analysis of lung cancer risk detects the KLF6 gene. Cancer
Lett, 2007.
Yin D, Komatsu N, Miller CW, Chumakov AM, Marschesky A,
McKenna R, Black KL, Koeffler HP. KLF6: mutational analysis
and effect on cancer cell proliferation. Int J Oncol
2007;30(1):65-72.
Narla G, DiFeo A, Yao S, Banno A, Hod E, Reeves HL, Qiao
RF, Camacho-Vanegas O, Levine A, Kirschenbaum A, Chan
AM, Friedman SL, Martignetti JA. Targeted inhibition of the
KLF6 splice variant, KLF6 SV1, suppresses prostate cancer
cell growth and spread. Cancer Res 2005;65(13):5761-5768.
Atlas Genet Cytogenet Oncol Haematol. 2007;11(3)
This article should be referenced as such:
Friedman SL, Narla G, Martignetti JA. KLF6 (Krüppel like factor
6). Atlas Genet Cytogenet Oncol Haematol.2007;11(3):229231.
231
Atlas of Genetics and Cytogenetics
in Oncology and Haematology
OPEN ACCESS JOURNAL AT INIST-CNRS
Gene Section
Review
MIRN21 (microRNA 21)
Sadan Duygu Selcuklu, Mustafa Cengiz Yakicier, Ayse Elif Erson
Biology Department, Room: 141, Middle East Technical University, Ankara 06531, Turkey
Published in Atlas Database: March 2007
Online updated version: http://AtlasGeneticsOncology.org/Genes/MIRN21ID44019ch17q23.html
DOI: 10.4267/2042/38450
This work is licensed under a Creative Commons Attribution-Non-commercial-No Derivative Works 2.0 France Licence.
© 2007 Atlas of Genetics and Cytogenetics in Oncology and Haematology
sequences of MIRN21 showed enrichment for Pol II
but not Pol III.
MIRN21 gene was shown to harbor a 5' promoter
element. 1008 bp DNA fragment for MIRN21 gene
was cloned (-959 to +49 relative to T1 transcription
site, see Figure 1; A). Analysis of the sequence showed
a candidate 'CCAAT' box transcription control element
located approximately about 200 nt upstream of the T1
site. T1 transcription site was found to be located in a
sequence
similar
to
'TATA'
box
(ATAAACCAAGGCTCTTACCATAGCTG). To test
the activity of the element, about 1kb DNA fragment
was inserted into the 5' end of firefly luciferase
indicator gene and transfected into 293T cells. The
sense orientation insert, unlike antisense, induced
luciferase activity.
pri-MIRN21 gene was reported to have two
transcription sites, T1 and T2. T1 (identified by RACE,
+1 start site) was reported as the minor transcription
site and T2 (identified by RACE, +27 start site) as the
major transcription start site. Based on the data of
pmiR-21-luc expression plasmid, the endogenous priMIRN21 was suggested to utilize T1 and T2 sites for
initiation of transcription (Figure 1; A).
The maturation of miRNA gene involves sequential
process.
Pri-miRNA
The miRNA genes are first transcribed in nucleus as
long primary transcripts called pri-miRNA. The
primary transcript for MIRN21 is found to be 3433-nt
long.
For localization of the pri-MIRN21 transcript, total,
nuclear and cytoplasmic RNA fractions from HeLa
cells were oligo-dT primed and reverse transcribed into
cDNA. pri-MIRN21 transcript was found mainly in the
nucleus as well as modest levels in the cytoplasm.
Sequence: NCBI cDNA clone: BC053563. Length:
3389bp
Identity
Hugo: MIRN21
Other names: hsa-mir-21; miR-21
Location: 17q23.1
Location base pair: MIRN21 is located on chr17:
55273409-55273480 (+).
Local order: Based on Mapviewer, genes flanking
MIRN21 oriented from centromere to telomere on
17q23 are:
- TMEM49, transmembrane protein 49, 17q23.1.
- MIRN21, microRNA 21, 17q23.1.
- TUBD1, tubulin, delta 1, 17q23.1.
- LOC729565, similar to NADH dehydrogenase
(ubiquinone) 1 beta subcomplex, 8, 19 kDa, 17q23.1.
- RPS6KB1, ribosomal protein S6 kinase, 7 0kDa,
polypeptide 1, 17q23.1.
DNA/RNA
Description
The gene is located in an intergenic region. The length
of MIRN21 gene is reported as 3433 nucleotides long.
It overlaps with the 3' UTR end of the Transmembrane
Protein 49 (TMEM 49) (also known as Human Vacuole
Membrane Protein 1, VMP-1).
Transcription
RNA Pol II is suggested to be the most likely enzyme
involved in miRNA transcription. However, current
studies also provide evidences for RNA Pol III
dependent transcription of few miRNAs interspersed
among repetitive Alu elements.
For MIRN21, the major RNA polymerase is likely to
be RNA Pol II due to the presence of 5' cap and 3' poly
(A)
tail
of
the
pri-MIRN21.
Chromatin
immunoprecipitation (ChIP) analysis of upstream
Atlas Genet Cytogenet Oncol Haematol. 2007;11(3)
232
MIRN21 (microRNA 21)
Selcuklu SD et al.
Figure 1. A: Characterization of the full-length about 3433 nt pri-MIRN21.
Open Reading frame analysis within the 3433 nucleotides identified a potential 124 amino acids long peptide. This uncharacterized ORF
is located near the transcription start site (+114).
This potential peptide sequence shows homology to a 180-amino-acid human protein. However, it is not clear yet if pri-MIRN21 functions
as an mRNA as well.
Figure 1. B: Stem-loop structure of MIRN21.
incorporated in to a protein complex, RNA induced
silencing complex (RISC), targeting a partially
complementary target mRNA.
MIRN21 is 22 nucleotides long.
Sequence: UAGCUUAUCAGACUGAUGUUGA.
Pre-miRNA
The primary transcripts of microRNAs are processed
by enzymatic microprocessor Drosha (RNase III
enzyme) and DGCR8 (dsRNA binding protein) from
their 3' and 5' cleavage sites into an intermediate stemloop precursor or pre-miRNA in the nucleus.
The precursor of MIRN21 is 72 bases long (preMIRN21), forms a secondary structure, and contains
the mature miRNA sequence, stem and terminal loop
structures with 2-nt 3'overhang (Figure 1; B). The
precursor is then transferred from nucleus to cytoplasm
by the enzyme Exportin 5. In cytoplasm, a second
RNase III enzyme, Dicer, removes terminal loop
generating about 20-bp RNA duplex.
Length: 72 bases
Sequence:
UGUCGGGUAGCUUAUCAGACUGAUGUUGACU
GUUGAAUCUCAUGGCAACACCAGUCGAUGGG
CUGUCUGACA (Figure 1; B).
Mature MIRN21
The mature miRNA forms one strand of the RNA
duplex. One strand is degraded and other is
Atlas Genet Cytogenet Oncol Haematol. 2007;11(3)
Pseudogene
No reported pseudogenes.
Protein
Note: miRNAs are not translated into amino acids.
Mutations
Note: In a panel of 91 human cancer cell lines
representing several human cancers, sequencing
showed no sequence variations in mature miRNAs.
In HCT-15 colon cancer cell line, pri-MIRN21 showed
a A+29G (A/G) heterozygous variation (Figure 2).
It was suggested that sequence variations in primiRNAs may cause structural alterations. However, the
variation was not found to be affecting pri-MIRN21
processing when it was compared to the wild type.
233
MIRN21 (microRNA 21)
Selcuklu SD et al.
Figure 2. Localization of sequence variation in pri-MIRN21 in HTC-15 colon cancer cell line.
Implicated in
Breast Cancer
Human neoplasms
Disease
RNAs from 76 breast cancer tumors and 14 cell lines
were analyzed by using miRNA microarray and
Northern blotting (10 normal samples were used for
comparison and normalization). MIRN21 was upregulated and the results were confirmed by Northern
blotting.
Consistent with other studies, MIRN21 overexpression
in breast tumors compared to matched normal breast
tissues was verified by stem-loop RT real-time PCR
and miRNA microarrays containing 157 mature human
miRNAs.
Oncogenesis
Apoptosis: Inhibition of MIRN21 in breast cancer cell
line MCF-7 by transfection of anti-mir-21 inhibitors
(chemically modified oligonucleotides) showed growth
inhibition. Treatment of transfected MCF-7 cell line
with anticancer drug topotecan (TPT) caused cell
growth inhibition by 40%. The results suggested
suppression of MIRN21 gene could sensitize tumor
cells to anticancer drugs. Inhibition of MIRN21 in a
xenograft carcinoma mouse model verified tumor
growth suppression.
Transfection results of MCF-7 cells with a general
caspase inhibitor suggested MIRN21 role in regulation
of bcl-2 gene expression indirectly, possibly controlling
expression of genes involved in apoptosis pathways
including bcl-2.
Note: Overexpression was fist shown in glioblastoma
and then in papillary thyroid carcinoma (PTC), breast
tumors and other various tumors (e.g. colorectal
carcinoma, lung tumors, pancreatic tumors, prostate
tumors,
stomach
tumors
cholangiocarcinomas,
neuroblastoma, hepatocellular carcinoma and uterine
leiomyomas) and cervical adenocarcinoma cell line,
HeLa.
Relatively low expression was seen in cell lines HL-60
(promyelocytic leukemia), K562 (chronic myelogenous
leukemia) and prostatic adenocarcinoma cell line.
miRNA microarray data from 540 samples from 6 solid
cancers (lung, stomach, prostate, colon, pancreatic and
breast) showed overexpression of MIRN21 gene
compared to normal cells.
Glioblastoma
Disease
Overexpression of MIRN21 was first shown in
malignant human brain tumor cells. When, human
glioblastoma tumor tissues, 12 early passage cultures
(passage 3) from high grade gliomas and 6
glioblastoma cell lines (A172, U87, U373, LN229,
LN428 and LN308) were compared to non-neoplastic
glial cells and a variety of mammalian tissues, MIRN21
was found to be strongly overexpressed in the
neoplastic samples. Moreover, oligonucleotide
microarrays specific for 180 human and mouse
miRNAs and Northern blotting methods were used to
profile expression of MIRN21. In glioblastoma tissues
its expression showed 5 to 100 fold increase compared
to non-neoplastic brain sample and 5 to 30 fold
increase in cell lines compared to normal.
Oncogenesis
Apoptosis: Loss-of-function approach was used to
identify the biological significance of MIRN21 in
glioblastoma cells. Sequence specific inhibitors (2’-Omethyl-oligonucleotides) were used to knock-down
MIRN21 transcript and apoptosis activity (caspase-3
and caspase-7 enzymatic activities) was measured. 48
hours post-transfection, caspase activity increased 3folds suggesting that MIRN21 acted as an antiapoptotic factor in glioblastoma cells through blocking
expression of key apoptosis-enabling genes.
Atlas Genet Cytogenet Oncol Haematol. 2007;11(3)
Pancreatic cancer
Disease
16 pancreatic adenocarcinomas and 10 adjacent benign
tissues compared to 6 normal pancreas samples were
analyzed for MIRN21 precursor expression and
compared to mature MIRN21 by using real-time PCR
assay. The results were consistent between precursor
and mature MIRN21 showing overexpression.
Neuroblastoma
Disease
Neuroblastoma cell line, SH-SY5Y, was treated with a
tumor promoting agent (12-O-tetradecanoyl phorbol
13-acetate (TPA)) to induce differentiation into a
neuronal phenotype. Following stimulation, microarray
analysis of stem-loop precursors was performed and
MIRN21 showed 7-8 times higher expression
234
MIRN21 (microRNA 21)
Selcuklu SD et al.
compared to other up-regulated miRNAs showing 2-4
times relative increase.
References
Lung cancer
Lee Y, Ahn C, Han J, Choi H, Kim J, Yim J, Lee J, Provost P,
Rǻdmark O, Kim S, Kim VN. The nuclear Rnase III Drosha
initiates microRNA processing. Nature 2003;425:415-418.
Disease
Analysis of 104 pairs of primary lung cancers and noncancerous lung tissues by microRNA microarray
showed differential expression of mature MIRN21
among phenotypical and histological classifications.
The results were confirmed by solution hybridization
and RT-PCR. The results verified up-regulation of
MIRN21 in lung cancer tissues compared to normals.
Moreover, real time RT-PCR results for stem-loop
precursor of MIRN21 showed at least 2-fold upregulation in 66% of 32 cases.
Cai X, Hagedorn CH, Cullen BR. Human microRNAs are
processed from capped, polyadenylated transcripts that can
also function as mRNAs. RNA 2004;10:1957-1966.
Calin GA, Sevignani C, Dumitru CD, Hyslop T, Noch E,
Yendamuri S, Shimizu M, Rattan S, Bullrich F, Negrini M,
Croce CM. Human microRNA genes are frequently located at
fragile sites and genomic regions involved in cancers. PNAS
2004;101:2999-3004.
Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY,
Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS. Human
embryonic stem cells express a unique set of microRNAs. Dev
Biol 2004;270:488-498.
Chan JA, Krichevsky AM, Kosik KS. MicroRNA-21 Is an
Antiapoptotic Factor in Human Glioblastoma Cells. Cancer Res
2005;65:(14).
Other cancers
Disease
In other miRNA microarray studies, MIRN21 was
found to be overexpressed in papillary thyroid cancer,
hepatocellular carcinoma, cholangiocarcinomas and
uterine leiomyomas. A study suggested that MIRN21
inhibition in a cervical adenocarcinoma cell line, HeLa,
caused increase in cell growth.
Prognosis
MIRN21 (as well as 7 other miRNAs) expresion was
correlated with adenocarcinoma patients¹ survival.
Patients that have high expression of MIRN21 were
found to have worse prognosis. Thus, in addition to
potential role of MIRN21 in lung carcinogenesis
through apoptosis pathway, it was suggested that
expression profiles could be informative in
adenocarcinoma patient survival.
Cytogenetics
Genomic amplification of chromosome band 17q23.2
in neuroblastoma, breast cancer, colon cancer, lung
cancer is known.
Oncogenesis
Apoptosis: MIRN21 was found to be highly overexpressed
in
malignant
cholangiocytes.
In
cholangiocarcinoma cells it was shown that one of the
targets of MIRN21 was PTEN encoding phosphatase
that inhibited the survival and growth promoting
activity of PI 3-kinase (phosphoinositole 3-kinase)
signaling.
In another report, inhibiton of MIRN21 showed
increased sensitivity to gemcitabine. The results
suggested that MIRN21 regulated gemcitabine-induced
apoptosis by PTEN (phosphatase and tensin homolog)
dependent activation of PI 3-kinase and AKT/mTOR
signaling. These studies suggested anti-apoptotic role
for the MIRN21 gene.
Atlas Genet Cytogenet Oncol Haematol. 2007;11(3)
Cheng AM, Byrom MW, Shelton J, Ford LP. Antisense
inhibition of human miRNAs and indications for an involvement
of miRNA in cell growth and apoptosis. Nucleic Acids Res
2005;4:1290-1297.
Fukuda Y, Kawasaki H, Taira K. Exploration of human miRNA
target genes in neuronal differentiation. Nucleic Acids Symp
Ser (Oxf) 2005;49:341-342.
He H, Jazdzewski K, Li W, Liyanarachchi S, Nagy R, Volinia S,
Calin GA, Liu CG, Franssila K, Suster S, Kloos RT, Croce CM,
de la Chapelle A. The role of microRNA genes in papillary
thyroid carcinoma. PNAS 2005;102:19075-19080.
Iorio MV, Ferracin M, Liu CG, Veronese A, Spizzo R, Sabbioni
S, Magri E, Pedriali M, Fabbri M, Campiglio M, Ménard S,
Palazzo JP, Rosenberg A, Musiani P, Volinia S, Nenci I, Calin
GA, Querzoli P, Negrini M, Croce CM. MicroRNA Gene
Expression Deregulation in Human Breast Cancer. Cancer Res
2005;65:7065-7070.
Zeng Y, Yi R, Cullen BR. Recognition and cleavage of primary
microRNA precursors by the nuclear processing enzyme
Drosha. The EMBO Journal 2005;24:138-148.
Borchert GM, Lanier W, Davidson BL. RNA polymerase III
transcribes human microRNAs. Nat Struct Mol Biol
2006;12:1097-1101.
Calin GA, Croce CM. MicroRNAs and chromosomal
abnormalities in cancer cells. Oncogene 2006;25:6202-6210.
(Review).
Diederichs S, Haber DA. Sequence variations of microRNAs in
human cancer: alterations in predicted secondary structure do
not affect processing. Cancer Res 2006;66:6097-6104.
Si ML, Zhu S, Wu H, Lu Z, Wu F, Mo YY. miR-21-mediated
tumor growth. Oncogene 2006;1-5.
Volinia S, Calin GA, Liu CG, Ambs S, Cimmino A, Petrocca F,
Visone R, Iorio M, Roldo C, Ferracin M, Prueitt RL, Yanaihara
N, Lanza G, Scarpa A, Vecchione A, Negrini M, Harris CC,
Croce CM. A microRNA expression signature of human solid
tumors defines cancer gene targets. PNAS 2006;103:22572261.
Yanaihara N, Caplen N, Bowman E, Seike M, Kumamoto K, Yi
M, Stephens RM, Okamoto A, Yokota J, Tanaka T, Calin GA,
Liu CG, Croce CM, Harris CC. Unique microRNA molecular
profiles in lung cancer diagnosis and prognosis. Cancer Cell
2006;9:189-198.
235
MIRN21 (microRNA 21)
Selcuklu SD et al.
Lee EJ, Gusev Y, Jiang J, Nuovo GJ, Lerner MR, Frankel WL,
Morgan DL, Postier RG, Brackett DJ, Schmittgen TD.
Expression profiling identifies microRNA signature in
pancreatic cancer. Int J Cancer 2007;120:1046-1054.
This article should be referenced as such:
Selcuklu SD, Yakicier MC, Erson AE. MIRN21 (microRNA 21).
Atlas Genet Cytogenet Oncol Haematol.2007;11(3):232-236.
Wang T, Zhang X, Obijuru L, Laser J, Aris V, Lee P, Mittal K,
Soteropoulos P, Wei JJ. A micro-RNA signature associated
with race, tumor size, and target gene activity in human uterine
leiomyomas. Genes Chromosomes Cancer 2007;46:336-347.
Atlas Genet Cytogenet Oncol Haematol. 2007;11(3)
236
Atlas of Genetics and Cytogenetics
in Oncology and Haematology
OPEN ACCESS JOURNAL AT INIST-CNRS
Gene Section
Short Communication
PSIP1 (PC4 and SFRS1 interacting protein 1)
Cristina Morerio, Claudio Panarello
Dipartimento di Ematologia ed Oncologia Pediatrica, IRCCS Istituto Giannina Gaslini, Largo G. Gaslini 5,
16147 Genova, Italy
Published in Atlas Database: March 2007
Online updated version: http://AtlasGeneticsOncology.org/Genes/PSIP1ID405ch9q22.html
DOI: 10.4267/2042/38451
This work is licensed under a Creative Commons Attribution-Non-commercial-No Derivative Works 2.0 France Licence.
© 2007 Atlas of Genetics and Cytogenetics in Oncology and Haematology
reveal LEDGF as an oncogenic protein that controls a
caspase-independent lysosomal cell death pathway.
Identity
Hugo: PSIP1
Other names: LEDGF (lens
growth factor); p75; p52
Location: 9p22.3
Homology
epithelium-derived
PSIP1 belongs to the hepatoma-derived growth factor
(HDGF) family of proteins that contain a well
conserved N-terminal amino acid sequence known as
the HATH (homologous to amino terminus of HDGF)
region.
DNA/RNA
Description
The gene contains at least 15 exons and 14 introns.
Implicated in
Transcription
t(9;11)(p22;p15) NUP98-PSIP1
Two alternative splice variants: p75 and p52.
Note: acute non lymphoblastic leukemia (ANLL), one
case of transformed chronic myeloid leukemia (CMLBC).
Hybrid/Mutated Gene
5'NUP98 - 3'PSIP1.
Abnormal Protein
Fuses the GLFG repeat domains of NUP98 to the
COOH-terminus of PSIP1.
Protein
Description
530 amino acids (p75), 333 amino acids (p52);
N-term - PWWP (proline - tryptophan - tryptophan proline) domain - NLS (nuclear localization signal) AT-hook-like - Coiled coil - IBD (integrase binding
domain) - HTH1 (helix-turn-helix DNA binding motif)
- HTH2 - C-term.
References
Expression
Ahuja HG, Hong J, Aplan PD, Tcheurekdjian L, Forman SJ,
Slovak ML. t(9;11)(p22;p15) in acute myeloid leukemia results
in a fusion between NUP98 and the gene encoding
transcriptional coactivators p52 and p75-lens epitheliumderived growth factor (LEDGF). Cancer Res 2000;60:62276229.
Expression of PSIP1 has been reported to be increased
in human breast and bladder cancer, prostate tumors
and benign prostate hyperplasia.
Localisation
Singh DP, Kimura A, Chylack LT, Shinohara T. Lens
epithelium-derived growth factor (LEDGF/p75) and p52 are
derived from a single gene by alternative splicing. Gene
2000;242:265-273.
Nuclear.
Function
Hussey DJ, Moore S, Nicola M, Dobrovic A. Fusion of the
NUP98 gene with the LEDGF/p52 gene defines a recurrent
acute myeloid leukemia translocation. BMC Genet 2001;2:20.
Transcriptional regulation of stress-associated genes,
mRNA splicing and cell survival. The involvement of
PSIP1 (LEDGF) has been reported in human
immunodeficiency virus type-1 (HIV-1) integration,
autoimmune disorders, and neurogenesis. Recent data
Atlas Genet Cytogenet Oncol Haematol. 2007;11(3)
Wu X, Daniels T, Molinaro C, Lilly MB, Casiano CA. Caspase
cleavage of the nuclear autoantigen LEDGF/p75 abrogates its
pro-survival function: implications for autoimmunity in atopic
disorders. Cell Death Differ 2002;9:915-925.
237
PSIP1 (PC4 and SFRS1 interacting protein 1)
Morerio C, Panarello C
Cherepanov P, Maertens G, Proost P, Devreese B, Van
Beeumen J, Engelborghs Y, De Clercq E, Debyser Z. HIV-1
integrase forms stable tetramers and associates with
LEDGF/p75 protein in human cells. J Biol Chem 2003;278:372381.
localization signal of LEDGF: contribution of two helix-turnhelix (HTH)-like domains and a stretch of 58 amino acids of the
N-terminal to the trans-activation potential of LEDGF. J Mol
Biol 2006;355:379-394.
Sutherland HG, Newton K, Brownstein DG, Holmes MC, Kress
C, Semple CA, Bickmore WA. Disruption of Ledgf/Psip1 results
in perinatal mortality and homeotic skeletal transformations.
Mol Cell Biol 2006;26:7201-7210.
Daniels T, Zhang J, Gutierrez I, Elliot ML, Yamada B, Heeb
MJ, Sheets SM, Wu X, Casiano CA. Antinuclear
autoantibodies in prostate cancer: immunity to LEDGF/p75, a
survival protein highly expressed in prostate tumors and
cleaved during apoptosis. Prostate 2005;62:14-26.
Daugaard M, Kirkegaard-Sørensen T, Ostenfeld MS, Aaboe M,
Høyer-Hansen M, Orntoft TF, Rohde M, Jäättelä M. Lens
epithelium-derived growth factor is an Hsp70-2 regulated
guardian of lysosomal stability in human cancer. Cancer Res
2007;67:2559-2567.
Grand FH, Koduru P, Cross NC, Allen SL. NUP98-LEDGF
fusion and t(9;11) in transformed chronic myeloid leukemia.
Leuk Res 2005;29:1469-1472.
Morerio C, Acquila M, Rosanda C, Rapella A, Tassano E,
Micalizzi C, Panarello C. t(9;11)(p22;p15) with NUP98-LEDGF
fusion gene in pediatric acute myeloid leukemia. Leuk Res
2005;29:467-470.
This article should be referenced as such:
Morerio C, Panarello C. PSIP1 (PC4 and SFRS1 interacting
protein 1). Atlas Genet Cytogenet Oncol Haematol.2007;
11(3):237-238.
Singh DP, Kubo E, Takamura Y, Shinohara T, Kumar A,
Chylack LT Jr, Fatma N. DNA binding domains and nuclear
Atlas Genet Cytogenet Oncol Haematol. 2007;11(3)
238
Atlas of Genetics and Cytogenetics
in Oncology and Haematology
OPEN ACCESS JOURNAL AT INIST-CNRS
Gene Section
Review
RAF1 (v-raf-1 murine leukemia viral oncogene
homolog 1)
Max Cayo, David Yu Greenblatt, Muthusamy Kunnimalaiyaan, Herbert Chen
Endocrine Cancer Disease Group, University of Wisconsin Paul P. Carbone Comprehensive Cancer Center,
H4/750 Clinical Science Center, 600 Highland Avenue, Madison, WI 53792, USA
Published in Atlas Database: March 2007
Online updated version: http://AtlasGeneticsOncology.org/Genes/RAF1ID42032ch3p25.html
DOI: 10.4267/2042/38452
This work is licensed under a Creative Commons Attribution-Non-commercial-No Derivative Works 2.0 France Licence.
© 2007 Atlas of Genetics and Cytogenetics in Oncology and Haematology
encoding for the serine/threonine kinase domain) in the
C terminus. The RAF proteins exhibit complex
regulation involving numerous phosphorylation sites
throughout the proteins. Despite constitutional
similarity, the Raf isoforms have been shown to carry
out non-redundant functions, implying that they are
distinct.
RAF-1 (C-RAF-1): 72-74 kDa.
Note: A-RAF: about 68 kDa.
Note: B-RAF (which undergoes alternate splicing):
ranges from 75 to 100 kDa.
Identity
Hugo: RAF1
Other names: CRAF; Raf-1; c-Raf
Location: 3p25
DNA/RNA
Note: History and Nomenclature:
c-Raf-1 was the first successfully cloned functional
human homolog of the v-Raf gene, and thus the gene
product of c-Raf-1 has historically been referred to in
the literature simply as Raf-1. Subsequently, B-Raf and
A-Raf-1 paralogues (BRAF, located in Xq13 and
ARAF, located in Xp11) were discovered. A suitable
nomenclature is as follows: A-RAF, B-RAF, and CRAF for the functional human proteins and A-RAF, BRAF, and C-RAF for the corresponding genes; a-raf, braf, and c-raf for the murine proteins and A-Raf, B-Raf,
and C-Raf for the corresponding genes. Raf-1 (or RAF1) is generally taken to mean C-RAF-1 but could apply
to A-RAF-1 equally. Here, RAF-1 will be taken to
mean C-RAF-1 (RAF-1 = C-RAF-1, etc.).
Expression
C-RAF (RAF-1) and A-RAF mRNA is expressed
ubiquitously. A-RAF mRNA is highly expressed in
urogenital organs. B-RAF is expressed in a wide range
of tissues, but most substantially in neuronal tissues.
Localisation
Cytosolic.
Function
RAF proteins are part of the conserved MAPK
(mitogen-activated protein kinase)/ERK (extracellular
signal-regulated kinase) signaling cascade between the
cell surface and the nucleus. RAF is regulated by the
upstream RAS family of small G proteins. RAS is
predominantly located on the inner leaflet of the plasma
membrane and is functionally activated by GTPbinding. Binding of various extracellular ligands such
as growth factors and hormones activates RAS and
subsequently RAF proteins. RAS binds directly to the
N-terminal regulatory domain or RAF (the RAS
binding domain (RBD)). RAS interacts secondarily
with the cysteine-rich domain (CRD) on CR1 of RAF.
RAS-RAF binding can be affected by 14-3-3 proteins
and other scaffold/adaptor proteins kinase suppressor of
Description
C-RAF (RAF-1, C-RAF-1) encompasses 80,570 bp of
DNA; 17 Exons.
Transcription
RAF-1 transcribed
nucleotides.
mRNA
contains
3212-3216
Protein
Description
The RAF proteins share three conserved domains: two
(CR1 and CR2) in the N terminus and a third (CR3-
Atlas Genet Cytogenet Oncol Haematol. 2007;11(3)
239
RAF1 (v-raf-1 murine leukemia viral oncogene homolog 1)
Cayo M et al.
RAS (KSR), the multidomain protein connectorenhancer of KSR (CNK), and the leucine-rich-repeat
protein suppressor of RAS mutations-8 (SUR8), which
cause formation of various homo- and heterodimers
and subsequently affect signal transduction. RAF
activation leads to activation of the protein kinases
MEK1 and MEK2 and subsequently the MAPK
proteins ERK1 and ERK2. The downstream effects of
MEK1/2-ERK1/2 activation are varied, complex, and
depend on the cellular context. Resultant effects
include activation of transcription factors involved in
tumorigenesis, cell growth, survival, differentiation,
metabolism, and cytoskeletal rearrangements. RAF-1
(C-RAF-1), A-RAF, and B-RAF are all capable of
activating the MEK1/2-ERK1/2 signaling pathway.
RAF-1 is capable of activating the NF-kB transcription
factor through an unknown mechanism that does not
seem to involve direct phosphorylation of NF-kB and is
independent of MEK1/2-ERK1/2 signaling.
RAF-1 is known to directly affect cell survival through
phosphorylation
of
BAG1
(BCL2-associated
athanogene-1), an anti-apoptotic protein that binds to
BCL2, a second anti-apoptotic factor, also the
prototype for a family of mammalian genes involved in
mitochondrial outer membrane permeability (MOMP),
thus restoring its function. BCL2 also targets RAF-1 to
the mitochondrial membrane, where it is able to more
readily phosphorylate substrates. The RAF1/BAG1/BCL2 interaction allows RAF-1 to
phosphorylate the pro-apoptotic protein BAD at the
mitochondrial membrane, promoting cell survival.
Other known substrates of RAF-1 include the
phosphatase CDC25C, the apoptosis signal-regulating
kinase-1 (ASK1), and the tumor-suppressor protein
retinoblastoma (Rb).
RAF-1 is tightly regulated by the AKT/PKB pathway
through phosphorylation at S259.
of all cases. MTC cells secrete hormones and tumor
markers such as calcitonin, chromogranin A (CgA),
and carcinoembryonic antigen (CEA).
Symptoms are related to either direct invasion or
metastasis (neck mass, dyspnea, dysphagia, voice
changes, pain) or tumor secretion of bioactive amines
and peptides (diarrhea, flushing).
Prognosis
Currently, surgery is the only potentially curative
therapy for patients with MTC. The recommended
operation is total thyroidectomy with lymph node
dissection. However, 50% of patients treated with
surgery suffer persistent or recurrent disease.
Oncogenesis
20% of patients with medullary thyroid cancer have an
autosomal dominant inherited form of the disease,
which is the result of well-characterized point
mutations in the RET proto-oncogene. RAF-1 is
conserved but not expressed at baseline in MTC. Preclinical studies have shown that activation of RAF-1 in
MTC (TT) cells by means of RAF-1 gene transfection
or RAF-1 activating small molecules (ZM336372)
results in tumor cell growth inhibition in vitro and in
vivo.
Carcinoid Tumors
Disease
Carcinoids are tumors that arise from the diffuse
neuroendocrine cell system of the gut, lungs, and other
organs. The incidence is 1-5 per 100,000 individuals.
Carcinoids frequently metastasize to the liver and are
the second most common source of isolated liver
metastases. Carcinoids secrete various bioactive
hormones such as 5-HT (5-hydroxy tryptophan, also
known as serotonin) and chromogranin A.
Prognosis
Patients with hepatic metastases suffer debilitating
symptoms such as abdominal pain, flushing,
bronchoconstriction, and diarrhea. Palliative treatment
for these hormone-induced symptoms includes
somatostatin analogs (such as octeotride). Conventional
anticancer treatments such as chemotherapy and
external beam radiation are largely ineffective for
carcinoid tumors.
Oncogenesis
RAF-1 activation is detrimental to tumorigenesis in
carcinoid cells. Marked reduction in neuroendocrine
phenotypic markers such as human achaete-scute
complex like-1 (ASCL-1) and bioactive hormones 5HT, chromogranin A, and synaptophysin has been
noted upon RAF-1 activation using an estrogeninducible RAF-1 construct in human GI (BON) and
pulmonary carcinoid cell lines (NCI-H727).
Treatment of GI carcinoid cells with RAF-1 activator
ZM336372 led to a decrease in bioactive hormone
levels, a suppression of cellular proliferation, an
Mutations
Somatic
It has been widely established that RAF-1 over activity,
typically via ras-activating mutations, is central to
tumorigenesis and cell proliferation in numerous
cancers (about 30% of all human cancers). However, it
has come to the fore that oncogenesis may be due to
ras/RAF-1 dysregulation (either increased or decreased
expression) rather than increases in ras/RAF-1 activity
exclusively.
Implicated in
Medullary Thyroid Cancer (MTC)
Disease
A neuroendocrine tumor derived from parafollicular C
cells of the thyroid gland, MTC is the third most
common form of thyroid cancer, accounting for 3-5%
Atlas Genet Cytogenet Oncol Haematol. 2007;11(3)
240
RAF1 (v-raf-1 murine leukemia viral oncogene homolog 1)
Cayo M et al.
increase in cell cycle inhibitors p21 and p18, as well as
a decrease in the neuroendocrine phenotypic marker
ASCL-1. ZM336372 treatments also led to progressive
phosphorylation (activation) of MEK1/2, ERK1/2, and
RAF-1.
leads to decreased cell proliferation. RAF-1 activation
in pheochromocytoma cells using ZM336372 led to
cellular differentiation, growth arrest, and a decrease in
the neuroendocrine marker chromogranin A.
Non-Neuroendocrine Cancers with rasactivating Mutations
Small Cell Lung Cancer (SCLC)
Disease
SCLC tends to present with metastatic and regional
spread. Carcinoids rarely metastasize, arise from major
bronchi, and express neuron-specific enolase,
chromogranin, and synaptophysin. Neuroendocrine
carcinoids or atypical carcinoids have a more
aggressive course.
Oncogenesis
Human small-cell lung cancer (SCLC) cell lines rarely
harbor ras-activating mutations. In one cell line of
SCLC, DMS53, it was shown that by RAF-1 induction
using an estrogen-inducible RAF-1 construct SCLC
cells underwent differentiation and G1-specific growth
arrest in conjunction with MEK/ERK1/2 pathway
activation.
Oncogenesis
About 30% of all human cancers express ras-activating
mutations.
More
than
85%
of
pancreatic
adenocarcinomas and 50% of colonic adenocarcinomas
harbor K-ras mutations. K-ras is an upstream effector
of RAF-1 in the RAF-1/MEK/ERK1/2 signaling
pathway. Ras mutations have also been linked to
tumorigenesis of cholangiocarcinoma, adenocarcinoma
of the lung, squamous cell cancer, gastric
adenocarcinoma, small bowel adenocarcinoma, and
malignant melanoma.
Colorectal Cancer
Oncogenesis
RAF-1 is over-activated due to oncogenic ras mutations
in about 50% of colon cancers. These mutations are
associated with poor prognosis, and are necessary for
maintenance of the malignant phenotype.
RAF-1 inhibition in response to interaction with RAF
kinase inhibitor protein (RKIP) (up-regulated in
conjunction with the nuclear factor kappa B signaling
pathway) has been linked with overall and disease-free
survival in patients with colorectal cancers. RKIP has
been identified as potentially useful for identifying
early-stage CRC patients at risk for relapse.
Non-Small Cell Lung Cancer (NSCLC)
Disease
Adenocarcinoma is the most common type of NSCLC
accounting for about 40% of cases. Lesions are
generally located peripherally and develop systemic
metastases despite small primary tumors. 25% of
NSCLC are squamous cell carcinomas which often
remain localized.
Oncogenesis
RAF-1 is over-expressed due to oncogenic ras
mutations in about 35% of NSCLC.
The majority of NSCLC exhibits EGFR overexpression leading to upregulation of RAF-1 activity.
NSCLC has been shown to be mediated by a TGF-a
/EGFR-mediated autocrine loop activated by signaling
involving RAF-1 and PI3K-Akt.
Pancreatic Carcinoma
Oncogenesis
RAF-1 is overactivated due to oncogenic ras mutations
in about 90% of pancreatic carcinomas (Panc-1 and
Mia-PaCa2). It has been shown that malignancy of
these cells is reduced using k-ras RNAi.
Pharmacological inhibition of the RAF/MEK/ERK
pathway in pancreatic cancer cell lines (via MEK
inhibition) results in reduction in cellular proliferation
and an increase in cell cycle arrest.
Pheochromocytoma
Disease
Pheochromocytomas are neuroectodermal in origin and
arise from the chromaffin cells of the adrenal medulla.
10% of tumors are bilateral. Typical symptoms such as
hypertension, headaches, diaphoresis, palpitations,
diarrhea, and skin rashes, are related to tumor
production of catecholamines, especially in patients
with metastases. Pheochromocytoma is potentially
fatal, but relatively uncommon (2-8 cases per million
people annually). Curative therapy is surgery, usually
accomplished by laparoscopic adrenalectomy.
Oncogenesis
Activation of MEK1/2-ERK1/2 is necessary for
differentiation of pheochromocytoma (PC12) cells and
Atlas Genet Cytogenet Oncol Haematol. 2007;11(3)
Hepatocellular Carcinoma (HCC)
Oncogenesis
RAF-1 is over-activated in about 50% of biopsies while
the RAF-1 protein is over-expressed in nearly 100% of
all HCC's. Angiogenesis and other functions essential
to tumorigenesis in HCC have been reported to depend
on the RAF/MEK/ERK signaling pathway. RAF-1
inhibitor Sorafenib has been reported (in-vitro and invivo) to inhibit RAF-1 activity, leading to decreased
MEK/ERK activity, reduced cellular proliferation, and
apoptosis in several HCC cell lines including HepG2
and PLC/PRF/5.
241
RAF1 (v-raf-1 murine leukemia viral oncogene homolog 1)
Cayo M et al.
Prostate Cancer
Renal Cell Carcinoma
Oncogenesis
RAF kinase inhibitor protein (RKIP) coding mRNAs
have been observed to activate interferon-inducible
2',5'-oligoadenylate synthetases (OAS). OAS activity is
characteristically increased (via these mRNAs) in
prostate cancer cell lines PC3, LNCaP and DU145.
RKIP expression is detectable in primary prostate
cancer sections but not in metastases. This suggests
RKIP's characterization as an anti-metastasis gene
using the RAF/MEK/ERK signaling pathway is
appropriate.
RAF-1 inhibition using systemically delivered novel
cationic cardiolipin liposomes (NeoPhectin-AT)
containing a small interfering RNA (siRNA) against
RAF-1 causes tumor growth inhibition in a xenograft
model of human prostate cancer.
RAF/MEK/ERK signaling pathway activation via a
biologically active peptide called a prosaptide (TX14A)
stimulates cell proliferation/survival, migration, and
invasion in human prostate cancer cells.
NSC 95397 and NSC 672121, cdc25 inhibitors, were
shown to activate the RAF/MEK/ERK pathway in
prostate cancer cells.
RAF-1 activation in LNCaP prostate cancer cells using
an estrogen-inducible construct led to growth
inhibition.
Oncogenesis
RAF-1 is overactivated in conjunction with loss of
function of the VHL (von Hippel-Lindau) tumorsuppressor gene.
Breast Cancer
Oncogenesis
RAF-1 inactivation using RNAi in gastric cancer cell
line SGC7901 led to dramatic reductions in
angiogenesis, increased apoptosis, and decreased
cellular proliferation.
Glioma
Oncogenesis
RAF-1 inhibitor AAL881 inhibited growth of glioma
cell xenografts.
Cervical Cancer
Oncogenesis
Low RAF-1 kinase activity is significantly associated
with paclitaxel sensitivity in cervical cancers.
Ovarian Cancer
Oncogenesis
RAF-1 dysregulation is associated with poor prognosis
and possibly carcinogenesis. RAF-1 inhibition using
RNAi reduces cellular proliferatin and inhibits ovarian
tumor cell growth in vitro and in vivo. Similar results
were observed using antisense oligonucleotide (ASO)
therapy (ISIS 5132 and ISIS 13650).
RAF-1 inhibition by the Akt pathway sensitizes human
ovarian cancer cells to the drug paclitaxel.
Gastric Cancer
Oncogenesis
Growth hormone releasing hormone (GHRH) has been
shown to regulate breast cancer cell proliferation and
differentiation. In MDA-231 breast cancer cells,
exogenous
GHRH
stimulated
dose-dependent
proliferation. RAF-1 inhibition using the agent
PD98059 caused prevention of MAPK phosphorylation
by GHRH as well as reduced cellular proliferation.
Proliferative effects of steroid hormone estradiol on
MCF-7 breast cancer cells have been linked with
increased expression of RAF-1, possibly due to direct
activation of RAF-1 by estradiol.
RAF kinase inhibitor protein (RKIP) is associated with
metastasis suppression. RKIP expression is lost in
lymph node metastases. This suggests RKIP is a
metastasis inhibitor gene and that RAF-1 expression
enables metastasis.
The PTK inhibitor AG 879 inhibits proliferation of
human breast cancer cells through inhibition of MAP
kinase activation through inhibition of expression of
the RAF-1 gene.
RAF-1 down-regulation is associated with paclitaxel
drug resistance in human breast cancer cell line MCF7/Adr.
Atlas Genet Cytogenet Oncol Haematol. 2007;11(3)
Bladder Cancer
Oncogenesis
RAF-1 gene amplification was detected in 4% of
bladder cancer samples. Deletions at the RAF-1 locus
were detected in 2.2% of these samples. Both
amplifications and deletions were heavily correlated
with high tumor grade (P < 0.00001), advanced stage
(P < 0.0001), and poor survival (P < 0.05).
Lymphoma
Oncogenesis
RAF-1 is typically over-expressed
lymphomas from TCR transgenic mice.
in
thymic
References
Bonner TI, Kerby SB, Sutrave P, Gunnell MA, Mark G, Rapp
UR. Structure and biological activity of human homologs of the
raf/mil oncogene. Mol Cell Biol 1985;5(6):1400-1407.
242
RAF1 (v-raf-1 murine leukemia viral oncogene homolog 1)
Cayo M et al.
Huebner K, ar-Rushdi A, Griffin CA, Isobe M, Kozak C,
Emanuel BS, Nagarajan L, Cleveland JL, Bonner TI,
Goldsborough MD, et al. Actively transcribed genes in the raf
oncogene group, located on the X chromosome in mouse and
human. Proc Natl Acad Sci USA 1986;83(11):3934-3938.
transformation. Proc Natl Acad Sci USA 2000;97(9):46154620.
Kobzdej M, Matuszyk J, Strzadala L. Overexpression of Ras,
Raf and L-myc but not Bcl-2 family proteins is linked with
resistance to TCR-mediated apoptosis and tumorigenesis in
thymic lymphomas from TCR transgenic mice. Leuk Res
2000;24(1):33-38.
Beck TW, Huleihel M, Gunnell M, Bonner TI, Rapp UR. The
complete coding sequence of the human A-raf-1 oncogene and
transforming activity of a human A-raf carrying retrovirus.
Nucleic Acids Res 1987;15(2):595-609.
Li W, Han M, Guan KL. The leucine-rich repeat protein SUR-8
enhances MAP kinase activation and forms a complex with
Ras and Raf. Genes Dev 2000;14(8):895-900.
Storm SM, Cleveland JL, Rapp UR. Expression of raf family
proto-oncogenes in normal mouse tissues. Oncogene
1990;5(3):345-351.
Luckett JC, Huser MB, Giagtzoglou N, Brown JE, Pritchard CA.
Expression of the A-raf proto-oncogene in the normal adult and
embryonic mouse. Cell Growth Differ 2000;11(3):163-171.
Robbins DJ, Zhen E, Cheng M, Xu S, Ebert D, Cobb MH. MAP
kinases ERK1 and ERK2: pleiotropic enzymes in a ubiquitous
signaling network. Adv Cancer Res 1994;63:93-116.
Chen J, Fujii K, Zhang L, Roberts T, Fu H. Raf-1 promotes cell
survival by antagonizing apoptosis signal-regulating kinase 1
through a MEK-ERK independent mechanism. Proc Natl Acad
Sci USA 2001;98(14):7783-7788.
Barnier J, Papin C, Eychène A, Lecoq O, Calothy G. The
mouse B-raf gene encodes multiple protein isoforms with
tissue-specific expression. The Journal of Biological Chemistry
1995;270(40):23381-23389.
Morrison DK. KSR: a MAPK scaffold of the Ras pathway?. J
Cell Sci 2001;114(Pt 9):1609-1612.
Galaktionov K, Jessus C, Beach D. Raf1 interaction with
Cdc25 phosphatase ties mitogenic signal transduction to cell
cycle activation. Genes Dev 1995;9(9):1046-1058.
Huser M, Luckett J, Chiloeches A, Mercer K, Iwobi M, Giblett
S, Sun XM, Brown J, Marais R, Pritchard C. MEK kinase
activity is not necessary for Raf-1 function. EMBO J
2001;20(8):1940-1951.
Pritchard CA, Bolin L, Slattery R, Murray R, McMahon M. Postnatal lethality and neurological and gastrointestinal defects in
mice with targeted disruption of the A-Raf protein kinase gene.
Curr Biol 1996;6(5):614-617.
McPhillips F, Mullen P, Monia BP, Ritchie AA, Dorr FA, Smyth
JF, Langdon SP. Association of c-Raf expression with survival
and its targeting with antisense oligonucleotides in ovarian
cancer. Br J Cancer 2001;85(11):1753-1758.
Wang HG, Rapp UR, Reed JC. Bcl-2 targets the protein kinase
Raf-1 to mitochondria. Cell 1996;87(4):629-638.
Mikula M,Schreiber M,Husak Z,Kucerova L,Rüth J,Wieser
R,Zatloukal K,Beug H,Wagner EF,Baccarini M. Embryonic
lethality and fetal liver apoptosis in mice lacking the c-raf-1
gene. EMBO J 2001;20(8):1952-1962.
Wang HG, Takayama S, Rapp UR, Reed JC. Bcl-2 interacting
protein, BAG-1, binds to and activates the kinase Raf-1. Proc
Natl Acad Sci USA 1996;93(14):7063-7068.
Wittinghofer A, Nassar N. How Ras-related proteins talk to
their effectors. Trends Biochem Sci 1996;21(12):488-491.
Simon R, Richter J, Wagner U, Fijan A, Bruderer J, Schmid U,
Ackermann D, Maurer R, Alund G, Knönagel H, Rist M, Wilber
K, Anabitarte M, Hering F, Hardmeier T, Schönenberger A,
Flury R, Jäger P, Fehr JL, Schraml P, Moch H, Mihatsch MJ,
Gasser T, Sauter G. High-throughput tissue microarray
analysis of 3p25 (RAF1) and 8p12 (FGFR1) copy number
alterations in urinary bladder cancer. Cancer Res
2001;61(11):4514-4519.
Wojnowski L, Zimmer AM, Beck TW, Hahn H, Bernal R, Rapp
UR, Zimmer A. Endothelial apoptosis in Braf-deficient mice.
Nat Genet 1997;16(3):293-297.
Britten RA, Perdue S, Opoku J, Craighead P. Paclitaxel is
preferentially cytotoxic to human cervical tumor cells with low
Raf-1 kinase activity: implications for paclitaxel-based
chemoradiation regimens. Radiother Oncol 1998;48(3):329334.
Anselmo AN, Bumeister R, Thomas JM, White MA. Critical
contribution of linker proteins to Raf kinase activation. J Biol
Chem 2002;277(8):5940-5943.
Denouel-Galy A, Douville EM, Warne PH, Papin C, Laugier D,
Calothy G, Downward J, Eychene A. Murine Ksr interacts with
MEK and inhibits Ras-induced transformation. Curr Biol
1998;8(1):46-55.
Mabuchi S, Ohmichi M, Kimura A, Hisamoto K, Hayakawa J,
Nishio Y, Adachi K, Takahashi K, Arimoto-Ishida E, Nakatsuji
Y, Tasaka K, Murata Y. Inhibition of phosphorylation of BAD
and Raf-1 by Akt sensitizes human ovarian cancer cells to
paclitaxel. J Biol Chem 2002;277(36):33490-33500.
Pratt MA, Satkunaratnam A, Novosad DM. Estrogen activates
raf-1 kinase and induces expression of Egr-1 in MCF-7 breast
cancer cells. Mol Cell Biochem 1998;189(1-2):119-125.
Pouysségur J, Volmat V, Lenormand P. Fidelity and spatiotemporal control in MAP kinase (ERKs) signalling. Biochem
Pharmacol 2002;64(5-6):755-763.
Wojnowski L, Stancato LF, Zimmer AM, Hahn H, Beck TW,
Larner AC, Rapp UR, Zimmer A. Craf-1 protein kinase is
essential for mouse development. Mech Dev 1998;76(12):141-149.
Sippel RS, Chen H. Activation of the ras/raf-1 signal
transduction pathway in carcinoid tumor cells results in
morphologic transdifferentiation. Surgery 2002;132(6):10351039.
Wang S, Ghosh RN, Chellappan SP. Raf-1 physically interacts
with Rb and regulates its function: a link between mitogenic
signaling and cell cycle regulation. Mol Cell Biol
1998;18(12):7487-798.
Tzivion G, Avruch J. 14-3-3 proteins: active cofactors in cellular
regulation by serine/threonine phosphorylation. J Biol Chem
2002;277(5):3061-3064.
Ravi RK, McMahon M, Yangang Z, Williams JR, Dillehay LE,
Nelkin BD, Mabry M. Raf-1-induced cell cycle arrest in LNCaP
human prostate cancer cells. J Cell Biochem 1999;72(4):45869.
Weinstein-Oppenheimer CR, Burrows C, Steelman LS,
McCubrey JA. The effects of beta-estradiol on Raf activity, cell
cycle progression and growth factor synthesis in the MCF-7
breast cancer cell line. Cancer Biol Ther 2002;1(3):256-262.
Zimmermann S, Moelling K. Phosphorylation and regulation of
Raf by Akt (protein kinase B). Science 1999;286(5445):17411744.
Davis JM, Navolanic PM, Weinstein-Oppenheimer CR,
Steelman LS, Hu W, Konopleva M, Blagosklonny MV,
McCubrey JA. Raf-1 and Bcl-2 induce distinct and common
pathways that contribute to breast cancer drug resistance. Clin
Cancer Res 2003;9(3):1161-1170.
Baumann B, Weber CK, Troppmair J, Whiteside S, Israel A,
Rapp UR, Wirth T. Raf induces NF-kappaB by membrane
shuttle kinase MEKK1, a signaling pathway critical for
Atlas Genet Cytogenet Oncol Haematol. 2007;11(3)
243
RAF1 (v-raf-1 murine leukemia viral oncogene homolog 1)
Cayo M et al.
Fu Z, Smith PC, Zhang L, Rubin MA, Dunn RL, Yao Z, Keller
ET. Effects of raf kinase inhibitor protein expression on
suppression of prostate cancer metastasis. J Natl Cancer Inst
2003;95(12):878-889.
cardiolipin liposomes silences Raf-1 expression and inhibits
tumor growth in xenograft model of human prostate cancer. Int
J Oncol 2005;26(4):1087-1091.
Van Gompel J.J., Kunnimalaiyaan M, Holen K, Chen H.
ZM336372, a Raf-1 activator, suppresses growth and
neuroendocrine hormone levels in carcinoid tumor cells.
Mol.Cancer.Ther 2005;4, 6:910-917.
Hancock JF. Ras proteins: different signals from different
locations. Nat Rev Mol Cell Biol 2003;4(5):373-384.
Lee M, Koh WS, Han SS. Down-regulation of Raf-1 kinase is
associated with paclitaxel resistance in human breast cancer
MCF-7/Adr cells. Cancer Lett 2003;193(1):57-64.
Al-Mulla F,Hagan S,Behbehani AI,Bitar MS,George SS,Going
JJ,Garcia JJ,Scott L,Fyfe N,Murray GI,Kolch W. Raf kinase
inhibitor protein expression in a survival analysis of colorectal
cancer patients. J Clin Oncol 2006;24(36):5672-5679.
Lanigan TM,Liu A,Huang YZ,Mei L,Margolis B,Guan KL.
Human homologue of Drosophila CNK interacts with Ras
effector proteins Raf and Rlf. FASEB J 2003;17(14):20482060.
Fu Z, Kitagawa Y, Shen R, Shah R, Mehra R, Rhodes D, Keller
PJ, Mizokami A, Dunn R, Chinnaiyan AM, Yao Z, Keller ET.
Metastasis suppressor gene Raf kinase inhibitor protein (RKIP)
is a novel prognostic marker in prostate cancer. Prostate
2006;66(3):248-256.
Morrison DK, Davis RJ. Regulation of MAP kinase signaling
modules by scaffold proteins in mammals. Annu Rev Cell Dev
Biol 2003;19:91-118. (Review).
Gollob JA,Wilhelm S,Carter C,Kelley SL. Role of Raf kinase in
cancer: therapeutic potential of targeting the Raf/MEK/ERK
signal transduction pathway. Semin Oncol 2006;33(4):392-406.
Sippel R.S., Carpenter J.E., Kunnimalaiyaan M., Lagerholm S.,
Chen H. Raf-1 activation suppresses neuroendocrine marker
and hormone levels in human gastrointestinal carcinoid cells.
Am.J.Physiol.Gastrointest.Liver Physiol 2003;285, 2:G245-254.
Kappes A, Vaccaro A, Kunnimalaiyaan M, Chen H. ZM336372,
a Raf-1 activator, inhibits growth of pheochromocytoma cells.
J.Surg.Res 2006;133 (1):42-45.
Troppmair J, Rapp UR. Raf and the road to cell survival: a tale
of bad spells, ring bearers and detours. Biochem Pharmacol
2003;66(8):1341-1345.
Kunnimalaiyaan M, Chen H. The Raf-1 pathway: a molecular
target for treatment of select neuroendocrine tumors?.
Anticancer Drugs 2006;17, 2:139-142.
Keller ET, Fu Z, Yeung K, Brennan M. Raf kinase inhibitor
protein: a prostate cancer metastasis suppressor gene. Cancer
Lett 2004;207(2):131-137.
Letterio J,Rudikoff E,Voong N,Bauer SR. Transforming growth
factor-beta1 sensitivity is altered in Abl-Myc- and Raf-Mycinduced
mouse
pre-B-cell
tumors.
Stem
Cells
2006;24(12):2611-2617.
Koochekpour S, Sartor O, Lee TJ, Zieske A, Patten DY,
Hiraiwa M, Sandhoff K, Remmel N, Minokadeh A. Prosaptide
TX14A stimulates growth, migration, and invasion and
activates the Raf-MEK-ERK-RSK-Elk-1 signaling pathway in
prostate cancer cells. Prostate 2004;61(2):114-123.
Liu L, Cao Y, Chen C, Zhang X, McNabola A, Wilkie D,
Wilhelm S, Lynch M, Carter C. Sorafenib blocks the
RAF/MEK/ERK pathway, inhibits tumor angiogenesis, and
induces tumor cell apoptosis in hepatocellular carcinoma
model PLC/PRF/5. Cancer Res 2006;66(24):11851-11858.
Larsson LI. Novel actions of tyrphostin AG 879: inhibition of
RAF-1 and HER-2 expression combined with strong
antitumoral effects on breast cancer cells. Cell Mol Life Sci
2004;61(19-20):2624-2631.
Molinaro RJ, Jha BK, Malathi K, Varambally S, Chinnaiyan AM,
Silverman RH. Selection and cloning of poly(rC)-binding
protein 2 and Raf kinase inhibitor protein RNA activators of
2',5'-oligoadenylate synthetase from prostate cancer cells.
Nucleic Acids Res 2006;34(22):6684-6695.
Mullen P, McPhillips F, MacLeod K, Monia B, Smyth JF,
Langdon SP. Antisense oligonucleotide targeting of Raf-1:
importance of raf-1 mRNA expression levels and raf-1dependent signaling in determining growth response in ovarian
cancer. Clin Cancer Res 2004;10(6):2100-2108.
Mullen P, McPhillips F, Monia BP, Smyth JF, Langdon SP.
Comparison of strategies targeting Raf-1 mRNA in ovarian
cancer. Int J Cancer 2006;118(6):1565-1571.
Nemoto K, Vogt A, Oguri T, Lazo JS. Activation of the Raf1/MEK/Erk kinase pathway by a novel Cdc25 inhibitor in
human prostate cancer cells. Prostate 2004;58(1):95-102.
Sathornsumetee S, Hjelmeland AB, Keir ST, McLendon RE,
Batt D, Ramsey T, Yusuff N,Rasheed BK, Kieran MW, Laforme
A, Bigner DD, Friedman HS, Rich JN. AAL881, a Novel Small
Molecule Inhibitor of RAF and Vascular Endothelial Growth
Factor Receptor Activities, Blocks the Growth of Malignant
Glioma. Cancer Res 2006;66(17):8722-8730.
Wellbrock C, Karasarides M, R Marais. The RAF proteins take
center stage. Nature Reviews Molecular Cell Biology
2004;5(11):875-885.
Chen H, Kunnimalaiyaan M, Van Gompel JJ. Medullary thyroid
cancer: the functions of raf-1 and human achaete-scute
homologue-1. Thyroid 2005;15, 6:511-521.
Siriwardana G,Bradford A,Coy D,Zeitler P. Autocrine/paracrine
regulation of breast cancer cell proliferation by growth hormone
releasing hormone via Ras, Raf, and mitogen-activated protein
kinase. Mol Endocrinol 2006;20(9):2010-2019.
Gysin S, Lee SH, Dean NM, McMahon M. Pharmacologic
inhibition of RAF--->MEK--->ERK signaling elicits pancreatic
cancer cell cycle arrest through induced expression of
p27Kip1. Cancer Res 2005;65(11):4870-4880.
Vaccaro A, Chen H, Kunnimalaiyaan M. In-vivo activation of
Raf-1 inhibits tumor growth and development in a xenograft
model of human medullary thyroid cancer. Anticancer Drugs
2006;17, 7:849-853.
Hagan S, Al-Mulla F, Mallon E, Oien K, Ferrier R, Gusterson B,
García JJ, Kolch W. Reduction of Raf-1 kinase inhibitor protein
expression correlates with breast cancer metastasis. Clin
Cancer Res 2005;11(20):7392-7397.
This article should be referenced as such:
Cayo M, Greentblatt DY, Kunnimalaiyaan M, Chen H. RAF1 (vraf-1 murine leukemia viral oncogene homolog 1). Atlas Genet
Cytogenet Oncol Haematol.2007;11(3):239-244.
Meng F, Ding J, Liu N, Zhang J, Shao X, Shen H, Xue Y, Xie
H, Fan D. Inhibition of gastric cancer angiogenesis by vectorbased RNA interference for Raf-1. Cancer Biol Ther
2005;4(1):113-117.
Pal A, Ahmad A, Khan S, Sakabe I, Zhang C, Kasid UN,
Ahmad I. Systemic delivery of Raf siRNA using cationic
Atlas Genet Cytogenet Oncol Haematol. 2007;11(3)
244
Atlas of Genetics and Cytogenetics
in Oncology and Haematology
OPEN ACCESS JOURNAL AT INIST-CNRS
Leukaemia Section
Short Communication
i(8)(q10) in acute myeloid leukaemia
David Betts
Department of Oncology, University Children's Hospital, Steinwiesstr. 75, CH-8032 Zürich, Switzerland
Published in Atlas Database: March 2007
Online updated version: http://AtlasGeneticsOncology.org/Anomalies/i8q10ID1334.html
DOI: 10.4267/2042/38453
This work is licensed under a Creative Commons Attribution-Non-commercial-No Derivative Works 2.0 France Licence.
© 2007 Atlas of Genetics and Cytogenetics in Oncology and Haematology
Prognosis
Identity
As the aberration is rare and will frequently occur in
complex karyotypes, whether an independent prognosis
association can be determined is uncertain.
Cytogenetics
Cytogenetics morphological
In approximately 40% of cases the aberration is
reported as a chromosome gain.
Probes
Use of a centromere 8 probe combined with a C-MYC
probe will help distinguish between gain of i(8)(q10)
and simple chromosome 8 gain.
Additional anomalies
Seldom occurs as a primary karyotype event. Most
often found in complex karyotypes and/or arises in a
sub-clone. The complex karyotypes will frequently
contain loss of chromosome 5(q) and/or loss of
chromosome 7(q).
i(8)(q10) G- banding - Courtesy Melanie Zenger and Claudia
Haferlach.
Clinics and pathology
Disease
References
Acute myeloid leukaemia (AML)
Note: The aberration has also been reported in many
other neoplastic disorders, most notably Tprolymphocytic leukaemia
(PLL) and
acute
lymphoblastic leukaemia (ALL). In the latter, it often
occurs as a secondary event to the t(9;22).
Rodrigues Pereira Velloso E, Michaux L, Ferrant A, Hernandez
JM, Meeus P, Dierlamm J, Criel A, Louwagie A, Verhoef G,
Boogaerts M, Michaux J-L, Bosly A, Mecucci C, Van den
Berghe H. Deletions of the long arm of chromosome 7 in
myeloid disorders: loss of band 7q32 implies worst prognosis.
Br J Haematol 1996;92:574-581.
Huhta T, Vettenranta K, Heinonen K, Kanerva J, Larramendy
ML, Mahlamaki E, Saarinen-Pihkala UM, Knuutila S.
Comparative genomic hybridization and conventional
cytogenetic analyses in childhood acute myeloid leukemia.
Leuk Lymphoma 1999;35:311-315.
Phenotype / cell stem origin
Has been reported to occur in all AML FAB types, with
FAB M2 representing the most common morphology.
Epidemiology
Wong KF, Kwong YL. Isochromosome 8q is a Marker of
Secondary Acute Myeloid Leukemia. Cancer Genet Cytogenet
2000;120:171-173.
A rare non-random event reported in over 50 cases of
AML (below 0.5% of all cases) and occurs in both
children and adults.
Atlas Genet Cytogenet Oncol Haematol. 2007;11(3)
245
i(8)(q10) in acute myeloid leukaemia
Betts D
Harrison CJ, Yang F, Butler T, Cheung K-L, O'Brien PC,
Hennessy BJ, Prentice HG, Ferguson-Smith M. Cross-species
color banding in ten cases of myeloid malignancies with
complex
karyotypes.
Genes
Chromosomes
Cancer
2001;30:15-24.
This article should be referenced as such:
Betts D. i(8)(q10) in acute myeloid leukaemia. Atlas Genet
Cytogenet Oncol Haematol.2007;11(3):245-246.
Seppa L, Hengartner H, Leibundgut K, Kuhne T, Niggli FK,
Betts DR. Loss of i(8)(q10) at relapse in two cases of childhood
acute myeloid leukaemia. Leuk Lymphoma 2007 (in press).
Atlas Genet Cytogenet Oncol Haematol. 2007;11(3)
246
Atlas of Genetics and Cytogenetics
in Oncology and Haematology
OPEN ACCESS JOURNAL AT INIST-CNRS
Leukaemia Section
Mini Review
t(5;12)(q31;p13) in MDS, AML and AEL
Maria D Odero
Division of Oncology, Center for Applied Medical Research (CIMA), University of Navarra, Pamplona,
Spain
Published in Atlas Database: March 2007
Online updated version: http://AtlasGeneticsOncology.org/Anomalies/t0512q31p13ID1344.html
DOI: 10.4267/2042/38454
This work is licensed under a Creative Commons Attribution-Non-commercial-No Derivative Works 2.0 France Licence.
© 2007 Atlas of Genetics and Cytogenetics in Oncology and Haematology
Identity
Cytogenetics
Cytogenetics morphological
May be not easy to detect.
Cytogenetics molecular
The translocation can be detected by FISH with ETV6
probes. The ETV6 gene is rearranged, and the
breakpoint is between exon 1 and exon 2 in all cases
reported.
Additional anomalies
t(5;12)(q31;p13) G- banding - Courtesy Melanie Zenger and
Claudia Haferlach.
Disruption of the second ETV6 allele by t(12;19) was
detected in the AML case by FISH analysis.
Variants
No variants.
Clinics and pathology
Disease
The t(5;12)(q31;p13) translocation involving ETV6
(12p13) and ACSL6 (5q31) was found in a patient with
refractory anemia with excess blasts (RAEB) with
basophilia, a patient with acute myelogenous leukemia
(AML) with eosinophilia, and a patient with acute
eosinophilic leukemia (AEL).
Genes involved and Proteins
ETV6 (ETS Variant gene 6)
Location: 12p13
Note: The gene is known to be involved in a large
number of chromosomal rearrangements associated
with leukemia and congenital fibrosarcoma.
DNA / RNA
9 exons; alternate splicing
Protein
The gene encodes an ETS family transcription factor;
the product of this gene contains a N-terminal pointed
(PNT) domain that is involved in the protein-protein
interactions, and a C-terminal ETS DNA-binding
domain; wide expression; nuclear localization.
Phenotype / cell stem origin
Myeloid lineage.
Epidemiology
To date, one case with myelodysplastic syndrome
(RAEB), one case with AML, one case with AEL, one
case with atypical CML, and 2 cases with
Polycythemia Vera (PV).
The t(5;12)(q31;p13) is a recurrent translocation in
myeloid malignancies (at least 23 cases reported).
Prognosis
ACSL6 (Acyl-CoA Synthetase Longchain family member 6)
No prognostic value established.
Location: 5q31
Atlas Genet Cytogenet Oncol Haematol. 2007;11(3)
247
t(5;12)(q31;p13) in MDS, AML and AEL
Odero MD
Note: None of the resulting chimeric transcripts, except
for the ACSL6/ETV6 transcript in the RAEB case, led
to a fusion protein.
DNA / RNA
57,74 kb, 21 exons; alternate splicing.
Protein
Two splicing isoforms, a long and a short. The gene
encodes an AMP binding enzyme; plays an important
role in fatty acid metabolism in brain, responsible for
activation of long-chain fatty acids in erythrocytes.
Wide expression, expression low at earlier stages of
erythroid development but very high in reticulocytes.
on 12p13, and BACs and PIs on 5q31, demonstrated
that the 5q31 breakpoints of the AML and AEL cases
involved the 5-prime portion of the ACSL6 gene, and
that the 5q31 breakpoint of the RAEB case involved
the 3-prime portion of the ACSL6 gene. None of the
resulting chimeric transcripts except for the
ACSL6/ETV6 transcript in the RAEB case led to a
fusion protein.
A case with a CML and a t(5;12)(q31;p13) was
characterized, and 3 different ETV6/ACSL6 transcripts
were detected. Moreover, as a consequence of the
translocation IL-3/CSF2, located at 5q31, was
ectopically expressed in the leukemic cells.
Results of the chromosomal
anomaly
References
Yagasaki F, Jinnai I, Yoshida S, Yokoyama Y, Matsuda A,
Kusumoto S, Kobayashi H, Terasaki H, Ohyashiki K, Asou N,
Murohashi I, Bessho M, Hirashima K. Fusion of TEL/ETV6 to a
novel ACS2 in myelodysplastic syndrome and acute
myelogenous leukemia with t(5;12)(q31;p13). Genes
Chromosomes Cancer 1999;26:192-202.
Hybrid gene
Description
A novel human gene, called ACS2 (acyl-CoA
synthetase-2), was identified as an ETV6 fusion partner
in a recurrent t(5;12)(q31;p13) translocation. Northern
blot analysis detected high levels of ACS2 expression
in brain, fetal liver, and bone marrow, and the gene was
found to be highly conserved in man and rat. The
ETV6/ACSL6 fusion transcripts showed an out-frame
fusion of exon 1 of ETV6 to exon 1 of ACSL6 in the
AEL patient, an out-frame fusion of exon 1 of ETV6 to
exon 11 of ACSL6 in the AML patient, and a short inframe fusion of exon 1 of ETV6 to the 3-prime
untranslated region of ACSL6 in the patient with
RAEB. Reciprocal ACSL6/ETV6 transcripts were
identified in 2 of the cases. FISH with ETV6 cosmids
Atlas Genet Cytogenet Oncol Haematol. 2007;11(3)
Cools J, Mentens N, Odero MD, Peeters P, Wlodarska I,
Delforge M, Hagemeijer A, Marynen P. Evidence for position
effects as a variant ETV6-mediated leukemogenic mechanism
in myeloid leukemias with a t(4;12)(q11-q12;p13) or
t(5;12)(q31;p13). Blood 2002;99:1776-1784.
Murati A, Adélaïde J, Gelsi-Boyer V, Etienne A, Rémy V,
Fezoui H, Sainty D, Xerri L, Vey N, Olschwang S, Birnbaum D,
Chaffanet M, Mozziconacci MJ. t(5;12)(q23-31;p13) with ETV6ACSL6 gene fusion in polycythemia vera. Leukemia
2006;20:1175-1178.
This article should be referenced as such:
Odero MD. t(5;12)(q31;p13) in MDS, AML and AEL. Atlas
Genet Cytogenet Oncol Haematol.2007;11(3):247-248.
248
Atlas of Genetics and Cytogenetics
in Oncology and Haematology
OPEN ACCESS JOURNAL AT INIST-CNRS
Solid Tumour Section
Mini Review
Carcinoma with t(15;19) translocation
Anna Collin
Department of Clinical Genetics, Lund University Hospital, 221 85 Lund, Sweden
Published in Atlas Database: February 2007
Online updated version: http://AtlasGeneticsOncology.org/Tumors/Carcinot1519q14p13ID5474.html
DOI: 10.4267/2042/38455
This work is licensed under a Creative Commons Attribution-Non-commercial-No Derivative Works 2.0 France Licence.
© 2007 Atlas of Genetics and Cytogenetics in Oncology and Haematology
Cytology
Identity
Focal reactivity with pan-cytokeratin markers. Negative
for CD30, CD45, PLAP, HMB45, S100 and
neuroendocrine markers.
Other
names:
Mediastinal
carcinoma
with
chromosome translocation t(15;19); Midline carcinoma
of children and young adults with NUT rearrangement;
Midline carcinoma with t(15;19); Poorly differentiated
carcinoma with t(15;19); Poorly differentiated thymic
carcinoma; t(15;19) positive tumor.
Pathology
The tumor cells are typically undifferentiated, of
intermediate size and the mitotic index is high.
Treatment
Clinics and pathology
Disease
Intensive combined chemotherapy and occasionally
radiotherapy.
Carcinoma with t(15;19) translocation.
Prognosis
Phenotype stem cell origin
Extremely poor. Among the cases reported so far, the
median survival time was 18 weeks (range 6-67).
It has been suggested that a critical prognostic
difference exists between BRD4-NUT/t(15;19) positive
tumors and tumors where NUT is rearranged but fused
to an as yet unknown partner.
It has been suggested that tumor cells derive from early
epithelial progenitor cells.
Embryonic origin
The majority of the cases presumably derive from
various (midline) epithelial surfaces. One tumor,
localized to the iliac bone and staining negative for
epithelial, endothelial, germ cell and neuroendocrine
markers has been reported, suggesting that the tumor
might also derive from non-epithelial structures.
Cytogenetics
Cytogenetics morphological
The characteristic t(15;19) has been observed in all
reported cases. The reported breakpoints on
chromosome 15 have varied (15q11-q15). The
breakpoints on chromosome 19 clustered to 19p13 in
the majority of the cases. In one case the breakpoint
was interpreted as 19q13.
Etiology
Unknown.
Epidemiology
A total of 13 cases have been reported to date. All
tumors occurred in children or young adults with a
median age of 15 years of age (range 3-35). There seem
to be no sex predilection (8 males, 5 females).
Cytogenetics molecular
Various FISH protocols for the detection of 15q and
19p rearrangements, strongly indicating the presence of
a t(15;19), have been reported. The material used has
been paraffin-embedded sections of tumor biopsy or
metaphase spreads of cultured tumor tissue.
Clinics
The growth pattern is typically aggressive and locally
invasive. Metastatic growth is common in particular in
bone, but also in lymph nodes and lungs.
Atlas Genet Cytogenet Oncol Haematol. 2007;11(3)
249
Carcinoma with t(15;19) translocation
Collin A
Probes
Result of the chromosomal
anomaly
Probes for NUT: RP11-194H7 covering the gene or
BAC 87M17 and YAC 766E7 flanking the gene.
Probes for BRD4: RP11-637P24 covering the gene or
BACs 1H8+64O3 and BACs 412E10+3D4 flanking the
gene.
Hybride Gene
Description
The t(15;19)(q14;p13) results in a BRD4-NUT
chimeric gene where exon 10 of BRD4 is fused to exon
2 of NUT.
Detection protocole
The hybrid gene can be visualized by FISH using gene
specific probes or by RT-PCR.
Additional anomalies
The t(15;19) is typically seen as the sole change. In one
case a variant t(11;15;19) was reported.
Variants
t(15;?)(q14;?) leading to rearrangement and fusion of
NUT to an unknown partner gene.
Fusion protein
Genes involved and Proteins
Description
The BRD4-NUT fusion protein is composed of the Nterminal of BRD4 (amino acids 1-720 out of 1372) and
almost the entire protein sequence of NUT (amino
acids 6-1127). The N-terminal of BRD4 includes
bromodomains 1 and 2 and other, less well
characterized functional domains.
Oncogenesis
It has been suggested that the oncogenic effect of the
NUT-BRD4 fusion is caused not only by the abnormal
regulation of NUT by BRD4 promotor elements but
also by the consequent ectopic expression of NUT in
non-germinal tissues.
NUT (nuclear protein in testis)
Location: 15q14 (position 32425358-32437221 on the
chromosome 15 genomic sequence according to the
UCSC database; assembly of May 2004)
DNA/RNA
The gene consists of 7 exons that span approximately
12 kb of genomic DNA in the centromere-to-telomere
orientation. The translation initiation codon and the
stop codon are predicted to exon 1 and exon 7,
respectively. The corresponding wildtype mRNA
transcript is 3.6 kb.
Protein
The open reading frame is predicted to encode a 1127
amino acid protein with an estimated molecular weight
of 120 kDa. The protein is nuclear and Northern blot
analysis has indicated that the normal expression of the
NUT gene is highly restricted to the testis.
References
Kees UR, Mulcahy MT, Willoughby MLN. Intrathoracic
carcinoma in an 11-year-old girl showing a translocation
t(15;19). Am J Pediatr Hematol Oncol 1991;13:459-464.
Kubonishi I, Takehara N, Iwata J, Sonobe H, Ohtsuki Y, Abe T,
Miyoshi I. Novel t(15;19) chromosome abnormality in a thymic
carcinoma. Cancer Res 1991;51:3327-3328.
BRD4 (bromodomain containing 4)
Lee ACW, Kwong Y-I, Fu KH, Chan GCF, Ma L, Lau Y-I.
Disseminated mediastinal carcinoma with chromosomal
translocation (15;19). A distinctive clinicopathologic syndrome.
Cancer 1993;72:2273-2276.
Location: 19p13 (position 15252262-15209302 on the
chromosome 19 genomic sequence according to the
UCSC database; assembly of May 2004).
DNA/RNA
The gene consists of 20 exons that span approximately
43 kb of genomic DNA in the centromere-to-telomere
orientation. The translation initiation codon and stop
codon are located to exon 2 and exon 20, respectively.
Two isoforms of BRD4 have been reported. The BRD4
long isoform encodes a 6.0 kb mRNA that corresponds
to the full length transcript. The BRD4 short isoform
encodes a 4.4 kb mRNA that corresponds to an
alternative splicing variant lacking exons 12-20.
Protein
The open reading frame encodes a 1362 amino acid
protein with a molecular weight of 200 kDa. The
protein is nuclear and Northern blot analysis has shown
an ubiquitous normal expression of both BRD4
isoforms.
Atlas Genet Cytogenet Oncol Haematol. 2007;11(3)
Dang TP, Gazdar AF, Virmani AK, Sepetavec T, Hande KR,
Minna JD, Roberts JR, Carbone DP. Chromosome 19
translocation, overexpression of Notch3, and human lung
cancer. J Natl Cancer Inst 2000;92:1355-1357.
French CA, Miyoshi I, Aster JC, Kubonishi I, Kroll TG, Dal Cin
P, Vargas SO, Perez-Atayde AR, Fletcher JA. BRD4
bromodomain gene rearrangement in aggressive carcinoma
with translocation t(15;19). Am J Pathol 2001;159:1987-1992.
Vargas SO, French CA, Faul PN, Fletcher JA, Davis IJ, Dal Cin
P, Perez-Atayde AR. Upper respiratory tract carcinoma with
chromosomal translocation 15;19. Evidence for a distinct
disease entity of young patients with a rapidly fatal course.
Cancer 2001;92:1195-1203.
French CA, Miyoshi I, Kubonishi I, Grier HE, Perez-Atayde AR,
Fletcher JA. BRD4-NUT fusion oncogene: a novel mechanism
in aggressive carcinoma. Cancer Res 2003;63:304-307.
Toretsky JA, Jenson J, Sun C-C, Eskenazi AE, Campbell A,
Hunger SP, Caires A, Frantz C, Hill JL, Stamberg J.
Translocation t(11;15;19): a highly specific chromosome
250
Carcinoma with t(15;19) translocation
Collin A
rearrangement associated with poorly differentiated thymic
carcinoma in young patients. Am J Clin Oncol 2003;26:300306.
You J, Croyle JL, Nishimura A, Ozato K, Howley P. Interaction
of the bovine papillomavirus E2 protein with Brd4 tethers the
viral DNA to host mitotic chromosomes. Cell 2004;117:349360.
French CA, Kutok JL, Faquin WC, Toretsky JA, Antonescu CR,
Griffin CA, Nose V, Vargas SO, Moschovi M, TzortzatouStathopoulo F, Miyoshi I, Perez-Atayde AR, Aster JC, Fletcher
JA. Midline carcinoma of children and young adults with NUT
rearrangement. J Clin Oncol 2004;22:4135-4139.
Engleson J, Soller M, Panagopoulos I, Dahlén A, Dictor M,
Jerkeman M. Midline carcinoma with t(15;19) and BRD4-NUT
fusion oncogene in a 30-year-old female with response to
docetaxel and radiotherapy. BMC Cancer 2006;6:69.
Marx A, French CA, Fletcher JA. Carcinoma with t(15;19)
translocation. In:World Health Organization classification of
tumours. Pathology and genetics of tumours of the lung,
thymus, pleura and heart. Travis WD, Brambilla E, MullerHermelink K, Harris CC, editors. Oxford University Press 2004.
pp185-186.
Atlas Genet Cytogenet Oncol Haematol. 2007;11(3)
Mertens F, Wiebe T, Adlercreutz C, Mandahl N, French CA.
Successful treatment of a child with t(15;19)-positive tumor.
Pediatr Blood Cancer 2006.
This article should be referenced as such:
Collin A. Carcinoma with t(15;19) translocation. Atlas Genet
Cytogenet Oncol Haematol.2007;11(3):249-251.
251
Atlas of Genetics and Cytogenetics
in Oncology and Haematology
OPEN ACCESS JOURNAL AT INIST-CNRS
Solid Tumour Section
Review
Vulva and Vagina tumors: an overview
Roberta Vanni, Giuseppina Parodo
Dip. Scienze e Tecnologie Biomediche, Sezione di Biologia e Genetica, Universitá di Cagliari, Cittadella
Universitaria, 09142 Monserrato, Italy
Published in Atlas Database: February 2007
Online updated version: http://AtlasGeneticsOncology.org/Tumors/VulVaginaCarcID5274.html
DOI: 10.4267/2042/38456
This work is licensed under a Creative Commons Attribution-Non-commercial-No Derivative Works 2.0 France Licence.
© 2007 Atlas of Genetics and Cytogenetics in Oncology and Haematology
8. Deep angiomyxoma
9. Superficial angiomyxoma
10. Angiomyofibroblastoma
11. Cellular angiofibroma
12. Leiomyoma
13. Granular cell Tumor
14. Other
- III. Melanocytic Tumors
1. Malignant melanoma
2. Congenital melanocytic naevus
3. Acquired melanocytic naevus
4. Blue naevus
5. Atypical melanocytic naevus of genital type
6. Dysplastic melanocytic naevus
- IV. Miscellaneous Tumors
1. Yolk sac Tumor
2. Merkel cell Tumor
3.
Peripheral
primitive
neuroectodermal
Tumor/Ewing sarcoma
- V. Haematopoietic and lymphoid Tumors
1. Malignant lymphoma
2. Leukemia
- VI. Secondary tumors
VAGINA NEOPLASIA:
- I. Epithelial neoplasms
A. Squamous Tumors and precursors
1. Squamous cell carcinoma not otherwise
specified
2. Squamous intraepithelial neoplasia
3. Benign squamous lesions (condyloma
acuminatum, squamous papilloma, fibroepithelial
polyp)
B. Glandular lesions
1. Adenocarcinoma, NOS
2. Clear cell adenocarcinoma
3. Endometrioid adenocarcinoma
4. Mucinous adenocarcinoma
5. Mesonephric adenocarcinoma
Classification
Note: Neoplasms of the vulva and vagina together
account for less than 5% of all female genital tract
cancers. Staging and grading of the lesions follows the
TNM (Tumor, regional lymphoNode, Metastasis) and
FIGO (International Federation of Gynecology and
Obstetrics) recommendations.
According to WHO recommendations, the main Vulva
and Vagina categories are:
VULVA NEOPLASIA:
- I. Epithelial neoplasms
A. Squamous and related Tumors and precursors
1. Squamous cell carcinoma not otherwise
specified
2. Basal cell carcinoma
3. Squamous intraepithelial neoplasia
4. Benign squamous lesions
B. Glandular Tumors
1. Paget disease
2. Bartholin gland Tumors: carcinomas, adenoma
and adenomyoma
3. Tumor arising from specialized ano-genital
mammary-like glands
4. Adenocarcinoma of Shene gland origin
5. Adenocarcinoma of other types
6. Adenoma of minor vestibular glands
7. Mixed Tumors of the vulva
8. Tumors of skin appendage origin
- II. Soft tissue Tumors
1. Embryonal rhabdomyosarcoma (sarcoma
botryoides)
2. Leiomyosarcoma
3. fibrous histiocytoma
4. Proximal epithelioid sarcoma
5. Alveolar soft part sarcoma
6. Liposarcoma
7. Dermatofibrosarcoma protuberans
Atlas Genet Cytogenet Oncol Haematol. 2007;11(3)
252
Vulva and Vagina tumors: an overview
Vanni R, Parodo G
6. Mullerian papilloma
7. Adenoma not otherwise specified
C. Other epithelial Tumors
1. Adenosquamous carcinoma
2. Adenoid cystic carcinoma
3. Adenoid basal carcinoma
4. Carcinoid
5. Small cell carcinoma
6. Undifferentiated carcinoma
- II. Mesenchymal Tumors
1. Sarcoma botryoides
2. Leiomyosarcoma
3. Endometrioid stromal sarcoma, low grade
4. Undifferentiated vaginal sarcoma
5. Alveolar soft part sarcoma
6. Leiomyoma
7. Deep angiomyxoma
8. Post-operative spindle nodule
- III. Mixed epithelial and mesenchymal Tumors
1. Carcinosarcoma (Malignant Mullerian Mixed
tumors; metaplastic carcinoma)
2. Adenosarcoma
3. Malignant mixed Tumors resembling synovial
sarcoma
4. Benign mixed Tumors
- IV. Melanocytic Tumors
1. Malignant melanoma
2. Blue naevus
3. Melanocytic naevus
- V. Miscellaneous Tumors
A. Tumor of germ cell type
1. Yolk sac Tumor
2. Dermoid Cyst
B. Others
1.
Peripheral
primitive
neuroectodermal
Tumor/Ewing sarcoma
2. Adenomatoid Tumor
3. Malignant lymphoma
4. Granulocytic sarcoma
- VI Secondary Tumors
the virus genome, still in an not integrated state,
expresses oncoproteins E6 and E7 which interfer with
the mechanisms of chromosome segregation during
mitosis. This phenomenon, would favour the virus
genome integration into chromosomal DNA. However,
no evidence for targeted disruption of critical cellular
genes by the integrated viral sequences has been found.
According to this, two categories of affected patients
can be distinguhished:
Malignant lesions of the vulva
Older age (mean 77): no vulva intraepithelial neoplasia
(VIN) pre-existing pre-malignant condition, not Human
Papilloma Virus (HPV) related, unknown etiology.
Younger age (mean 55): usually associated with VIN,
HPV-related (usually type 16).
Malignant lesions of the vagina
The strongest association is between squamous cell
carcinoma and HPV types 16 and 18 infection.
Association with a pre-malignant lesion, known as
vaginal intraepithelial neoplasia (VAIN), was reported.
Association with previous history of cervical
intraepithelial neoplasia (CIN), invasive cervical
carcinoma, or invasive vulvar carcinoma has been
reported.
Epidemiology
Malignant neoplasms of the vulva together with
neoplasms of the vagina account for less than 5% of all
genital tract cancers. Squamous cell carcinoma
(approximately 90% and 80% of the malignant
neoplasms of the vulva and the vagina, respectively) is
the most commonly found, and it is primarily a disease
of elderly women, although it may be also observed in
premenopausal women. Pigmented vulvar and vaginal
lesions may occur, including nevi and melanoma,
which accounts for 9% of vulvar and 5% of vaginal
malignant lesions. Diethylstilbestrol (DES)-Associated
Disease of the vagina are described: DES is a synthetic
non-steroidal estrogen used in the early 1970s to
prevent miscarriage. The female fetuses delivered by
the mothers taking DES suffered from severe vaginal
lesions including vaginal adenosis (benign) and clear
cell adenocarcinoma. Malignant mesenchimal tumors
of the vulva or vagina are rare: leiomyosarcoma is the
most common vulvar lesion (mean age 35),
dermatofibrosarcoma is one of the rarest: 25 cases
reported, mean age 54.
Clinics and pathology
Disease
Tumor of the vulva and vagina
Note: Benign and malignant solid tumors at these sites
are rare. The malignant lesions may have epithelial
(squamous and glandular) and mesenchymal (soft
tissue) origin.
Clinics
Cancer of the vulva and vagina at the very early stages
tends to be asymptomatic. Delay in diagnosis is
common, partially due to disease rarity and to delay in
relating patient symptoms to the disease origin.
Vulva. Major symptoms are: painless bleeding
unrelated to the menstrual cycle, appearing of vulvar
skin white and rough.
Vagina. Major symptoms are painless vaginal bleeding
(65-80% of all cases), difficult or painful urination,
Etiology
The high-risk (HR) human papillomaviruses (HPVs)
infections have been identified as an essential although
not sufficient factor in the pathogenesis of vulval and
vagina carcinoma. It has been demonstrated that HPV
integration sites are distributed over the whole genome,
with a preference for genomic fragile site. It has been
also hypothesized that, at the early stages of infection,
Atlas Genet Cytogenet Oncol Haematol. 2007;11(3)
253
Vulva and Vagina tumors: an overview
Vanni R, Parodo G
pain in the pelvic area. Mainly post-menopausal
women (70%) are affected. Many vulvar or vaginal
growths are not neoplastic and may be treated by
monitoring or simple excision. Suspicious growths
require diagnostic biopsy and in case of cancer
diagnosis surgical ablation is mandatory.
influence the survival rate. The overall 5-year survival
rate is about 61%, with about 54% survivig for 10 years
or more.
Cytogenetics
Cytogenetics morphological
Pathology
Data on cytogenetics of vulva and vagina cancer are
scarse. Epithelial malignancy of both lesions show
cytogenetic abnormalities, although no specific
chromosome markers have been identified so far, and
no consistent association between cytogenetic
subgroups and histological differentiation have been
observed. Complex karyotypes are frequent, however
simple karyotypes have been observed in a number of
cases as well. Cytogenetically unrelated clones, as well
as closely related clones, were found in both in situ and
infiltrating squamous cell carcinoma (SCC). Structural
changes of chromosome 3, 8, 9, 11, 13, 14, 19 and 22
have been frequently observed. Cytogenetically
unrelated, abnormal clones, characterized by simple
changes (chromosome X and 7 aneuploidy) have been
described in Paget’s disease. The karyotypes of
melanoma and dermatofibrosarcoma protuberans,
arising in the vulva and/or vagina, substantially do not
differ from the karyotypes of the same entities arising
at other sites. A single case of vagina leiomyoma has
been reported recently and a t(7;8)(p13;q11.2)
translocation without PLAG1 alteration has been
described.
The histopathology of vulva and vagina neoplasms
reflects the different cell origins of the Tumors (see
classification). Examples of both gross and microscopic
images of these clinical entities can be viewed at
http://www.gfmer.ch/selected_images_v2/level1.php?c
at1=8 & stype=n Immunohistochemical studies
demonstrate that monoclonal antibodies to MIB-1
(Ki67), a proliferation-associated marker, distinguish
two different labeling patterns in the vulvar lesions :
diffuse pattern, associated with poor prognosis, or
localized pattern.
Treatment
Vulva. Small primary lesions less than 2 cm in
diameter with superficial invasion are usually treated
with wide local excision with adequate surgical
margins For tumors larger than 2 cm, or deeply
growing
into
the
underlying
inguinal,
lymphadenectomy is performed in order to plan a
further partial or total vulvectomy. Radiation, with or
without chemotherapy, may be used to treat advanced
tumors or tumor recurrences, although there is not
general consensus on the advantage of post-operative
radiation therapy.
Vagina. According to the FIGO, a vaginal lesion arises
solely from the vagina : a vaginal lesion involving the
external os of the cervix should be considered cervical
cancer, and a tumor involving both vulva and vagina
should be considered vulvar cancer, and they should be
treated as such. Radiotherapy is the most commonly
used treatment for cancer of the vagina. Indication for
diverse surgical interventions (radical hysterectomy,
total or subtotal vaginectomy, vulvectomy, inguinal
lymphadenectomy, etc), often accompained by
radiation therapy, depends on the lesion type, stage,
location, size and patient’s history.
Cytogenetics molecular
Fluorescence in situ hybridization (FISH) supports the
cytogenetic pattern observed by conventional
techniques, confirming the gain of chromosome 3q as
an early and consistent change in carcinomas of the
vulva, and the presence of EWS/FLI-1 fusion in
extraosseous
Ewing's
sarcoma/peripheral
neuroectodermal tumors of both vulva and vagina.
CGH profiles are also confirmatory: chromosome
imbalance with gains from the long arm of
chromosome 3, 5, 8, 9 and losses from the 11q have
been frequently observed. A comparison between
papillomavirus-negative and papillomavirus-positive
vulvar cancer indicated that chromosome 8q was more
commonly gained in the positive cases.
Prognosis
Vulva. As with many other types of cancer prognosis
depends on several factors, including the histological
type of the lesion. In general, patients with increasing
tumor stage have a lower rate of survival. The overall
5-year survival rate ranges from 90% to 33%,
depending upon whether and how many lymphonodes
are involved (not in a directly proportional way).
Recurrences are seen in a high percentage of patients
within the first two years of follow-up.
Vagina. The histologic type, size (Tumors less than
4cm seem to be associated with a significantly better
survival rate), stage and grade and location of the tumor
Atlas Genet Cytogenet Oncol Haematol. 2007;11(3)
Genes involved and Proteins
Note: No specific genes involved in vulva or vagina
carcinogenesis have been found so far. An isolated
study indicated a prominent role of the common IL1RN
intron 2 polymorphism in vulvar carcinogenesis.
References
Teixeira MR, Kristensen GB, Abeler VM, Heim S. Karyotypic
findings in tumors of the vulva and vagina. Cancer Genet
Cytogenet 1999;111:87-91.
254
Vulva and Vagina tumors: an overview
Vanni R, Parodo G
Vang R, Taubenberger JK, Mannion CM, Bijwaard K, Malpica
A, Ordonez NG, Tavassoli FA, Silver SA. Primary vulvar and
vaginal
extraosseous
Ewing's
sarcoma/peripheral
neuroectodermal tumor: diagnostic confirmation with CD99
immunostaining and reverse transcriptase-polymerase chain
reaction. Int J Gynecol Pathol 2000;19:103-109.
Micci F, Teixeira MR, Scheistroen M, Abeler VM, Heim.
Cytogenetic characterization of tumors of the vulva and vagina.
Genes Chromosomes Cancer 2003;38:137-148.
Grimm C, Berger I, Tomovski C, Zeillinger R, Concin N,
Leodolter S, Koelbl H, Tempfer CB, Hefler LA. A polymorphism
of the interleukin-1 receptor antagonist plays a prominent role
within the interleukin-1 gene cluster in vulvar carcinogenesis.
Gynecol Oncol 2004;92:936-940.
Vanni R, Faa G, Dettori T, Dumanski JP, O¹ Brien KP. A case
of Dermatofibrosarcoma protuberans of the vulva with a
COL1A1/PDGFB fusion identical to a case of Giant Cell
fibroblastoma. Virchows Arch 2000;437:95-100.
Horton E, Dobin SM, Debiec-Rychter M, Donner RL. A clonal
translocation (7;8)(p13;q11.2) in a leiomyoma of the vulva.
Cancer Genet Cytogenet 2006;170:58-60.
Allen DG, Hutchins AM, Hammet F, White DJ, Scurry JP,
Tabrizi SN, Garland SM, Armes JE. Genetic aberrations
detected by comparative genomic hybridisation in vulvar
cancers. Br J Cancer 2002;86:924-928.
This article should be referenced as such:
Vanni R, Parodo G. Vulva and Vagina tumors: an overview.
Atlas Genet Cytogenet Oncol Haematol.2007;11(3):252-255.
Tavassoli FA and Stratton MR Editors. Pathology and Genetics
of Tumours of the Breast and Female Genital Organs. WHO
classification of tumours:2002 editions.
Atlas Genet Cytogenet Oncol Haematol. 2007;11(3)
255
Atlas of Genetics and Cytogenetics
in Oncology and Haematology
OPEN ACCESS JOURNAL AT INIST-CNRS
Cancer Prone Disease Section
Mini Review
Diamond-Blackfan anemia (DBA)
Hanna T Gazda
Harvard Medical School, Children's Hospital Boston, 300 Longwood Ave., Boston, MA 02115, USA
Published in Atlas Database: February 2007
Online updated version: http://AtlasGeneticsOncology.org/Kprones/DiamondBlackfanID10040.html
DOI: 10.4267/2042/38457
This article is an update of: Punnett HH. Diamond-Blackfan anemia (DBA). Atlas Genet Cytogenet Oncol Haematol.1999;3(3):160.
This work is licensed under a Creative Commons Attribution-Non-commercial-No Derivative Works 2.0 France Licence.
© 2007 Atlas of Genetics and Cytogenetics in Oncology and Haematology
Identity
Genes involved and Proteins
Inheritance: Genetic heterogeneity; majority of cases
autosomal dominant, occasionally with variable
expression (incomplete dominance) manifesting as
mild anemia or only macrocytosis and/or elevated
erythrocyte adenosine deaminase activity (eADA) in
transmitting parent or in siblings; some cases
apparently autosomal recessive, not linked to 19q.
RPS19
Location: 19q13.2
Protein
Description: Ribosomal protein S19; ribosomal
proteins are a major component of cellular proteins. In
general their function(s), aside from being part of the
ribosome, are unknown. However, RPS19 protein was
shown to be essential for 18S rRNA maturation and
40S subunit synthesis. Haplo-insufficiency of the
protein encoded by the mutated gene is a likely
mechanism underlying the pathogenesis of DBA.
Mutations
Germinal: 62 different heterozygous mutations in
RPS19 were identified and reported in 113 of the 457
(about 25%) DBA probands. They were non-sense,
frameshift, splice site and missense mutations. Several
patients
had
disease-associated
chromosomal
abnormalities in DBA region, including t(X;19),
t(8;19), and 19q microdeletions.
Clinics
- Chronic constitutional aregenerative anemia with
absent or decreased red cell precursors in bone marrow.
- Macrocytosis elevated fetal hemoglobin and increased
eADA.
- Physical abnormalities in about 40% of DBA cases
including craniofacial and thumb abnormalities, atrial
or ventrucular septal defects, short stature, mild
retardation, etc.
- Hematologic malignancy: in 2.5% of all reported
cases of DBA; primarily ANLL with no FAB
preference but also ALL, Hodgkin's disease.
- Solid tumors include carcinoma of liver, stomach,
osteogenic sarcoma.
- Age of malignancy onset from 2 to 43 years.
- Disease-related and treatment-related factors, i.e.,
allosensitization and iron overload, contribute to
malignancy.
RPS24
Location: 10q22.3
DNA/RNA
Description: ribosomal protein S24.
Mutations
Germinal: Three heterozygous mutations in RPS24
(two nonsense and one splice site mutations causing
premature termination codons and skipped exon,
respectively) were identified among 185 RPS19negative DBA probands (about 2%).
Treatment
Corticosteroids, transfusion, bone marrow transplant.
Evolution
Some patients enter remission, with or without
corticosteroid therapy.
Prognosis
Median survival: 38 years.
Atlas Genet Cytogenet Oncol Haematol. 2007;11(3)
256
Diamond-Blackfan anemia (DBA)
Gazda HT
Van Dijken PJ, Verwijs W. Diamond-Blackfan anemia and
malignancy. A case report and review of the literature. Cancer
1995;76:517-520. (Review).
Flygare J, Kiefer T, Miyake K, Utsugisawa T, Hamaguchi I, Da
Costa L, Richter J, Davey EJ, Matsson H, Dahl N, Wiznerowicz
M, Trono D, Karlsson S. Deficiency of ribosomal protein S19 in
CD34+ cells generated by siRNA blocks erythroid development
and mimics defects seen in Diamond-Blackfan anemia. Blood
2005;105(12):4627-4634.
Janov AJ, Leong T, Nathan DG, Guinan EC. DiamondBlackfan anemia. Natural history and sequelae of treatment.
Medicine 1996;75(2):77-78.
Ohene-Abuakwa Y, Orfali KA, Marius C, Ball SE. Two-phase
culture in Diamond Blackfan anemia: localization of erythroid
defect. Blood 2005;105(2):838-846.
Gustavsson P, Garelli E, Draptchinskaia N, Ball S, Willig T-N,
Tentler D, Dianzani I, Punnett HH, Shafer F, Cario H,
Ramenghi U, Glomstein A, Pfeiffer RA, Goringe A, Oliver NF,
Smibert E, Tchernia G, Elinder G, Dahl N. Identification of
microdeletions spanning the Diamond-Blackfan anemia locus
(DBA) on 19q13 and evidence for genetic heterogeneity. Am J
Human Genet 1998;63:1388-1395.
Cmejlova J, Dolezalova L, Pospisilova D, Petrtylova K, Petrak
J, Cmejla R. Translational efficiency in patients with DiamondBlackfan anemia. Haematologica 2006;91(11):1456-1464.
References
Faivre L, Meerpohl J, Da Costa L, Marie I, Nouvel C, Gnekow
A, Bender-Gotze C, Bauters F, Coiffier B, Peaud PY, Rispal P,
Berrebi A, Berger C, Flesch M, Sagot P, Varet B, Niemeyer C,
Tchernia G, Leblanc T. High-risk pregnancies in DiamondBlackfan anemia: a survey of 64 pregnancies from the French
and German registries. Haematologica 2006;91(4):530-533.
Draptchinskaia N, Gustavsson P, Andersson B, Petterson M,
Willig TN, Dianzani I, Ball S, Tchernia G, Klar J, Matsson H,
Tentler D, Mohandas N, Carlsson B, Dahl N. The gene
encoding ribosomal protein S19 is mutated in DiamondBlackfan anemia. Nature Genet 1999;21:169-174.
Flygare J, Karlsson S. Diamond-Blackfan
erythropoiesis lost in translation. Blood 2006;.
Gazda HT, Grabowska A, Merida-Long LB, Latawiec E,
Schneider HE, Lipton JM, Vlachos A, Atsidaftos E, Ball SE,
Orfali KA, Niewiadomska E, Da Costa L, Tchernia G, Niemeyer
C, Meerpohl JJ, Stahl J, Schratt G, Glader B, Backer K, Wong
C, Nathan DG, Beggs AH, Sieff CA. Ribosomal protein S24
gene is mutated in Diamond-Blackfan anemia. Am J Hum
Genet 2006;79(6):1110-1118.
Willig TN, Draptchinskaia N, Dianzani I, Ball S, Niemeyer C,
Ramenghi U, Orfali K, Gustavsson P, Garelli E, Brusco A,
Tiemann C, Perignon JL, Bouchier C, Cicchiello L, Dahl N,
Mohandas N, Tchernia G. Mutations in ribosomal protein S19
gene and diamond blackfan anemia: wide variations in
phenotypic expression. Blood 1999;94:4294-4306.
Vlachos A, Klein GW, Lipton JM. The Diamond Blackfan
Anemia Registry: tool for investigating the epidemiology and
biology of Diamond-Blackfan anemia. J. Pediatr. Hematol.
Oncol 2001;23(6):377-382.
Gazda HT, Kho AT, Sanoudou D, Zaucha JM, Kohane IS, Sieff
CA, Beggs AH. Ribosomal Protein Gene Expression Alters
Transcription, Translation, Apoptosis, and Oncogenic
Pathways in Diamond-Blackfan Anemia. Stem Cells
2006;24:2034-2044.
Da Costa L, Narla G, Willig TN, Peters LL, Parra M, Fixler J,
Tchernia G, Mohandas N. Ribosomal protein S19 expression
during erythroid differentiation. Blood 2003;101:318-324.
Orrù S, Aspesi A, Armiraglio M, Caterino M, Loreni F,
Ruoppolo M, Santoro C, Dianzani I. Analysis of RPS19's
interactome. Mol Cell Proteomics 2006;.
Gazda HT, Zhong R, Long L, Niewiadomska E, Lipton JM,
Ploszynska A, Zaucha JM, Vlachos A, Atsidaftos E, Viskochil
DH, Niemeyer CM, Meerpohl JJ, Rokicka-Milewska R,
Pospisilova D, Wiktor-Jedrzejczak W, Nathan DG, Beggs AH,
Sieff CA. RNA and protein evidence for haplo-insufficiency in
Diamond-Blackfan anaemia patients with RPS19 mutations. Br
J Haematol 2004;127:105-113.
Choesmel V, Bacqueville D, Rouquette J, Noaillac-Depeyre J,
Fribourg S, Crétien A, Leblanc T, Tchernia G, Da Costa L,
Gleizes PE. Impaired ribosome biogenesis in DiamondBlackfan anemia. Blood 2007;109(3):1275-1283.
Flygare J, Aspesi A, Bailey JC, Miyake K, Caffrey JM, Karlsson
S, Ellis SR. Human RPS19, the gene mutated in DiamondBlackfan anemia, encodes a ribosomal protein required for the
maturation of 40S ribosomal subunits. Blood 2007;109(3):980986.
Orfali KA, Ohene-Abuakwa Y, Ball SE. Diamond Blackfan
anaemia in the UK: clinical and genetic heterogeneity. Br J
Haematol 2004;125:243-252.
Ebert BL, Lee MM, Pretz JL, Subramanian A, Mak R, Golub
TR, Sieff CA. An RNA interference model of RPS19 deficiency
in
Diamond-Blackfan
anemia recapitulates
defective
hematopoiesis and rescue by dexamethasone: identification of
dexamethasone-responsive genes by microarray. Blood
2005;105(12):4620-4626.
Atlas Genet Cytogenet Oncol Haematol. 2007;11(3)
anemia:
This article should be referenced as such:
Gazda HT. Diamond-Blackfan anemia (DBA). Atlas Genet
Cytogenet Oncol Haematol.2007;11(3):256-257.
257
Atlas of Genetics and Cytogenetics
in Oncology and Haematology
OPEN ACCESS JOURNAL AT INIST-CNRS
Case Report Section
Paper co-edited with the European LeukemiaNet
t(16;21)(q24;q22) in therapy-related acute
myelogenous leukemia arising from
myelodysplastic syndrome
Paola Dal Cin, Karim Ouahchi
Department of Pathology, Brigham and Women's Hospital and Harvard Medical School, Boston, MA 02115,
USA
Published in Atlas Database: February 2007
Online updated version: http://AtlasGeneticsOncology.org/Reports/1621DalCinID100022.html
DOI: 10.4267/2042/38458
This work is licensed under a Creative Commons Attribution-Non-commercial-No Derivative Works 2.0 France Licence.
© 2007 Atlas of Genetics and Cytogenetics in Oncology and Haematology
WBC: 0.29 x 109/l; Hb: 10.7 g/dl; platelets: 19x 109/l.
Bone marrow: Megakaryocytes: none noted; Blasts:
65%; Promyelocytes: 1%; Myeloid Activity: 20%,
occasional dysplastic forms; Erythroid Activity: 12%,
occasional dysplastic forms; Lymphocytes: 2%.
myelodysplastic syndrome: (09-2006) karyotype was
not performed; therapy-related AML: (01-11-2007)
karyotype showing t(16;21)
Treatment:
Chemotherapy
and
radiotherapy;
chlorambucil, Vinblastine Procarbazine, Prednisone
(MOPP) until June 2004; radiotherapy in 2004;
ifosfamide, carboplatin and etoposide (ICE) in August
2005; autologous bone marrow transplant in August
2006, and conditioning regimen consisted of Cytoxan,
BCNU and etoposide. Induction therapy in January
2007 (16-01-07) and preparation for second transplant.
Complete remission was obtained
Comments : bone marrow biopsy performed on 03-012007 showing no evidence of leukemia and 2% of
blast. Karyotype performed on bone marrow aspirate
was interpreted as 46, XY in 20 metaphases.
Relapse: Status: Alive 03-2007
Cytopathology classification
Karyotype
Cytology: M2 arising from previous myelodysplastic
syndrome (RAEB-1).
Immunophenotype: Population of immature cells is
positive for CD34 +, CD45 (dim), HLA-DR +, CD117
+, CD13 +, and CD33+ and negative for CD15-,
monocytic, B and T lymphoid markers.
Pathology: Involvement by acute myelogenous
leukemia
(FAB-M2)
with
background
dysmyelopoiesis.
Sample: Bone marrow aspirate; Culture time: 24h;
Banding: GTG.
Results:
49,XY,+Y,+3,+8,t(16;21)(q24;q22)[18]/46,XY[2]
Other molecular cytogenetic technics: FISH evaluation
for AML1 rearrangement was performed on abnormal
metaphases with the LSI TEL/AML1 ES Dual Color
Translocation Probe (Abbott Molecular/Vysis, Inc.).
Other
molecular
cytogenetics
results:
Ish
der(16)(dimAML1+), der(21)(dimAML1+)[5/5] (see
Fig. 2).
Clinics
Age and sex: 32 years old male patient.
Age and sex : 32 year(s) old male patient.
Previous History : preleukemia (RAEB diagnosed in
09-2006); Hodgkin's lymphoma diagnosed in 2003.
Organomegaly : no hepatomegaly ; no splenomegaly ;
enlarged lymph nodes (History of Hodgkin's lymphoma
involving right side neck lymph node) ; no central
nervous system involvement.
Blood
Survival
Date of diagnosis: Hodgkin's lymphoma: (2003);
Atlas Genet Cytogenet Oncol Haematol. 2007;11(3)
258
t(16;21)(q24;q22) in therapy-related acute myelogenous leukemia arising from myelodysplastic syndrome
Dal Cin P, Ouahchi K
Trisomy 8 is a frequent secondary abnormality
associated with t(16;21), however in this current case
we also report the presence of an additional
chromosome Y and trisomy 3.
Comments
The t(16;21) was reported mostly in t-MDS/t-AML,
and classified as M2 in a majority of cases. Two cases
including this current report were observed after
treatment for Hodgkin lymphoma.
Partial GTG-banding karyotype showing t(16;21)(q24;q22)(a) and numerical anomalies.
Partial FISH analysis showing the AML1 hybridization signals on the derivative chromosomes 16 and 21 and on the normal chromosome
21(b).
Atlas Genet Cytogenet Oncol Haematol. 2007;11(3)
259
t(16;21)(q24;q22) in therapy-related acute myelogenous leukemia arising from myelodysplastic syndrome
Jonveaux P, Baranger L, Eclache-Saudreau V, Pagès MP,
Cabrol C, Terré C, Berger R; Groupe Français de
Cytogénétique Hématologique (GFCH). Abnormalities of the
long arm of chromosome 21 in 107 patients with hematopoietic
disorders: a collaborative retrospective study of the Groupe
Français de Cytogénétique Hématologique. Cancer Genet
Cytogenet 2006;166:1-11.
References
Pérot C. t(16;21)(q24;q22). Atlas Genet Cytogenet Oncol
Haematol 1998;2(3).
Kondoh K, Nakata Y, Furuta T, Hosoda F, Gamou T,
Kurosawa Y, Kinoshita A, Ohki M, Tomita Y, Mori T. A pediatric
case of secondary leukemia associated with t(16;21)(q24;q22)
exhibiting the chimeric AML1-MTG16 gene. Leuk Lymphoma
2002;43:415-420.
This article should be referenced as such:
Dal Cin P, Ouahchi K. t(16;21)(q24;q22) in therapy-related
acute myelogenous leukemia arising from myelodysplastic
syndrome. Atlas Genet Cytogenet Oncol Haematol.2007;
11(3):258-260.
Huret JL. t(16;21)(q24;q22). Atlas Genet Cytogenet Oncol
Haematol 2003;7(4).
Jeandidier E, Dastugue N, Mugneret F, Lafage-Pochitaloff M,
Mozziconacci MJ, Herens C, Michaux L, Verellen-Dumoulin C,
Talmant P, Cornillet-Lefebvre P, Luquet I, Charrin C, Barin C,
Collonge-Rame MA, Pérot C, Van den Akker J, Grégoire MJ,
Atlas Genet Cytogenet Oncol Haematol. 2007;11(3)
Dal Cin P, Ouahchi K
260
Atlas of Genetics and Cytogenetics
in Oncology and Haematology
OPEN ACCESS JOURNAL AT INIST-CNRS
Case Report Section
Paper co-edited with the European LeukemiaNet
A de novo AML with a t(1;21)(p36;q22) in an elderly
patient
Paola Dal Cin, Andrew J Yee, Bimalangshu Dey
Department of Pathology, Brigham and Women's Hospital, 75 Francis Street, Boston, MA 02115, USA
(PDC); Hematology/Oncology Unit, Massachusetts General Hospital, Boston, MA, USA (AJY, BD)
Published in Atlas Database: March 2007
Online updated version: http://AtlasGeneticsOncology.org/Reports/0121DalCinID100021.html
DOI: 10.4267/2042/38459
This work is licensed under a Creative Commons Attribution-Non-commercial-No Derivative Works 2.0 France Licence.
© 2007 Atlas of Genetics and Cytogenetics in Oncology and Haematology
Clinics
Survival
Age and sex: 81 years old male patient.
Previous History : no preleukemia ; no inborn
condition of note.
Organomegaly : no hepatomegaly ; no splenomegaly ;
enlarged lymph nodes ; no central nervous system
involvement.
Date of diagnosis: 01-2005.
Treatment: Hydroxyurea and supportive care.
Complete remission: None
Treatment related death: Relapse: Patient never achieved complete remission.
Status: Dead 02-2005.
Survival: 1 months.
Blood
Karyotype
WBC: 3.3 x 109/l; Hb: N/A g/dl; platelets: 16x 109/l;
blasts: 2% (CD34+ myeloblasts).
Bone marrow: 20% myeloid precursors, 16% erythroid
precursor, 6% lymphocytes, 55% blasts and 2% plama
cells.
Sample: Bone marrow; Culture time: 24h; Banding:
GTG.
Results: 46,XY,t(1;21)(p36;q22)[15]
Other molecular cytogenetic technics: FISH with LSI
(TEL/AML1 ES Dual Color Translocation Probe
(Vysis, Inc.) on metaphases (see Fig 2).
Other
molecular
cytogenetics
results:
Ish
der(1)(dimAML1+), der(21)(dimAML1+).
Cytopathology classification
Cytology: AML M0
Immunophenotype: CD33+, CD13+, MPO-, CD41-,
CD61-, CD203c- (5% of all blast).
Rearranged Ig or Tcr: N/A
Precise diagnosis: Immunophenotype consistent with
the presence of myeloid precursors. Negative markers
(CD61,CD41,CD203c) associated with megakaryocytic
differentiation; AML M0.
Atlas Genet Cytogenet Oncol Haematol. 2007;11(3)
Comments
The t(1;21)(p36;q22) so far reported, is generally
observed as the sole chromosomal abnormality (5/6),
and is mostly a de novo aberration (4/6). The short
survival (one month) of our case, confirms the poor
prognosis in these patients carrying this chromosome
abnormality.
261
A de novo AML with a t(1;21)(p36;q22) in an elderly patient
Dal Cin P et al.
Partial GTG-banding karyotype showing t(1;21)(p36;q22)) (a)
Partial FISH analysis showing the AML1 hybridization signals on derivative chromosomes 1 and 21, and on the normal chromosome 21
(b)
Atlas Genet Cytogenet Oncol Haematol. 2007;11(3)
262
A de novo AML with a t(1;21)(p36;q22) in an elderly patient
Dal Cin P et al.
Southern Denmark. Contribution of multiparameter genetic
analysis to the detection of genetic alterations in hematologic
neoplasia. An evaluation of combining G-band analysis,
spectral karyotyping, and multiplex reverse-transcription
polymerase chain reaction (multiplex RT-PCR). Cancer Genet
Cytogenet 2006;165:1-8.
References
Stevens-Kroef MJ, Schoenmakers EF, van Kraaij M, Huys E,
Vermeulen S, van der Reijden B, van Kessel AG. Identification
of truncated RUNX1 and RUNX1-PRDM16 fusion transcripts in
a case of t(1;21)(p36;q22)-positive therapy-related AML.
Leukemia 2006;20:1187-1189.
This article should be referenced as such:
Dal Cin P, Yee AJ, Dey B. A de novo AML with a
t(1;21)(p36;q22) in an elderly patient. Atlas Genet Cytogenet
Oncol Haematol.2007;11(3):261-263.
Marian Stevens-Kroef. t(1;21)(p36;q22) - updated. Atlas Genet
Cytogenet Oncol Haematol 2006;10(3).
Preiss BS, Kerndrup GB, Pedersen RK, Hasle H, Pallisgaard
N; Lymphoma-Leukemia Study Group of the Region of
Atlas Genet Cytogenet Oncol Haematol. 2007;11(3)
263
Instructions to Authors
Manuscripts submitted to the Atlas must be submitted solely to the Atlas.
Iconography is most welcome: there is no space restriction.
The Atlas publishes "cards", "deep insights", "case reports", and "educational items".
Cards are structured review articles. Detailed instructions for these structured reviews can be found at:
http://AtlasGeneticsOncology.org/Forms/Gene_Form.html for reviews on genes,
http://AtlasGeneticsOncology.org/Forms/Leukaemia_Form.html for reviews on leukaemias,
http://AtlasGeneticsOncology.org/Forms/SolidTumour_Form.html for reviews on solid tumours,
http://AtlasGeneticsOncology.org/Forms/CancerProne_Form.html for reviews on cancer-prone diseases.
According to the length of the paper, cards are divided, into "reviews" (texts exceeding 2000 words), "mini reviews" (between), and
"short communications" (texts below 400 words). The latter category may not be accepted for indexing by bibliographic databases.
Deep Insights are written as traditional papers, made of paragraphs with headings, at the author's convenience. No length restriction.
Case Reports in haematological malignancies are dedicated to recurrent -but rare- chromosomes abnormalities in
leukaemias/lymphomas. Cases of interest shall be: 1- recurrent (i.e. the chromosome anomaly has already been described in at least 1
case), 2- rare (previously described in less than 20 cases), 3- with well documented clinics and laboratory findings, and 4- with
iconography of chromosomes.
It is mandatory to use the specific "Submission form for Case reports":
see http://AtlasGeneticsOncology.org/Reports/Case_Report_Submission.html.
Educational Items must be didactic, give full information and be accompanied with iconography. Translations into French, German,
Italian, and Spanish are welcome.
Subscription: The Atlas is FREE!
Corporate patronage, sponsorship and advertising
Enquiries should be addressed to [email protected].
Rules, Copyright Notice and Disclaimer
Conflicts of Interest: Authors must state explicitly whether potential conflicts do or do not exist. Reviewers must disclose to editors
any conflicts of interest that could bias their opinions of the manuscript. The editor and the editorial board members must disclose
any potential conflict.
Privacy and Confidentiality – Iconography: Patients have a right to privacy. Identifying details should be omitted. If complete
anonymity is difficult to achieve, informed consent should be obtained.
Property: As "cards" are to evolve with further improvements and updates from various contributors, the property of the cards
belongs to the editor, and modifications will be made without authorization from the previous contributor (who may, nonetheless, be
asked for refereeing); contributors are listed in an edit history manner. Authors keep the rights to use further the content of their
papers published in the Atlas, provided that the source is cited.
Copyright: The information in the Atlas of Genetics and Cytogenetics in Oncology and Haematology is issued for general
distribution. All rights are reserved. The information presented is protected under international conventions and under national laws
on copyright and neighbouring rights. Commercial use is totally forbidden. Information extracted from the Atlas may be reviewed,
reproduced or translated for research or private study but not for sale or for use in conjunction with commercial purposes. Any use of
information from the Atlas should be accompanied by an acknowledgment of the Atlas as the source, citing the uniform resource
locator (URL) of the article and/or the article reference, according to the Vancouver convention. Reference to any specific
commercial products, process, or service by trade name, trademark, manufacturer, or otherwise, does not necessarily constitute or
imply its endorsement, recommendation, or favouring. The views and opinions of contributors and authors expressed herein do not
necessarily state or reflect those of the Atlas editorial staff or of the web site holder, and shall not be used for advertising or product
endorsement purposes. The Atlas does not make any warranty, express or implied, including the warranties of merchantability and
fitness for a particular purpose, or assumes any legal liability or responsibility for the accuracy, completeness, or usefulness of any
information, and shall not be liable whatsoever for any damages incurred as a result of its use. In particular, information presented in
the Atlas is only for research purpose, and shall not be used for diagnosis or treatment purposes. No responsibility is assumed for any
injury and/or damage to persons or property for any use or operation of any methods products, instructions or ideas contained in the
material herein.
See also: "Uniform Requirements for Manuscripts Submitted to Biomedical Journals: Writing and Editing for Biomedical
Publication - Updated October 2004": http://www.icmje.org.
http://AtlasGeneticsOncology.org
© ATLAS - ISSN 1768-3262