Download Lightfield (2011) I&I

INFECTION AND IMMUNITY, Apr. 2011, p. 1606–1614
0019-9567/11/$12.00 doi:10.1128/IAI.01187-10
Copyright © 2011, American Society for Microbiology. All Rights Reserved.
Vol. 79, No. 4
Differential Requirements for NAIP5 in Activation of
the NLRC4 Inflammasome!
Karla L. Lightfield,1†‡ Jenny Persson,2†§ Norver J. Trinidad,2 Sky W. Brubaker,2¶ Eric M. Kofoed,2
John-Demian Sauer,2 Eric A. Dunipace,2 Sarah E. Warren,3,4
Edward A. Miao,3 and Russell E. Vance2*
School of Public Health,1 Division of Immunology & Pathogenesis,2 Department of Molecular & Cell Biology, University of
California, Berkeley, California 94720; Institute for Systems Biology, Seattle, Washington 981033; and Department of
Immunology, University of Washington, Seattle, Washington 981954
Received 8 November 2010/Returned for modification 2 December 2010/Accepted 20 January 2011
Inflammasomes are cytosolic multiprotein complexes that assemble in response to infectious or noxious
stimuli and activate the CASPASE-1 protease. The inflammasome containing the nucleotide binding domainleucine-rich repeat (NBD-LRR) protein NLRC4 (interleukin-converting enzyme protease-activating factor
[IPAF]) responds to the cytosolic presence of bacterial proteins such as flagellin or the inner rod component
of bacterial type III secretion systems (e.g., Salmonella PrgJ). In some instances, such as infection with
Legionella pneumophila, the activation of the NLRC4 inflammasome requires the presence of a second NBDLRR protein, NAIP5. NAIP5 also is required for NLRC4 activation by the minimal C-terminal flagellin peptide,
which is sufficient to activate NLRC4. However, NLRC4 activation is not always dependent upon NAIP5. In this
report, we define the molecular requirements for NAIP5 in the activation of the NLRC4 inflammasome. We
demonstrate that the N terminus of flagellin can relieve the requirement for NAIP5 during the activation of the
NLRC4 inflammasome. We also demonstrate that NLRC4 responds to the Salmonella protein PrgJ independently of NAIP5. Our results indicate that NAIP5 regulates the apparent specificity of the NLRC4 inflammasome for distinct bacterial ligands.
(LRR)-containing proteins constitute an important family of
cytosolic immunosensors. Certain NBD-LRR proteins, including NAIP5 and NLRC4, are involved in orchestrating the assembly and activation of multiprotein complexes called inflammasomes (24). The primary function of inflammasomes is to
activate the cysteine protease CASPASE-1 (CASP-1), which is
produced initially as an inactive proprotein and requires recruitment to inflammasomes to become activated (16). Once
activated, CASP-1 is required for the proteolytic processing
and secretion of the proinflammatory cytokines interleukin-1"
(IL-1") and IL-18. In addition, activated CASP-1 can induce a
rapid, inflammatory cell death termed pyroptosis (2).
Several distinct NBD-LRR proteins are expressed by host
cells and appear to dictate inflammasome assembly in response
to specific stimuli. For example, the NBD-LRR protein
NLRP3 (NALP3; cryopyrin) orchestrates the assembly of an
inflammasome that responds to a wide variety of stimuli, including crystalline substances such as uric acid, asbestos, and
alum (24). In the mouse, the related NBD-LRR protein
NLRP1B (NALP1B) activates a distinct inflammasome in response to anthrax lethal toxin (3). NBD-LRR proteins are not
the only sensor-scaffold proteins responsible for CASP-1 activation. For example, the PYHIN family member AIM2 binds
cytosolic DNA and is responsible for CASP-1 activation in
response to infection with bacterial pathogens (7, 11, 12, 21,
23, 28).
The inflammasome containing the NBD-LRR protein
NLRC4 (interleukin-converting enzyme protease-activating
factor [IPAF]) is one of the most well-characterized inflammasomes, and it has been shown to activate CASP-1 specifically in response to a conserved domain within the bacterial
The innate immune system initiates defense against infectious agents by employing germ line-encoded receptors to detect microbial molecules (also called pathogen-associated molecular patterns, or PAMPs) (10). Examples of PAMPs include
lipopolysaccharide, cell wall components, bacterial nucleic acids, and flagellin. The mammalian Toll-like receptors (TLRs)
are transmembrane receptors that are capable of detecting
microbial products at the cell surface and within intracellular
compartments (26). Signaling downstream of TLR stimulation
results in the activation of NF-!B and the induction of proinflammatory cytokines, chemokines, and other antimicrobial
defenses. In addition to TLRs, there are several types of receptors that lack transmembrane domains and function to
sense PAMPs within the cytosol (26). For example, the cytosolic presence of RNA is detected by the MDA5/RIG-I family
of RNA helicases. It is believed that cytosolic immunosurveillance permits host cells to make specialized or unique responses to intracellular pathogens and thus to distinguish these
pathogens from extracellular microbes that do not access the
host cell cytosol (27).
The nucleotide binding domain (NBD)-leucine-rich repeat
* Corresponding author. Mailing address: 415 Life Science Addition, Department of Molecular and Cell Biology, University of California, Berkeley, CA 94720. Phone: (510) 643-2795. Fax: (510) 6421386. E-mail: [email protected].
† These authors contributed equally.
‡ Present address: Department of Microbiology & Immunology,
Stanford University, Stanford, CA 94305.
§ Present address: Department of Microbiology, Tumor and Cell
Biology, Karolinska Institute, Stockholm, Sweden.
¶ Present address: Children’s Hospital Boston, Boston, MA 02115.
!
Published ahead of print on 31 January 2011.
1606
VOL. 79, 2011
REQUIREMENT FOR NAIP5 IN NLRC4 INFLAMMASOME ACTIVATION
protein flagellin (1, 9, 14, 17), as well as to the conserved inner
rod component of the type III secretion system, called PrgJ in
Salmonella (18). Interestingly, in some instances, the activation
of the NLRC4 inflammasome requires the presence of a second NBD-LRR protein, NAIP5 (formerly BIRC1E) (14, 19,
22, 30). NAIP5 is believed to heterooligomerize with NLRC4
(5, 30), but the precise biochemical function of NAIP5 in
NLRC4 activation remains enigmatic. It was previously shown
that NAIP5 is required for CASP-1 activation in response to
some, but not all, NLRC4-dependent stimuli (14). For example, NAIP5 was required for the NLRC4-dependent activation
of CASP-1 in response to Legionella pneumophila, whereas
Naip5 deficiency had only partial effects on NLRC4-dependent
responses to Salmonella and Pseudomonas (14). NAIP5/
NLRC4/CASP-1 activation by L. pneumophila is dependent
largely on amino acids within the C terminus of flagellin (14),
and accordingly the retrovirus-mediated expression of a minimal C-terminal peptide from flagellin activates CASP-1-mediated pyroptotic cell death in a manner completely dependent
on NLRC4 and NAIP5 (14). Unexpectedly, however, the retrovirus-mediated expression of full-length flagellin activated
NLRC4- and CASP-1-dependent pyroptosis independently of
NAIP5 (14).
The molecular basis for the differential requirements for
NAIP5 in NLRC4 activation is not well understood. Legionella
and Salmonella both activate NLRC4 primarily via the translocation of flagellin to the cytosol of host cells, but the flagellin
molecules translocated exhibit amino acid differences in the
critical C-terminal domain. Moreover, while Salmonella translocates flagellin into host cells via its SPI-I type III secretion
system (T3SS) (25), Legionella lacks a T3SS and instead utilizes
the evolutionarily unrelated Dot/Icm type IV secretion system
(T4SS) to translocate flagellin into host cells. T3SSs, but not
T4SSs, contain homologs of the bacterial protein PrgJ, another
known activator of NLRC4 (18). Thus, differences in flagellin
itself, and/or the flagellin-translocating apparatus, may underlie the differential requirements for NAIP5 in NLRC4 activation.
In this paper, we dissect the molecular features that dictate
the requirement for NAIP5 in the activation of the NLRC4
inflammasome. We demonstrate that L. pneumophila engineered to express Salmonella flagellin activates NLRC4 in a
strictly NAIP5-dependent manner, thus ruling out polymorphisms within flagellin as an explanation for the differential
requirement for NAIP5 in the activation of NLRC4 by the two
bacterial species. We further demonstrate that the N terminus
of flagellin, while not sufficient itself to activate NLRC4, nevertheless is able to transform the C terminus of flagellin from
an NAIP5-dependent activator of the NLRC4 inflammasome
to an NAIP5-independent activator. Lastly, we show that the
PrgJ protein can activate NLRC4 without a requirement for
NAIP5. Taken together, our results suggest a model in which
NAIP5 functions to dictate the specificity of NLRC4 for distinct stimuli.
MATERIALS AND METHODS
Mice. Wild-type (WT) C57BL/6J (B6) mice were from Jackson Laboratories.
Nlrc4#/# mice on a pure B6 background (15) were obtained from S. Mariathasan
and V. Dixit (Genentech). Naip5#/# mice on a pure B6 background mice were
described previously (14).
1607
Bacterial strains. The Salmonella enterica serovar Typhimurium strain LT2
and the flagellin mutant S. Typhimurium LT2FliC/FljB# were gifts from A. Van
Der Velden and M. Starnbach. The pLIV2-L.p.FlaA and pLIV2-S.t.PrgJ constructs were constructed as isopropyl-"-D-thiogalactopyranoside (IPTG)-inducible variants of previously described strains. A construct fusing the amino-terminal 300 bp of the actA gene with the flaA gene from L.p.FlaA was previously
described and used to facilitate the ectopic secretion of Legionella pneumophila
FlaA (J.-D. Sauer et al., submitted for publication). The actA-L.p.FlaA fusion
was amplified from the pPL2-L.p.FlaA plasmid with the primers AAAAGCGG
CCGGTGGGATTAAATAGATTTATGCGTGC and AAAAGTCGACCAGA
AATCGAAGTGCAGTTG using Pfu Ultra II (Agilent Technologies, Santa
Clara, CA), where underlining indicates the restriction sites. The resulting PCR
product and the IPTG-inducible variant of pPL2, pLIV2 (8), were double digested with EagI and SalI (New England Biosystems, Waltham, MA) and ligated
using the NEB quick ligation kit. The resulting vector, pLIV2-L.p.FlaA, subsequently was integrated at the tRNAArg locus on the L. monocytogenes 10403s
chromosome as previously described (13). pLIV2-S.t.PrgJ was constructed similarly to the previously described actA-prgJ fusion construct (Sauer et al., submitted). The fusion was amplified from the pPL2-S.t.PrgJ plasmid using the
primers AAAAGCGGCCGCAGGAGGGAGTATAAGTGGGATTAAATAG
and TTTTGTCGACTCATGAGCGTAATAGCGTTTC, digested, and ligated
into pLIV2, and then it was integrated into the 10403s chromosome as previously
described. Legionella strain LP02 is a streptomycin-resistant thymidine auxotroph derivative of Legionella pneumophila strain LP01. LP02$flaA contains an
unmarked deletion of flaA and was described previously (22). LP02$flaA::fliC
expresses Salmonella fliC from the chromosome under the control of the endogenous Legionella flaA promoter. To generate this strain, the flaA promoter from
LP02 was amplified by PCR using primers pflaAFwd (ATAGTCGACTTAATG
CCTCTTTCTCTCCTGTCG) and pflaARev (AATGACTTGTGCCATAATTT
TAGTCTCCTCAGACCTGAATCC), while fliC was amplified from S. Typhimurium using primers fliCfwd (GAGGAGACTAAAATTATGGCACAAGTC
ATTAATACAAACAGC) and fliCrev (ATAGGATCCTTAACGCAGTAAAG
AGAGGACGTTTTG). These amplicons were mixed and spliced in a second
round of PCR using pflaAFwd and fliCrev and cloned into the allelic exchange
vector pSR47S. This suicide construct was introduced onto the LP02$flaA chromosome by a single crossover and selection with kanamycin (50 %g/ml).
Retroviral constructs and transductions. Retroviral constructs were generated
and transductions were performed as previously described (14). Briefly, retroviral particles were generated by the transient transfection of Phoenix-Eco packaging cells with MSCV2.2-based retroviral vectors. Bone marrow-derived cells
(1 & 106) were cultured for 48 h in a 6-well plate in medium containing macrophage colony-stimulating factor (M-CSF) and then were transduced with 1 ml of
retrovirus-containing packaging cell supernatant. Macrophages were analyzed 3
to 4 days posttransduction and analyzed for GFP expression on a Beckman
Coulter FC-500 flow cytometer. More than 10,000 cells were analyzed per sample. When we simultaneously transduced cells with multiple constructs (see Fig.
2), equal volumes of each retroviral supernatant were used. These macrophages
were analyzed on a BD Influx cell sorter for green fluorescent protein (GFP) and
mCherry expression. The retroviral constructs used in this paper were generated
as follows: GFP-C65 was constructed by amplifying the C-terminal 65 amino
acids of flagellin using the primers pC65fwd (GACGAGCTGTACAAGTTTG
AATCAACGATAG) and pFlaA65rev (TTGCGGCCGCCTATCGACCTAAC
AAAGATAATACAGATTGCG), while GFP was amplified using the primers
pGFPfwd (ATAAGATCTCCACCATGGTGAGCAAGGGCGAGGA) and
pGFP65rev (CTATCGTTGATTCAAACTTGTACAGCTCGTC). These amplicons were mixed and spliced in a second round of PCR using the primers
pGFPfwd and pFlaArev and were cloned into the retroviral expression vector
pMSCV2.2 using the enzymes BglII and NotI. Similarly, the construct N65-GFPC65 was generated by amplifying GFP-C65 with the primers pN65GFPfwd (G
GATGAACCAAGCCGTTATGGTGAGCAAGGGC) and pFlaA65rev, while
the N-terminal 65 amino acids of flagellin were amplified with the primers
pN65fwd
(ATAAGATCTCCACCATGGCTCAAGTAATCAACACTAATG
TGG) and pN65GFPrev (GCCCTTGCTCACCATAACGGCTTGGTTCATCC).
These amplicons were spliced in a second round of PCR using the primers pN65fwd
and pFlaA65rev. N65-GFP was generated by amplifying the N-terminal 65 amino
acids of flagellin with the primers pN65fwd and pN65GFPrev while amplifying GFP
with the primers pN65GFPfwd and pGFPrev (TTGCGGCCGCTTACTTGTACA
GCTCGTC). These amplicons were mixed and spliced in a second round of PCR
using the primers pN65fwd and pGFPrev. The constructs N65-GFP-C65 L12L32::II
and N65-GFP-C65 were generated using site-directed mutagenesis on the parental
N65-GFP-C65 construct, pL12fwd (CACTAATGTGGCGTCGatcACAGCCCAA
CGTAATTTGGG), pL12rev (CCCAAATTACGTTGGGCTGTgatCGACGCCA
CATTAGTG), pL32fwd (CATCGATCCAGCGTatcTCATCGGGATTAAGG),
1608
LIGHTFIELD ET AL.
and pL32rev (CCTTAATCCCGATGAgatACGCTGGATCGATG) for L12L32::II
and pL12Afwd (CACTAATGCAGCGTCGGCAACAGCCCAACG), pL12Arev
(CGTTGGGCTGTT GCCGACGCTGCATTAGTG), pI5V9Aafwd (GGCTCAA
GTAGCAAACACTAATGCAGCGTCGCTCAC), and pI5V9AArev(GTGAGC
GACGCTGCATTAGTGTTT GCTACTTGAGCC) for I5V9L12:AAA. mCherryC65 was generated by amplifying mCherry using pmCherryfwd (ATAAGATCTCC
ACCATGGTGAGCAAGGGCGAGG) and pmCherry65rev (GGCTATCGTTG
ATTCAAACTTGTACAGCTCGTCC), while the C-terminal 65 amino acids of
flagellin were amplified using the primers pmCherry65fwd (GGACGAGCTGTAC
AAGTTTGAATCAACGATGCC) and pFlaA65rev. These amplicons were mixed
and spliced during a second round of PCR with the primers pmCherryfwd and
pFlaA65rev and cloned into pMSCV2.2 with BglII and NotI.
Cytotoxicity assays. Cytotoxicity was measured as described previously (6) by
determining the activity of lactate dehydrogenase (LDH) released by cells. Bone
marrow-derived macrophages (5 & 104 to 1 & 105) were seeded onto tissue
culture-treated 96-well plates and infected with bacteria at the indicated multiplicity of infection. Plates were centrifuged at 400 & g to ensure the equivalent
infectivity of WT and flagellin mutant strains. At 30 min to 1 h postinfection,
medium was removed and replaced with medium containing 10 to 100 %g/ml
gentamicin to kill extracellular bacteria. Six hours after infection, plates were
centrifuged at 400 & g, and supernatant was collected and assayed for LDH
release. Legionella strains used for infection were grown overnight to an optical
density of '3.8. Salmonella cultures were grown overnight with shaking at 37°C
and were diluted 3 h prior to infection at 1:40 in 1 ml of LB and regrown with
shaking until reaching late-exponential phase. Listeria strains were grown as
standing cultures at 37°C in brain heart infusion (BHI) medium. In the experiments with Listeria, infected cells were treated with IPTG to induce the expression of flaA or prgJ. The percent specific lysis of infected cells was calculated
as the following: (amount of LDH released) # (background release by uninfected cells)/(amount of LDH released by detergent lysed cells minus background) & 100.
Growth curves. Bacterial growth was determined as previously described (4).
Macrophages were plated at a density of 5 & 105 cells per ml in 24-well plates,
allowed to adhere overnight, and infected with stationary-phase Legionella (OD,
'3.8) at a multiplicity of infection (MOI) of 0.01. CFU were determined by
lysing washed macrophage monolayers with sterile distilled water and plating
lysates on buffered charcoal yeast extract plates.
Protein transfection. Salmonella FliC, PrgJ, and SsaI proteins were purified as
described previously (18). Macrophages were plated at 5 & 104 per well in a
96-well plate, allowed to adhere overnight, and primed with tripalmitoyl cysteinyl
seryl tetralysine lipopeptide (Pam3CSK4; 0.5 %g/ml) for 3.5 h prior to protein
transfection to induce the expression of pro-interleukin-1" (pro-IL-1"). Protein
(0.2 %g/well) was transfected using the Profect P1 (Targeting Systems) transfection reagent according to the manufacturer’s instructions. Supernatants were
collected for analysis 3 h posttransfection and analyzed by enzyme-linked immunosorbent assay (ELISA) for IL-1" (R&D Systems).
Statistics. Statistical significance was assessed by the t test or one-way analysis
of variance (ANOVA) with Bonferroni posttests. Graph Pad Prism 5 software
was used for statistical analyses.
RESULTS
The N terminus of flagellin can relieve the requirement for
NAIP5 in flagellin sensing. To better understand the molecular basis for NAIP5/NLRC4 activation, we first sought to determine what regions of flagellin enable full-length flagellin to
be toxic to Naip5#/# macrophages in the retroviral lethality
assay (14). In this assay, flagellin is expressed downstream of a
mammalian promoter in macrophages using a retrovirus-based
construct. The transduction of macrophages with a construct
expressing a stimulatory flagellin molecule results in the rapid
pyroptotic cell death of the macrophages and thereby prevents
the expression of a coexpressed GFP reporter (14). Conversely, the transduction of a construct encoding a nonstimulatory flagellin mutant results in GFP( cells (14). Previously,
the retroviral lethality assay was used to establish that NLRC4
and NAIP5 both are required for the response to the C-terminal domain of flagellin, whereas pyroptotic cell death in
response to full-length flagellin required NLCR4 but not
INFECT. IMMUN.
NAIP5 (14). Thus, to determine what regions in full-length
flagellin relieve the requirement for NAIP5, we began by making a series of retroviral constructs expressing N-terminally
deleted flagellin molecules (Fig. 1A). These constructs were
transduced into primary macrophages. As shown previously
(14), retroviral expression constructs encoding full-length
flagellin (FlaA) did not stably transduce C57BL/6 (WT) or
isogenic Naip5#/# macrophages, as evidenced by a lack of
GFP( cells 3 days after transduction (Fig. 1B). However, we
found that a retroviral construct that expresses a flagellin molecule lacking the N-terminal 65 amino acids from flagellin
(FlaAN$65) could be transduced into Naip5#/# macrophages
(Fig. 1B). Consistently with our previous observation that the
C terminus of flagellin is sufficient to activate NLRC4,
FlaAN$65 (which retains the normal flagellin C terminus)
could not be transduced into WT macrophages. Further, Nterminal deletions of FlaA ($N85, $N100, and $N125) resembled $N65 and could be transduced into Naip5#/# macrophages (Fig. 1B). These results suggest that the N terminus of
flagellin is important for the ability of full-length flagellin to
activate NLRC4 independently of NAIP5.
Molecular basis by which the N terminus affects the requirement for Naip5. We next sought to address whether the N
terminus of flagellin is sufficient to convert the C terminus of
flagellin into an NAIP5-independent activator of NLRC4.
Consistently with our previous studies (14), we found that the
C-terminal 65 amino acids of flagellin, fused to GFP, is an
NAIP5-dependent activator of NLRC4 (Fig. 1C). In contrast,
full-length flagellin (whether or not it is fused to GFP) is an
NAIP5-independent activator of NLRC4 (Fig. 1B and C). To
determine the role of the N terminus in NAIP5/NLRC4 activation, we created an expression construct that consisted of
GFP flanked by the N-terminal and C-terminal 65 amino acids
of FlaA (Fig. 1A). The resulting N65-GFP-C65 construct behaved just like full-length flagellin; namely, it was cytotoxic to
macrophages in a manner requiring NLRC4 but independent
of the presence or absence of NAIP5 (Fig. 1C). The N terminus of flagellin fused to GFP was itself noncytotoxic and could
be transduced into WT (Nlrc4() macrophages (Fig. 1C). Thus,
the N terminus of flagellin is not sufficient to activate NLRC4.
However, the N terminus of flagellin appears to enhance or
alter NLRC4-dependent responses to the C terminus of flagellin in such a way that NAIP5 is no longer required.
Although the C-terminal region of flagellin is thought to be
unstructured when flagellin is in its monomeric form, the structure of flagellin within the flagellin filament (29) suggests that
the N and C termini of flagellin interact weakly via a coiled-coil
interaction. Moreover, the crystal structure of GFP reveals that
its N and C termini are near each other (20), and it therefore
is possible that the appended N and C termini of flagellin
interact with each other in the N65-GFP-C65 construct. Thus,
we hypothesized that a weak coiled-coil interaction with the N
terminus of flagellin resulted in a stabilized or structurally
altered C-terminal region that no longer required NAIP5 for
the stimulation of NLRC4. To test this idea, we mutated the N
terminus of flagellin within the N65-GFP-C65 construct to
disrupt the putative interaction between the N and C termini.
Two leucines (L12 and L32) in the N terminus of flagellin were
mutated to more bulky isoleucines, which would not be easily
accommodated within the core of a coiled coil and thus should
VOL. 79, 2011
REQUIREMENT FOR NAIP5 IN NLRC4 INFLAMMASOME ACTIVATION
1609
FIG. 1. Role for the N terminus of flagellin in NLRC4 activation. (A) Diagram of all retroviral constructs used in transduction experiments.
Note that all constructs expressed GFP, either as a direct fusion to L. pneumophila flagellin (FlaA; as shown) or downstream of an internal
ribosome entry site (IRES) (not shown). C65, C-terminal 65 amino acids of FlaA; C20, C-terminal 20 amino acids of FlaA; N65, N-terminal 65
amino acids of FlaA. FlaA$N constructs lack the indicated number of amino acids from the N terminus. (B and C) Wild-type (C57BL/6) or isogenic
Naip5#/# or Nlrc4#/# macrophages were transduced with the indicated constructs, and the percentage of GFP( cells was enumerated by flow
cytometry 3 to 4 days after transduction. (D and E) Wild-type, Naip5-deficient, or Naip5#/# Nlrc4#/# doubly deficient macrophages were
transduced with the indicated constructs, and the percentage of GFP( cells was enumerated by flow cytometry 3 to 4 days after transduction. More
than 10,000 cells were analyzed for each experiment. For each panel, data shown are from a single representative experiment of at least three that
produced similar results.
result in a disruption of putative coiled-coil interactions. In
addition, a series of mutations predicted to be even more
disruptive to the putative coiled-coil interaction were made,
namely, isoleucine 5, valine 9, and leucine 12 all were mutated
to alanines (I5V9L12:AAA). Neither series of mutations was
sufficient to transform the parental N65-GFP-C65 stimulus
from an NAIP5-independent stimulus (N65-GFP-C65) into an
NAIP5-dependent one (Fig. 1D and E). Thus, we were unable
to find evidence that a coiled-coil interaction between the N
and C termini of flagellin is important for the ability of fulllength flagellin to activate NLRC4 independently of NAIP5.
These results do not rule out the possibility that an interaction
between the N and C termini of flagellin (that we did not
disrupt with the mutations we made) is important in determining the requirement for NAIP5 in NLRC4 activation. However, a lack of a role for a coiled-coil interaction would not be
1610
LIGHTFIELD ET AL.
INFECT. IMMUN.
FIG. 2. N terminus of flagellin can relieve requirement for NAIP5 in flagellin sensing even when expressed on a distinct molecule from the C
terminus. A retroviral construct expressing the N-terminal 65 amino acids of flagellin fused to GFP, and a separate retroviral construct expressing
the C-terminal 65 amino acids of flagellin fused to mCherry, were transduced simultaneously into wild-type (A), Naip5#/# (B), or Nlrc4#/#
(C) macrophages, and the percentage of cells expressing GFP and/or mCherry was enumerated by flow cytometry 4 days posttransduction. The
percentage of double-positive cells among all transduced cells is indicated in parentheses. The results are representative of two representative
experiments.
surprising, given that the interaction between the N and C
termini of flagellin likely is very weak (29) and probably not
significant when flagellin is in its monomeric form, which is the
form that appears to be recognized by NLRC4 (17).
The N and C termini of flagellin can act in trans to activate
NLRC4. Because coiled-coil interactions did not appear to be
required for the NAIP5-independent activation of NLRC4 by
flagellin, we questioned whether the N and C termini of flagellin needed to be expressed on the same molecule or whether
they could cooperate in trans to activate NLRC4 without
NAIP5. To address this question, a construct encoding the
N-terminal 65 amino acids of flagellin fused to GFP (N65GFP), and a separate construct encoding the C-terminal 65
amino acids of flagellin fused to mCherry (mCherry-C65),
were expressed simultaneously in wild-type, Naip5-deficient,
and Nlrc4-deficient macrophages via retroviral transduction.
As expected, mCherry-C65 was cytotoxic to wild-type macrophages but not Naip5#/# or Nlrc4#/# macrophages (Fig. 2A to
C). While a robust population of brightly double-positive macrophages was detected in transduced Nlrc4#/# macrophages,
Naip5#/# macrophages harbored only a proportionally
smaller, less bright population of double-positive macrophages
(Fig. 2B and C). These results indicate that, at the relatively
high expression levels achieved by retroviral transduction, the
N terminus of flagellin can act in trans to convert the C terminus of flagellin into an NAIP5-independent stimulus. We were
unable to detect a physical interaction between mCherry-C65
and N65-GFP by immunoprecipitation (data not shown).
Taken together, our data raise the possibility that the N and C
termini cooperate to activate NLRC4 without physically interacting with each other, although a role for a transient or weak
physical interaction cannot be rule out.
NAIP5-independent detection of Salmonella. We previously
reported that while the activation of the inflammasome by
Legionella was strictly flagellin and NAIP5 dependent, the activation of the inflammasome by Salmonella was partially
NAIP5 independent. It is difficult to compare infections between two different bacterial species when there may be differences in infectivity, translocation levels of flagellin, or flagel-
lin molecules themselves. Thus, to begin to determine if there
is in fact a qualitative difference between Salmonella and Legionella with respect to the activation of NLRC4, we assayed
macrophage cell death at a wide range of MOIs for both
bacterial species (Fig. 3). We centrifuged bacteria onto the
macrophages to minimize differences in infectivity between
motile and nonmotile strains and carefully monitored the infectivity of the various strains by determining gentamicin-resistant cell-associated CFU 1 h after infection. We found that
the infection of macrophages with Legionella causes macrophage cell death in a manner dependent upon both the host
expression of NAIP5 and NLRC4 and the bacterial expression
of flagellin across a broad range of MOIs, from 0.3 to 10 (Fig.
3A). In contrast, we found that Salmonella causes a partially
flagellin-independent cell death at higher bacterial loads (e.g.,
MOI, '2) (Fig. 3A), which is consistent with previous results
(18). As previously described (14), we also found that at these
higher MOIs, Salmonella also induces a partially NAIP5-independent (but NLCR4-dependent) cell death. Some of the
NAIP5-independent death appeared to be flagellin dependent,
but some appeared to be flagellin independent. The flagellindependent activation of NLRC4 could not be explained by a
reduced infectivity of the $fliC Salmonella mutant, since the
CFU per cell were quantified and not found to be significantly
different. Thus, the activation of NLRC4 by Salmonella seems
to be only partially NAIP5 and flagellin dependent. This contrasts with the activation of NLRC4 by Legionella, which was
more uniformly NAIP5 and flagellin dependent.
To further assess the underlying differences in NLRC4 activation between Salmonella and Legionella, we asked whether
the NAIP5-independent death initiated by Salmonella is due to
an intrinsic difference between Legionella and Salmonella
flagellin. Thus, we generated a strain of Legionella that expresses Salmonella flagellin (fliC) in place of its own flagellin.
This strain (LP02 $flaA::fliC) was capable of activating the
NLRC4 inflammasome almost as efficiently as wild-type Legionella (22), and interestingly, it did so in a fully NAIP5-dependent manner (Fig. 3B). In addition, complementing flagellindeficient Legionella with Salmonella fliC restored the
VOL. 79, 2011
REQUIREMENT FOR NAIP5 IN NLRC4 INFLAMMASOME ACTIVATION
1611
FIG. 3. Differential requirement for NAIP5 in sensing Legionella and Salmonella is dictated by the bacterium and not the flagellin itself.
(A) Cell death was assessed by the measurement of lactate dehydrogenase (LDH) release from wild-type (B6), isogenic Naip5#/#, or isogenic
Naip5#/# Nlrc4#/# doubly deficient macrophages infected with either wild-type (WT) Legionella (LP02), isogenic flagellin-deficient Legionella
($flaA), wild-type Salmonella (LT2), or isogenic flagellin-deficient Salmonella (designated LT2 fliC/fljB#). Gentamicin (100 %g/ml) was added 30
min after infection to kill extracellular bacteria. (B) Cell death was assessed by LDH release from B6, Naip5#/#, or Nlrc4#/# macrophages infected
with WT Legionella (LP02), Legionella $flaA, or Legionella expressing Salmonella fliC from the Legionella chromosome in place of its native flaA
gene ($flaA::fliC). Gentamicin (100 %g/ml) was added 30 min after infection to kill extracellular bacteria. (C) IL-1" release assayed from
macrophages infected with the indicated strains, as shown in panel B. Macrophages were pretreated with tripalmitoyl cysteinyl seryl tetralysine
lipopeptide (Pam3CSK4; 0.5 %g/ml) for 3.5 h to induce the expression of pro-IL-1" prior to infection. (D) Growth of $flaA or $flaA::fliC Legionella
in wild-type B6, isogenic Naip5#/#, or isogenic Nlrc4#/# macrophages was assayed by determining the CFU at the time points indicated. *, P )
0.00. Two-way ANOVA and Bonferroni’s test were used to determine the statistical significance (P) of differences in IL-1" and LDH release (B
and C) against infection with $flaA Legionella. For each panel, data shown are from a single representative experiment of at least two that produced
similar results.
Naip5-dependent IL-1" secretion in response to infection with
Legionella (Fig. 3C) and the growth restriction of Legionella
within macrophages (Fig. 3D). Thus, when expressed from
Legionella, Salmonella flagellin activates NLRC4 in an entirely
NAIP5-dependent manner, similarly to Legionella’s own flagellin. For reasons that remain unclear, we were unable to generate a strain of Salmonella that was capable of translocating
Legionella flagellin into host cells. Nevertheless, our data
1612
LIGHTFIELD ET AL.
INFECT. IMMUN.
FIG. 4. Sensing of Salmonella PrgJ is independent of NAIP5. (A) Flow cytometry of wild-type (WT; C57BL/6), isogenic Naip5#/#, or Nlrc4#/#
macrophages transduced with retroviruses expressing N65-GFP, GFP-C65, or Salmonella PrgJ. The PrgJ construct expressed GFP downstream of
an internal ribosome entry site. (B) IL-1" release by wild-type, Naip5#/#, or Nlrc4#/# macrophages transfected with purified Salmonella flagellin
(FliC), PrgJ, or SsaI proteins. (C) Cell death assessed by LDH released from wild-type, Naip5#/#, or Nlrc4#/# macrophages infected with wild-type
Listeria, Listeria expressing PrgJ, or Listeria expressing Legionella FlaA. The expression of PrgJ or FlaA was induced by the addition of the indicated
concentrations of IPTG. *, P ) 0.001. For B and C, two-way ANOVA and Bonferroni’s test were used to determine the statistical significance (P)
of differences in IL-1" and LDH release. Significance tests were done versus WT macrophages or versus both Naip5#/# and WT macrophages when
transfecting with PrgJ (B) or infecting with Listeria expressing PrgJ (C). For each panel, data shown are from a single representative experiment
of at least two that produced similar results.
strongly suggest that there are not intrinsic differences between
the flagellins that underlie the differing abilities of Legionella
and Salmonella to activate the NLRC4 inflammasome independently of NAIP5. These results are consistent with previous
experiments that demonstrated that the C termini of Legionella
and Salmonella flagellin behaved identically in the retroviral
lethality assay (14).
PrgJ activates Nlrc4 in an Naip5-independent manner. Recently, it was reported that Salmonella PrgJ activates NLRC4
(18). PrgJ is an essential inner rod component of the SPI-1 type
III secretion system. Legionella utilizes a type IV secretion
system to translocate flagellin into host cells and lacks both a
type III secretion system and a PrgJ homolog. Thus, one hypothesis to explain the ability of Salmonella to activate NLRC4
independently of NAIP5 is that Salmonella PrgJ can activate
NLRC4 independently of NAIP5. We therefore utilized the
retroviral lethality assay to test whether PrgJ activated NLRC4
independently of NAIP5 (Fig. 4A). We found that in contrast
to the control retrovirus expressing the Naip5-dependent GFPC65 stimulus, the PrgJ-expressing retrovirus was not efficiently
transduced into Naip5#/# macrophages. This result is consistent with PrgJ being an NAIP5-independent activator of
NLRC4; however, the interpretation of the result is complicated by the fact that full-length flagellin itself behaves as an
NAIP5-independent activator of NLRC4 in the retroviral lethality assay (Fig. 1B) (14). Thus, the lack of NAIP5 dependence for PrgJ in the retroviral lethality assay may be due in
part to a peculiarity of the assay (for example, the very high
expression levels obtained from the retroviral promoter).
Therefore, to test whether PrgJ could stimulate NLRC4 inde-
VOL. 79, 2011
REQUIREMENT FOR NAIP5 IN NLRC4 INFLAMMASOME ACTIVATION
pendently of NAIP5, it was necessary to utilize an assay in
which full-length flagellin behaved as an NAIP5-dependent
stimulus. Two such assays were employed. In the first, fulllength recombinant FliC and PrgJ proteins were transfected
into the macrophage cytosol using protein transfection as described previously (17, 18). The activation of NLRC4 was monitored by measuring the NLRC4/CASP-1-dependent release of
IL-1" into the supernatant (Fig. 4B). Although IL-1" release
in response to transfected FliC protein required NAIP5, IL-1"
release in response to PrgJ was nearly entirely NAIP5 independent (Fig. 4B).
In the second assay to assess whether PrgJ is an NAIP5independent activator of NLRC4, we utilized flagellin- and
PrgJ-expressing strains of the Gram-positive bacterium Listeria
to activate NLRC4. Listeria strains engineered to express Legionella flagellin (FlaA) strongly activate NLRC4-dependent
cell death (Sauer et al., submitted). Although the cell death
induced by Listeria flaA was NAIP5 dependent, cell death
induced by Listeria prgJ was entirely NAIP5 independent (Fig.
4C). Thus, we conclude that PrgJ can activate NLRC4 independently of NAIP5.
DISCUSSION
Our results demonstrate that NAIP5 is required for the
activation of the NLRC4 inflammasome only in response to
certain stimuli. These stimuli include infection with Legionella
(expressing Legionella or Salmonella flagellin) or transduction
with a retrovirus expressing the C terminus of flagellin fused to
GFP. Other stimuli, such as constructs expressing both the N
and C termini of flagellin, or PrgJ, appear to activate NLRC4
without a requirement for NAIP5. Lastly, infection with Salmonella activates the NLRC4 inflammasome in a partially
NAIP5-dependent, partially NAIP5-independent manner.
The NLRC4 inflammasome has yet to be reconstituted or
purified, thus the biochemical role of NAIP5 in the activation
of NLRC4 remains poorly understood. Nevertheless, our results indicate that NAIP5 affects the ability of the NLRC4
inflammasome to respond to specific stimuli. There are several
possible models that account for the ability of NAIP5 to regulate the apparent specificity of NLRC4. One model (the potentiation model) is that NAIP5 functions as a potentiator of
NLRC4 activation. In this model, the NLRC4 stimuli that
exhibit a requirement for NAIP5 are intrinsically weak activators of NLRC4 and thus require NAIP5 to activate NLRC4.
For example, the C terminus of flagellin might be poorly structured in the absence of the N terminus of flagellin and therefore may be a relatively poor activator of NLRC4. The presence of NAIP5 could stabilize the C terminus of flagellin and
thus improve its ability to stimulate NLRC4. NAIP5 also might
potentiate NLRC4 responses by acting downstream of flagellin
recognition and act to amplify the NLRC4-dependent activation of CASP-1 in response to a weak stimulus. We found that
the N terminus of flagellin can relieve the requirement for
NAIP5 in NLRC4 activation. In the potentiation model, the N
terminus might function to stabilize the C terminus, thereby
improving its signaling capacity and thus relieving the requirement for NAIP5. A direct biochemical interaction between
flagellin and NLRC4 or NAIP5 has yet to be demonstrated;
thus, these models are difficult to distinguish at present. It also
1613
is not clear whether Legionella is in fact a weaker activator of
NLRC4 than is Salmonella, as would be implied under the
potentiation model. In fact, at similar MOIs, Legionella and
Salmonella appear to induce comparable levels of NLRC4dependent cell death (Fig. 3). It also is not clear whether PrgJ,
an NAIP5-independent activator of NLRC4, is a substantially
stronger activator of NLRC4 than is flagellin. In fact, the transfection of wild-type macrophages with equivalent amounts of
each protein activates NLRC4 similarly, but PrgJ appears to be
a much better activator of NLRC4 specifically in Naip5#/#
macrophages. Thus, it is not clear whether our results can be
readily explained by a model in which NAIP5 functions primarily to potentiate NLRC4 signaling.
Although it is widely assumed that NLRC4 is the proximal
sensor of the ligands that lead to its activation, this has never
been formally demonstrated. In fact, it is possible that NAIP5,
or another host protein, is the true direct cytosolic sensor (or
receptor) of flagellin. Thus, another model to explain our data
is that NAIP5 functions not as a general potentiator of NLRC4
activation/signaling but as a specific sensor of certain bacterial
ligands. We call the latter model the specificity model. For
example, NAIP5 may specifically recognize the C terminus of
flagellin, whereas another host protein may specifically recognize full-length flagellin or PrgJ. This model could explain the
differential NAIP5 dependence for NLRC4 activation by Legionella versus Salmonella, since Salmonella expresses PrgJ, an
NAIP5 independent stimulus, whereas Legionella does not.
The specificity model is difficult to address until direct evidence
is obtained that NAIP5, NLRC4, or another host protein is the
true receptor for flagellin and/or PrgJ.
It was interesting that full-length flagellin delivered by protein transfection or Listeria activated NLRC4 in an NAIP5dependent manner (Fig. 4B and C), whereas full-length flagellin expressed from a retroviral construct activated NLRC4 in
an NAIP5-independent manner (Fig. 1B) (14). Although there
are many possible explanations for this result, one plausible
idea is that the very high levels of flagellin expression attained
via retroviral transduction are responsible for relieving the
requirement for NAIP5. Thus, both the expression levels of the
stimulus and its molecular characteristics may influence the requirement for NAIP5.
Regardless of the underlying molecular mechanism, our
data illustrate the ability of NLRC4 to respond to distinct
bacterial ligands. In future studies, it will be important to
determine the specific molecular role that NAIP5 plays in
NLRC4 activation.
ACKNOWLEDGMENTS
This work was supported by Investigator Awards to R.E.V. from the
Burroughs Wellcome Fund and the Cancer Research Institute as well
as by NIH grants (AI075039 and AI080749). J.P. was supported by
Stiftelsen Olle Engkvist Byggmästare through the Swedish Research
Council. J.-D.S. was supported by the American Cancer Society (PF07-066-01-LIB).
We thank Tom Alber for help with the analysis of the putative coiled
coil in the D0 region of flagellin.
REFERENCES
1. Amer, A., et al. 2006. Regulation of Legionella phagosome maturation and
infection through flagellin and host IPAF. J. Biol. Chem. 281:35217–35223.
2. Bergsbaken, T., S. L. Fink, and B. T. Cookson. 2009. Pyroptosis: host cell
death and inflammation. Nat. Rev. Microbiol. 7:99–109.
1614
LIGHTFIELD ET AL.
3. Boyden, E. D., and W. F. Dietrich. 2006. Nalp1b controls mouse macrophage
susceptibility to anthrax lethal toxin. Nat. Genet. 38:240–244.
4. Coers, J., R. E. Vance, M. F. Fontana, and W. F. Dietrich. 2007. Restriction
of Legionella pneumophila growth in macrophages requires the concerted
action of cytokine and Naip5/Ipaf signalling pathways. Cell Microbiol.
9:2344–2357.
5. Damiano, J. S., V. Oliveira, K. Welsh, and J. C. Reed. 2004. Heterotypic
interactions among NACHT domains: implications for regulation of innate
immune responses. Biochem. J. 381:213–219.
6. Decker, T., and M. L. Lohmann-Matthes. 1988. A quick and simple method
for the quantitation of lactate dehydrogenase release in measurements of
cellular cytotoxicity and tumor necrosis factor (TNF) activity. J. Immunol.
Methods 115:61–69.
7. Fernandes-Alnemri, T., et al. 2010. The AIM2 inflammasome is critical for
innate immunity to Francisella tularensis. Nat. Immunol. 11:385–393.
8. Fischetti, V. A., and American Society for Microbiology. 2006. Gram-positive
pathogens, 2nd ed. ASM Press, Washington, DC.
9. Franchi, L., et al. 2006. Cytosolic flagellin requires Ipaf for activation of
caspase-1 and interleukin 1beta in salmonella-infected macrophages. Nat.
Immunol. 7:576–582.
10. Janeway, C. A., Jr. 1989. Approaching the asymptote? Evolution and revolution in immunology. Cold Spring Harb. Symp. Quant. Biol. 54(Pt 1):1–13.
11. Jones, J. W., et al. 2010. Absent in melanoma 2 is required for innate
immune recognition of Francisella tularensis. Proc. Natl. Acad. Sci. U. S. A.
107:9771–9776.
12. Kim, S., et al. 2010. Listeria monocytogenes is sensed by the NLRP3 and
AIM2 inflammasome. Eur. J. Immunol. 40:1545–1551.
13. Lauer, P., M. Y. Chow, M. J. Loessner, D. A. Portnoy, and R. Calendar. 2002.
Construction, characterization, and use of two Listeria monocytogenes sitespecific phage integration vectors. J. Bacteriol. 184:4177–4186.
14. Lightfield, K. L., et al. 2008. Critical function for Naip5 in inflammasome
activation by a conserved carboxy-terminal domain of flagellin. Nat. Immunol. 9:1171–1178.
15. Mariathasan, S., et al. 2004. Differential activation of the inflammasome by
caspase-1 adaptors ASC and Ipaf. Nature 430:213–218.
16. Martinon, F., K. Burns, and J. Tschopp. 2002. The inflammasome: a molecular platform triggering activation of inflammatory caspases and processing of proIL-beta. Mol. Cell 10:417–426.
Editor: B. A. McCormick
INFECT. IMMUN.
17. Miao, E. A., et al. 2006. Cytoplasmic flagellin activates caspase-1 and secretion of interleukin 1beta via Ipaf. Nat. Immunol. 7:569–575.
18. Miao, E. A., et al. 2010. Innate immune detection of the type III secretion
apparatus through the NLRC4 inflammasome. Proc. Natl. Acad. Sci. U. S. A.
107:3076–3080.
19. Molofsky, A. B., et al. 2006. Cytosolic recognition of flagellin by mouse
macrophages restricts Legionella pneumophila infection. J. Exp. Med. 203:
1093–1104.
20. Ormö, M., et al. 1996. Crystal structure of the Aequorea victoria green
fluorescent protein. Science 273:1392–1395.
21. Rathinam, V. A., et al. 2010. The AIM2 inflammasome is essential for host
defense against cytosolic bacteria and DNA viruses. Nat. Immunol. 11:395–
402.
22. Ren, T., D. S. Zamboni, C. R. Roy, W. F. Dietrich, and R. E. Vance. 2006.
Flagellin-deficient Legionella mutants evade caspase-1- and Naip5-mediated
macrophage immunity. PLoS Pathog. 2:e18.
23. Sauer, J. D., et al. 2010. Listeria monocytogenes triggers AIM2-mediated
pyroptosis upon infrequent bacteriolysis in the macrophage cytosol. Cell
Host Microbe 7:412–419.
24. Schroder, K., R. Zhou, and J. Tschopp. 2010. The NLRP3 inflammasome: a
sensor for metabolic danger? Science 327:296–300.
25. Sun, Y. H., H. G. Rolan, and R. M. Tsolis. 2007. Injection of flagellin into the
host cell cytosol by Salmonella enterica serotype typhimurium. J. Biol.
Chem. 282:33897–33901.
26. Takeuchi, O., and S. Akira. 2010. Pattern recognition receptors and inflammation. Cell 140:805–820.
27. Vance, R. E., R. R. Isberg, and D. A. Portnoy. 2009. Patterns of pathogenesis:
discrimination of pathogenic and nonpathogenic microbes by the innate
immune system. Cell Host Microbe 6:10–21.
28. Warren, S. E., et al. 2010. Cutting edge: cytosolic bacterial DNA activates the
inflammasome via Aim2. J. Immunol. 185:818–821.
29. Yonekura, K., S. Maki-Yonekura, and K. Namba. 2003. Complete atomic
model of the bacterial flagellar filament by electron cryomicroscopy. Nature
424:643–650.
30. Zamboni, D. S., et al. 2006. The Birc1e cytosolic pattern-recognition receptor contributes to the detection and control of Legionella pneumophila
infection. Nat. Immunol. 7:318–325.