Download REGULATION OF STRIATAL MEDIUM SPINY NEURON GABAA

REGULATION OF STRIATAL MEDIUM SPINY NEURON GABAA RECEPTOR
MEDIATED TONIC CURRENT
A Dissertation
Submitted to the Faculty of the
Graduate School of Arts and Sciences
of Georgetown University
in partial fulfillment of the requirements for the degree of
Doctor of Philosophy
in Pharmacology
By
Megan J Janssen Schroeder, B.S.
Washington, DC
July 2, 2010
Copyright 2010 by M. Janssen Schroeder
All Rights Reserved
ii
REGULATION OF STRIATAL MEDIUM SPINY NEURON GABAA RECEPTOR
MEDIATED TONIC CURRENT
Megan J Janssen Schroeder, B.S.
Thesis Advisor: Stefano Vicini, Ph.D.
ABSTRACT
The majority of striatal neurons are GABAergic projecting medium spiny neurons
(MSNs), of which there are two types based on their primary axonal projection pathway
and dopamine receptor expression. MSNs that express the dopamine D2 receptor (D2+)
inhibit the globus pallidus to inhibit movement, while those that express the dopamine D1
receptor (D1+) inhibit the substantia nigra to facilitate movement. Although these
neurons are morphologically and electrophysiologically indistinguishable, D2+ MSNs
express greater GABAergic inhibitory tonic currents than D1+ MSNs in young mice.
In this thesis, I identify putative GABAA receptor subunits that underlie tonic
current in striatal MSNs. Using whole-cell recordings in acute mouse brain slices from
bacterial artificial chromosome transgenic mice where EGFP is driven by the Drd2
promoter and tdTomato protein is driven by the Drd1a promoter, I show that the GABAA
receptor β3 subunit largely regulates tonic current based on phosphorylation state and
dopamine receptor activation. Thus, D2+ MSNs express tonic current through a basally
phosphorylated β3 subunit, while under proper conditions where the β3 subunit becomes
phosphorylated, D1+ MSNs also express tonic current. Indeed, a transgenic mouse with
β3 subunits selectively knocked-out of D2+ MSNs failed to demonstrate the typical tonic
iii
current pattern seen in wild type mice, suggesting that this subunit is particularly
important in mediating tonic current.
In this thesis, I also compare striatal MSNs to a subtype of striatal GABAergic
interneurons that express Neuropeptide Y (NPY +). These neurons have a characteristic
cell-attached firing pattern, making them a likely source for the ambient GABA
necessary for MSN tonic currents. My data suggest that these interneurons receive fewer
inhibitory inputs with different presynaptic origins than MSNs.
My thesis work has revealed important players in striatal tonic current and such
insight offers innumerable pharmacological targets in the treatment of Parkinson‟s
disease, and other striatally relevant diseases, where an imbalance in the D2+ and D1+
MSN projection pathways causes symptomatic akinetic behaviors.
iv
ACKNOWLEDGMENTS
This thesis dissertation has come to fruition due to the support of many
individuals. Each person has either helped to shape my research or my personal skills,
without which this project would not have been completed.
My thesis mentor, Dr. Stefano Vicini, has been extremely instrumental in my
development as a scientist. I am grateful for his excitement when experiments were
successful and his words of encouragement when experiments did not go quite like we
had hoped. I am equally appreciative for the high standards that he expects his students
to meet; I was challenged each and every day, and these challenges have made my
successes even more significant. I am honored to continue working for him as a postdoctoral fellow, as I continue to progress towards becoming an independent scientist.
Dr. John Partridge has also been a tremendous help to me during my time in the
lab. Not only has he answered my many questions, but has also offered the guidance and
constructive criticism to perfect my understanding of, and love for, striatal physiology.
Dr. Kristen Ade introduced me to the wonderful world of GABAergic currents in
striatal MSNs. Although the research has changed and evolved over the years, the project
was originally hers, and she handed it off to me when she completed her PhD, for which I
am grateful.
I am greatly appreciative to the members of my thesis committee. Drs. David
Lovinger, Gerard Ahern, Molly Huntsman, and Barry Wolfe have spent numerous hours
with me, going over data, discussing possible interpretations, and offering constructive
criticisms to my research.
v
I would also like to thank other members, both past and present, of Dr. Vicini‟s
lab: Dr. Zhanyan Fu, Mary Adedoyin, Alfredo Gonzalez-Sulser, and Rupa Lalchandani.
Their friendship has meant so much to me over the years, and made my time in this lab
truly enjoyable and memorable.
My family has been instrumental in my successes, both past and present. My
parents emphasized the importance of education and pursing dreams. Their
encouragement, support, and praise has made me want to work harder and achieve more
each and every day.
Most importantly, I dedicate this dissertation to my husband, Pete. His unvarying
patience, support, love, and encouragement have gotten me through the toughest times of
these past four years, and made the pleasant times even more exciting and meaningful.
vi
TABLE OF CONTENTS
PAGE
ABSTRACT
iii
ACKNOWLEDGEMENTS
v
TABLE OF CONTENTS
vii
LIST OF FIGURES
xii
LIST OF TABLES
xiv
INTRODUCTION
1
I.
GABA Receptor Mediated Inhibition
1
a. Phasic and Tonic Inhibitory Currents
2
b. GABAA Receptor Subunits
5
II.
The Basal Ganglia
7
III.
Striatal Medium Spiny Neurons
11
a. MSN Electrophysiological Characteristics
14
b. GABAA Receptor Subunit Expression in Striatal MSNs
17
Striatal Interneuons
18
a. The Cholinergic Interneuron
18
b. The GABAergic Calretinin-Positive Interneuron
19
c. The GABAergic Fast-Spiking Interneuron
20
d. The GABAergic Low-Threshold Spiking Interneuron
24
V.
Feedforward and Feedback Inhibition
29
VI.
Modulation of Striatal MSNs
31
a. Dopamine
31
IV.
vii
VII.
b. Adenosine
34
Post-translational Modifications of MSN GABAergic Currents
36
a. Receptor Assembly and Membrane Insertion
36
b. Phosphorylation
38
i. Dopamine‟s Influence on Phosphorylation
c. Endocytosis and Recycling
41
45
HYPOTHESIS
50
MATERIALS AND METHODS
51
I.
Animals
51
II.
Cre-lox System
54
III.
Genotyping
55
IV.
Acute Slice Preparation
59
V.
Cell Identification
59
VI.
Whole Cell Recordings
60
VII.
Drugs and Peptides
62
VIII.
Measurement of GABA Currents
63
a. Phasic GABAergic Measurements
63
b. GABAergic Tonic Current Measurements
64
c. Evoked Current Measurements
65
IX.
HEK 293 Cell Culture and Transfection
65
X.
Immunofluorescence and Confocal Imaging
67
XI.
Statistics
68
RESULTS
69
viii
I.
GABAergic Tonic Conductances in Striatal MSNs
69
a. Identification of MSNs in Acute Slice Preparation
69
b. Unique GABAA Receptor Subunits Mediate MSN Tonic Current
72
i. Importance of β Subunit Expression in MSNs
80
ii. Etomidate is Selective for β3 Subunits in Recombinant
Receptors
81
iii. MSNs have Different Etomidate Responses
87
iv. Etomidate does not Affect mIPSC Properties
87
c. PKA Phosphorylation Affects MSN Tonic Conductance
92
i. Intracellular PKA Application Modulates D1+ MSN
BMR-Sensitive Tonic Current
ii. Basal Phosphorylation of β3 Subunits in D2+ MSNs
92
96
iii. sIPSC Properties are Largely Unaffected by PKA and
PKI
101
d. Dopamine Modulation of MSN Tonic Current
102
i. Little Basal Dopamine Present in Acute Slice Preparation 102
ii. Dopamine Receptor Agonists Alter MSN Tonic Current
103
iii. The Link Between Dopamine Receptor Activation,
Phosphorylation, and GABA-Mediated Tonic Current
106
iv. Tonic Current in Adult MSNs
106
v. Dopamine Regulates MSN Excitability
112
vi. Dopamine Receptor Agonists do not Affect sIPSC
Properties
112
ix
e. The Importance of the GABAA Receptor β3 Subunit in MSN
Tonic Tonic Current
115
i. Cre-lox Method Decreases β3 GABAA Receptor Subunit
Expression
115
ii. Conditional β3 Subunit KO Mice Show Enhanced
Lethality
116
iii. Conditional β3 Subunit KO Mice have Decreased Tonic
Current
117
iv. Etomidate Sensitivity in Conditional β3 Subunit KO Mice 121
v. Synaptic Responses in β3 Subunit KO Mice
II.
Characterizing NPY+ Interneurons
122
125
a. Identification of LTS/NPY+ Interneurons in Acute Slice
Preparation
125
b. Intrinsic NPY+ Interneuron Characterization
125
c. GABAergic Signaling in NPY+ Interneurons
129
d. Inhibitory Short Term Plasticity
135
DISCUSSION
144
I.
Summary
144
II.
Etomidate Sensitivity
145
III.
PKA Phosphorylation of GABA Receptor Subunits
147
IV.
Dopamine Receptor Regulation of Tonic Current
149
V.
Potential Role for GABAA Receptor Endocytosis
154
x
VI.
Interpretations of Conditional β3 Subunit KO
156
VII.
Potential GABAA Receptor Composition in Striatal MSNs
158
VIII.
Developmental Regulation of MSN Tonic Current
160
IX.
Functional Implications of Striatal MSN GABAergic Tonic Current
161
X.
Inputs to NPY+ Interneurons
162
XI.
GABAergic Drugs in the Management and Treatment of Movement
XII.
Disorders
164
Implications to Parkinson‟s Disease Research
165
CONCLUSIONS
167
APPENDIX
169
Copyright Permissions
169
REFERENCES
171
xi
LIST OF FIGURES
PAGE
Figure 1. Phasic and Tonic GABAA Receptors Mediate Inhibition
4
Figure 2. Striatal Circuitry
10
Figure 3. Medium Spiny Neuron Characteristics
13
Figure 4. Fast Spiking Interneuron Characteristics
22
Figure 5. Characteristics of Low Threshold Spiking Interneurons
27
Figure 6. PKA Phosphorylation Cascade is Regulated by Dopamine
43
Figure 7. β3 Subunit-Mediated Endocytosis
47
Figure 8. Generation of Conditional β3 Subunit KO Mice using the Cre-Lox System
53
Figure 9. Striatopallidal and Striatonigral Pathways are Distinct
71
Figure 10. Tonic Current Expression in BAC Drd2 EGFP;BAC Drd1a tdTomato
Mice
74
Figure 11. δ Subunits do not Mediate MSN Tonic Current
76
Figure 12. β3 Subunit Expression in Striatal MSNs
79
Figure 13. GABA Dose Response Curves for Recombinant GABAA Receptors
83
Figure 14. Etomidate‟s Direct Effects are Selective for β3 Subunit-Containing
Recombinant Receptors
86
Figure 15. Etomidate Selectively Activates Extrasynpatic Receptors in D2+ MSNs
89
Figure 16. Etomidate does not Affect Striatal Synaptic GABAA Receptors
91
Figure 17. Internal PKA Application Regulates GABA-Mediated Tonic Current
94
Figure 18. D2+ MSNs are Basally Phosphorylated by PKA and PKC
98
xii
Figure 19. Synaptic Receptors are Unaffected by PKA and PKI
100
Figure 20. Dopamine Agonists Alter MSN Tonic Conductance
105
Figure 21. SKF-81297 Increases Etomidate Response in D1+ MSNs
108
Figure 22. Adult Animals have Different Tonic Current Expression
111
Figure 23. Dopamine Receptor Agonists Modulate MSN Excitability
114
Figure 24. Tonic Current Patterns in β3 Subunit KO Mice
119
Figure 25. Synaptic Responses in Drd2-β3 Subunit KO Mice
124
Figure 26. Intrinsic NPY+ Interneuron Characteristics
127
Figure 27. GABA Mediated Synaptic Transmission in NPY+ Interneurons
131
Figure 28. Evoked GABAergic Currents in NPY+ Interneurons and MSNs
134
Figure 29. Short Term Plasticity in NPY+ Interneurons
138
Figure 30. Alterations to Presynaptic Release Probabilities
142
Figure 31. Tonic Conductance is Mediated through a Phosphorylated β3 Subunit
153
xiii
LIST OF TABLES
PAGE
Table 1. PCR Reaction Protocols
56
xiv
INTRODUCTION
I. GABA Receptor Mediated Inhibition
GABA (γ-aminobutyric acid) is the primary inhibitory neurotransmitter in the
adult central nervous system (CNS), and is largely implicated in many developmental
stages, as well as disease states and disorders, ranging from epilepsy to sleep
disturbances. GABA binds to and activates both fast-acting ionotropic GABAA and
GABAC receptors and slower metabotropic G-protein coupled GABAB receptors.
GABAA receptors are pentameric ligand-gated ion channels that undergo a
conformational change upon binding two agonist molecules to allow Cl- and, to a lesser
extent, HCO3- ion flow (Bormann et al, 1987; Kaila, 1994). The inward or outward flow
of these ions is based upon the electrochemical gradient. In mature neurons, the
postsynaptic membrane potential typically becomes hyperpolarized upon receptor
activation due to the inward ionic flow, resulting in reduced neuronal activity. GABAA
receptors are responsible for the majority of GABAergic inhibition in the adult CNS, and
are the GABA receptors investigated in this thesis.
GABAC receptors are ionotropic, chloride-sensitive channels that are related to
the GABAA receptor, but are insensitive to the GABAA receptor antagonist, bicuculline
(Bormann, 2000). GABAB receptors are chloride-independent receptors that mediate
inhibition by heterotrimeric G protein activation. These metabotropic GABAB channels
also regulate cell excitability and are located both pre- and post-synaptically. Presynaptic GABAB receptors serve as autoreceptors and mediate a reduction in calcium
1
currents at the nerve terminal, while post-synaptic GABAB channels activate potassium
channels that hyperpolarize the neuron (Bormann, 1988; Owens & Kriegstein, 2002).
a. Phasic and Tonic Inhibitory Currents
GABAA receptors produce two forms of inhibition based on certain biophysical
features and cell surface location (Figure 1). Receptors in the post-synaptic active zone
experience a rapid increase in GABA concentration due to pre-synaptic vesicular release,
and GABA binding causes ion channel openings. This phasic mode of inhibition is
defined by the short duration (< 1 ms) in which the receptors are exposed to high GABA
concentrations (0.3 - 1 mM) due to rapid reuptake and diffusion away from the synapse
(Nusser et al, 2001; Mozrzymas et al, 2003). Activation of phasic receptors induces
inhibitory postsynaptic currents (IPSCs), characterized by high amplitudes and fast decay
kinetics. Phasic inhibition is essential in setting the temporal window for synaptic
integration (Farrant & Nusser, 2005), and may also generate rhythmic network activities
(Cobb et al, 1995; Huntsman et al, 1999).
GABAA receptors are also located outside the active zone, and play a role in the
slower form of inhibition, tonic inhibition. Continuous, or tonic, activation of these
receptors likely occurs from ambient neurotransmitter (near µM levels) (Tossman et al,
1986) present in the extracellular space that binds to the high affinity extrasynaptic and
perisynaptic GABAA receptors. Although tonic current is small in amplitude, the
persistent inhibition is likely central for modulating cellular excitability (Mody, 2001).
Tonic currents are revealed by their blockade and application of a GABA antagonist that
reduces the amount of current required to keep the membrane potential fixed (holding
2
Figure 1. Phasic and Tonic GABAA Receptors Mediate Inhibition. (A) Single
vesicular release from a presynaptic terminal activates GABAA receptors in the
postsynaptic active zone (yellow). The blue shading indicates the spread of released
GABA. The current trace (below) shows a representative example of a mIPSC, with the
charge transfer colored in green. (B) Action-potential mediated release of multiple
presynaptic vesicles activates both synaptic (yellow) and extrasynaptic (blue) receptors
due to the large spread of GABA, or “spillover.” The current trace (below) shows a
representative example of a sIPSC with the light green showing the resultant charge
transfer with the mIPSC charge transfer superimposed (green). (C) Low concentrations
of ambient GABA fail to activate synaptic receptors, but activate the high-affinity
extrasynaptic receptors (blue) to mediate tonic inhibition. The current trace (below)
shows that application of the GABA receptor antagonist gabazine reduces the holding
current and RMS noise, revealing tonic current. The green shaded area represents the
charge transfer via these extrasynaptic receptors. Reprinted with permission from
Farrant & Nusser, 2005. See Appendix for permission rights.
3
4
current). This decrease in input conductance is also accompanied by a reduction in
current variance due to the reduced number of open GABAA channels (Brickley et al,
1996; Wall & Usowicz, 1997; Glykys & Mody, 2007). By increasing a cell‟s input
conductance, tonic inhibition decreases the size and duration of excitatory postsynaptic
potentials (EPSPs) while narrowing the temporal and spatial window in which synaptic
integration can occur (Semyanov et al, 2004; Farrant & Nusser, 2005).
b. GABAA Receptor Subunits
There are 19 known subunits that comprise the GABAA channel: α1-6, β1-3, γ1-3,
δ, ε, θ, π, and ρ1-3 (Macdonald & Olsen, 1994; Owens & Kriegstein, 2002; Seighart &
Sperk, 2002). Each GABAA receptor typically expresses two α subunits, two β subunits,
and either a δ or γ subunit to form the pentameric channel (McKernan & Whiting, 1996;
Tretter et al, 1997). The subunit composition of a GABAA receptor determines the
channel‟s subcellular location and biophysical properties. Therefore, the extent and type
of inhibition exhibited by a neuron relies heavily on subunit composition.
Although no GABAA subunit appears to have an exclusive synaptic location, α1,
α2, α3, β2, β3, and γ2 subunits are enriched at GABAergic synapses in many brain
regions (Craig et al, 1994; Somogyi et al, 1996; Brünig et al, 2002). Indeed, it has been
shown that the γ2 subunit clusters receptors at the synaptic localization (Essrich et al,
1998; Nusser et al, 1998), although α5βXγ2 receptors are usually located
extrasynaptically (Brünig et al, 2002) and mediate tonic current (Caraiscos et al, 2004;
Prenosil et al, 2006; Ade et al, 2008). Receptors that incorporate the δ subunit appear to
be exclusively present in the extrasynaptic plasma membrane in cerebellar granule cells
5
(Nusser et al, 1998) and hippocampal dentate gyrus cells (Nusser & Mody, 2002; Wei et
al, 2003). δ subunits prefer to form receptors with α6, α4, and β2/β3 subunits (Jones et
al, 1997; Barnard et al, 1998) to mediate tonic inhibition in many brain regions (Nusser &
Mody, 2002; Stell et al, 2003; Cope et al, 2005; Jia et al, 2005; Mangan et al, 2005;
Drasbek & Jensen, 2006; Mtchedlishvili & Kapur, 2006; Glykys et al, 2007).
Although post-synaptic localization of the β subunit has not been well
characterized, immunostaining in cultured hippocampal pyramidal neurons suggests that
β1 GABAA receptor subunits are not synaptically located, while β2/β3 subunits are
present at both synaptic and extrasynaptic locations (Mangan et al, 2005). An additional
study found that α4β2δ GABAA receptors mediate tonic current in dentate gyrus granule
cells (Herd et al, 2008). As β subunit expression may play a unique role in mediating
both types of inhibitory currents because of its phosphorylation capability and potential
changes in biophysical properties (McDonald et al, 1998; see Introduction, Section
VIIb), its expression and function is of central importance in this thesis.
GABAA receptor subunits also dictate GABA sensitivity and other biophysical
properties of the receptor. These properties prime the receptors with characteristics of
phasic or tonic currents. In recombinant GABAA receptors, α subunits dictate much of
the GABA sensitivity; α6 subunits have the highest affinity for GABA (Ducic et al,
1995), a property necessary for receptors in the extrasynaptic space due to low ambient
GABA levels. Additionally, the incorporation of the δ subunit increases GABA affinity
in receptors heterologously expressed in fibroblast cells (Saxena & Macdonald, 1994;
Fisher and Macdonald, 1997). Receptor deactivation and desensitization rates are also
dependent upon subunit composition. α1 subunit-containing receptors have the fastest
6
deactivation rate (Bianchi et al, 2002), whereas γ2 subunit-containing receptor have more
rapid kinetics than δ subunit-containing receptors (Haas and Macdonald, 1999), ideal for
their role in synaptic inhibition. Compared with γ2-containing receptors, αβδ receptors
have slower and less extensive desensitization (Haas & Macdonald, 1999; Bianchi et al,
2001; Bianchi et al, 2002), priming them to generate inhibitory tonic current.
II. The Basal Ganglia.
The basal ganglia are a group of forebrain structures, associated with motor
control and learning, that include the striatum, globus pallidus, substantia nigra, and
subthalamic nucleus. In a complex array of organization, these regions integrate
excitatory input from the cortex and generate a net inhibitory output to the thalamus that
largely dictates motor control and movement (Kreitzer, 2009).
Excitatory input from the cortex and thalamus converge in the largest basal
ganglia structure, the striatum. These connections are topographically complex, such that
an area of the cortex forms more connections in a particular region of the striatum
compared to others (Voorn, 2004). This complex patterning of corticostriatal
connections conditions areas of the striatum for procedural learning. The dorsomedial
striatum receives much of its input from the association cortex, while the dorsolateral
striatum receives most input from the sensorimotor cortex (Brown et al, 1998). The
ventral striatum, also known as the nucleus accumbens (NAc), receives excitatory input
from both the frontal cortex and limbic regions (Voorn, 2004), but can be further divided
into shell and core regions, which also differ in their input. Because the ventral striatum
is not the subject of this thesis, further discussion of the striatum will be referring to the
7
dorsal striatum, although concepts investigated in the dorsal striatum may also be
relevant for ventral striatal pathways.
Another important input structure for the striatal function, the substantia nigra
pars compacta (SNpc), provides the striatum with dopamine. Due to the large
dopaminergic input, the striatum contains the highest density of dopamine receptors in
the rodent brain (Richtand et al, 1995). Although dopamine does not fit the classic
definition of a neurotransmitter, it modulates striatal output from both the “direct” and
“indirect” pathways (Gerfen et al, 1990).
Histochemically, the striatum is often divided into two distinct compartments, the
patch and matrix. Each region is distinct in neuronal connectivity and biochemical
characteristics. The patch, also called striosome, consists of cells surrounded by the
larger matrix of grey matter, and while it receives input from the superficial layers of
layer V of the cortex, deeper areas of layer V and layer VI constitute the primary input to
the matrix (Gerfen, 1992). Patches express high levels of opiate receptors, dopamine
receptor 1 (D1R), Substance P, and tyrosine-hydroxylase reactive fibers (Graybiel &
Ragsdale, 1978; Gerfen, 1992). Acetylcholinesterase-, calbindin-, and somatostatinpositive neurons largely populate the matrix (Gerfen, 1992).
Striatal output is GABAergic and acts to inhibit neurons in other basal ganglia
structures through one of two pathways. Striatal pathways that project to the internal
segment of the globus pallidus (GPi) and the substantia nigra pars reticulata (SNr)
comprise the “direct” pathway, which serves to disinhibit thalamocortical projections and
facilitate movement (Kreitzer & Malenka, 2008). The striatal “indirect” pathway sends
8
Figure 2. Striatal Circuitry. Cartoon depicting the striatal circuitry within the basal
ganglia. The striatum receives excitatory input from the cerebral cortex and thalamus
(green arrows). Striatal neurons are comprised of dopamine D1 receptor (D1+) and
Substance P (SubP) expressing neurons that constitute a direct pathway (blue arrows) that
inhibits the substantia nigra pars reticulata (SNr) and medial globus pallidus (GPm).
Both of these areas are output nuclei of the basal ganglia. The indirect pathway of striatal
neurons (red arrows) consists of dopamine D2 receptor (D2+) and Enkephalin (Enk)
expressing neurons, whose axons terminate in the globus pallidus (GP). GP neurons
project to the subthalamic nucleus (STN), which then projects to the output structures of
the GPm and SNr. Modified and reprinted with permission from Gerfen, 2006. See
appendix for permission rights.
9
10
inhibitory projections to the external segment of the globus pallidus (GPe) and
subthalamic nucleus (STN). The STN is not an output structure, and projects within the
basal ganglia to the GPi and SNpr. Therefore, this pathway inhibits thalamocortical
projections to inhibit movement (Kreitzer & Malenka, 2008). The balance between these
two output pathways ensures proper movement control. Figure 2 attempts to simplify the
complex basal ganglia organization and circuitry.
III. Striatal Medium Spiny Neurons.
Striatal neurons represent a heterogeneous population of neurons that either
release acetylcholine (from Cholinergic interneurons, see Introduction, Section IVa) or
GABA (from GABAergic interneuron and medium spiny neurons). Medium spiny
neurons (MSNs) represent 90-95% of the striatal population (Graveland & DiFiglia,
1985) and nearly equal amounts of MSNs belong to the “direct” and “indirect” pathways
(Gerfen, 2004). MSNs of the “direct” pathway primarily express the dopamine D1
receptor (D1+) and substance P (SubP), while MSNs of the “indirect” pathway primarily
express the dopamine D2 receptor (D2+) and enkephalin (Enk) (Figure 2). In the larger
basal ganglia circuit, D1+ MSN output acts to facilitate movement, while D2+ MSN
output inhibits movement control.
Although the two subtypes of MSNs have distinct output pathways and deliver
opposing messages on movement initiation and control, these neurons are
indistinguishable in size and basic physiology. Anatomically, all MSNs are medium
sized (soma size ranges between 10-20 µm), and their dense dendritic tree is covered with
small bulbular protrusions, called spines (Figure 3A). GABA and dopamine terminals
11
Figure 3. Medium Spiny Neuron Characteristics. (A) Confocal z-stack image of
biocytin injected MSN. Calibration bar: 25 µm. Inset is 1.5 times magnification of the
boxed red region, showing densely spiny dendrites. (B) Representative trace from a
current clamp recording of a striatal MSN with a set holding potential of -70 mV.
Current injection steps are 10 pA. Hyperpolarized current injections show significant
inward rectification (i). Depolarizing current injections to threshold are characterized by
delayed action potential firing (ii). Further depolarizing current injections show
repetitive action potential firing (iii). Scale bars: 20 pA and 500 ms.
12
A
B
iii
ii
i
13
are both found on the spine neck, in a unique position to filter and regulate excitatory
input, which is found on spine heads (Smith et al, 1994). MSN dendritic arborization is
spherical, offering dense local innervation to other MSNs.
The distal dendritic arborization of MSNs receives dense glutamatergic,
excitatory innervation from the cortex and intralaminar thalamus, while modulatory
dopaminergic afferents arise from the SNpc. Glutamatergic synapses primarily act
through excitatory AMPA and NMDA receptors, while dopamine acts through
metabotropic G-protein coupled receptors (GPCRs).
In addition to sending inhibitory projections out of the striatum, some MSNs also
form axon collaterals with other MSNs at distal portions of the dendritic tree (Tunstall et
al, 2002; Czubayko & Plenz, 2002; Taverna et al, 2004; Tepper et al, 2004), forming a
feedback inhibitory network (see Introduction, Section V). These connections allow
neurons of both pathways to influence and be influenced by neurons of the same and
opposite output pathway, adding to their complex circuitry. MSNs also receive inhibitory
input from neighboring GABAergic interneurons that only make connections within the
striatum, constituting an inhibitory feedforward circuitry (see Introduction, Section V).
The inhibitory connections between presynaptic MSNs and interneurons and among
interneurons remain subject for debate (Partridge et al, 2009; Gittis et al, 2010; Planert et
al, 2010), although this issue will be revisited.
a. MSN Electrophysiological Characteristics
Morphologically indistinguishable, striatal D1+ and D2+ MSNs are characterized
by several defining properties including hyperpolarized resting membrane potential
14
(RMP), low input resistance, delayed onset firing patterns, as well as both “up” and
“down” states. Unique potassium channels shape many of these characteristics. At rest,
a striatal MSN‟s membrane potential resides around -80 mV (Yasumoto et al, 2002; Shen
et al, 2005; Ade et al, 2008). Because the MSN RMP resides far from the reversal
potential for Cl- (-60 mV) (Mercuri et al, 1991), much of the GABAergic input results in
membrane depolarization (Kita, 1996; Tunstall et al, 2002; Ade et al, 2008). This
hyperpolarized membrane potential is principally determined by an inwardly rectifying
potassium channel (Kir) (Bargas et al, 1988) where the current magnitude depends on the
voltage difference between the RMP and reversal potential for potassium (Jiang & North,
1991, Nisenbaum & Wilson, 1995). At membrane potentials more negative than the
chloride reversal potential, these channels are open, priming the MSN with unique inward
rectification evoked by hyperpolarized current and low input resistance (Nisenbaum &
Wilson, 1995) (Figure 3Bi). Therefore, Kir channels are thought to shunt the amplitude
of excitatory synaptic input and reduce the efficacy for temporal summation of excitatory
currents (Nisenbaum & Wilson, 1995).
As the MSN membrane potential becomes more depolarized due to a barrage of
excitatory input, Kir channels close and polyamines block the pore (Ficker et al., 1994).
At potentials near -60 mV, transient-outwardly rectifying potassium channels (IAs) open,
and function to slow the depolarization (Bargas et al, 1988; Nisenbaum & Wilson, 1995;
Nisenbaum et al, 1996; Shen et al, 2004). Such Kv1.2 channels (Shen et al, 2004) have
been shown to delay first spike latency in response to depolarized currents and slow the
repetitive spike discharge of these cells (Nisenbaum et al, 1994), which are two
additional MSN characteristics (Figure 3Bii, iii).
15
Lastly, while membrane “up” and “down” states are also regulated by these
potassium channels, they are under direct influence of cortical and thalamic excitatory
input. At rest, the mature MSN displays a hyperpolarized membrane potential (-90 to
-80 mV) due to the Kir channels and the lack of synchronous excitatory input. Upon a
barrage of synchronous excitatory input in vivo, Kir channels close, and the membrane
potential reaches its “up” state, near -55 mV, due to outwardly rectifying potassium
channels. In the “up” state, MSNs are more likely to fire action potentials, and modest
excitatory input has greater impact on MSN firing. Therefore, closure of Kir channels
increases MSN excitability as it allows for easier transitions into the more excitable “up”
state.
The advent of bacterial artificial chromosome (BAC) technology combined with
fluorescent protein labeling has allowed identification of D1+ and D2+ MSNs in acute
striatal slices (Gong et al, 2003; Shuen et al 2008), and has exponentially increased both
investigation into and reliability of MSN subtype studies. These studies showed that in
addition to their different projection patterns, striatonigral and striatopallidal neurons
have different electrophysiological characteristics; D2+ MSNs are significantly more
excitable than D1+ MSNs (Ade et al, 2008; Day et al, 2008; Gertler et al, 2008). In
addition, D1+ and D2+ MSNs express different amounts of GABAergic tonic current.
While young D1+ MSNs express small amounts of tonic current, young D2+ MSNs
express a significant amount of tonic current (Ade et al, 2008; Santhakumar et al, 2010);
this difference in tonic current is likely due to differences in GABAA receptor subunit
expression.
16
b. GABAA Receptor Subunit Expression in Striatal MSNs.
The GABAA receptor subunits expressed in the striatum have been thoroughly
researched for many years with the aid of antibody staining (Liste et al, 1997; Waldvogel
et al, 1997; Pirker et al, 2000; Rodriguez-Pallares et al, 2000; Schwarzer et al, 2001; Ade
et al, 2008), single cell PCR (Flores-Hernandez et al, 2000), and pharmacological
sensitivity (Ade et al, 2008; Santhakumar et al, 2010). Although all studies do not agree
on subunit expression, the striatum stained positive for α1-α5 subunits, all β subunits, as
well as γ2 and δ subunits in a comprehensive GABAA receptor antibody staining study
performed by Pirker et al. (2000). While this study did not address which types of striatal
neurons expressed which subunits, it has been shown that α3 and α6 subunits are not
expressed in MSNs (Liste et al, 1997; Rodriguez-Pallares et al, 2000; Schwarzer et al,
2001), while they do express α2 and β2/β3 subunits (Liste et al, 1997). Although the β
subunit antibody used in that study does not discriminate between β2 and β3 subunits,
single-cell PCR studies suggest that β1 and β3 subunits are expressed by MSNs (FloresHernandez et al, 2000), while β2 subunits appear to be solely expressed on striatal
interneurons (Schwarzer et al, 2001).
The GABAA receptor subunits that mediate tonic current in striatal MSNs have
been an interest in our lab for many years. Ade et al. (2008) showed that receptors
containing α5 and γ2 subunits contribute to tonic current in young mice (p 16-21), while
both α1 and δ subunits do not contribute to MSN tonic current. The β subunit responsible
for MSN tonic current is a central component to this thesis, and I demonstrate that the β3
subunit largely mediates MSN GABAA tonic current in young animals (Janssen et al,
2009).
17
IV. Striatal Interneurons
As indicated by their name, striatal interneurons‟ axons are restricted to the
striatum and form connections with MSNs to modulate network activity and regulate
inhibitory output. Although they only represent a small portion (about 5%) of striatal
neurons, aspiny interneurons can be categorized into cholinergic and GABAergic cells
(Kawaguchi et al, 1995).
a. The Cholinergic Interneuron
Cholinergic interneurons are giant (20-50 µm diameter soma) aspiny
interneurons, representing approximately 2% of all striatal neurons. They express
choline acetyltransferase (ChAT) (Kawaguchi et al, 1995) and release acetylcholine
(Ach) in the striatum. Electrophysiologically, ChAT+ cells are characterized by their
depolarized RMP and high input resistance (Kawaguchi, 1993), as well as a membrane
potential sag in response to hyperpolarizing current injections (Bennett & Wilson, 1998).
Limited cortical and thalamic excitatory input (Meredith & Wouterlood, 1990;
Lapper & Bolam, 1992) at proximal locations along the neuron (Wilson et al, 1990) is
able to produce enough depolarization (1-5 mV) for ChAT+ interneurons to tonically fire
action potentials, giving them the name “tonically active neurons” (TANs) (Zhou et al,
2002). These interneurons also receive GABAergic inputs originating from MSN axon
collaterals (Bolam et al, 1986; Martone et al, 1992; DeBoer & Westerink, 1994; Bennett
& Wilson, 1998) that may influence cell excitability.
Dopamine is also thought to modulate ChAT+ neuronal output due to their
expression of both dopamine D1- and D2- like receptors. Activation of D1-like receptors
18
increases Ach release through depolarization (Aosaki et al, 1998; Damsma et al, 1990;
Consolo et al, 1992), while D2 activation inhibits Ach release (Lehmann & Langer, 1983;
Stoof et al, 1992; Maurice et al, 2004).
Their dendritic arborization offers dense, local innervation, primarily onto MSN
distal dendrites (Bolam et al, 1984; Phelps et al, 1985; Zhou et al, 2002), overlapping
with dopamine terminal fields (Bolam et al, 2000). In addition to synaptic transmission,
these interneurons are also thought to release Ach via volume transmission, which has
been shown to depolarize GABAergic fast-spiking interneurons (Chang & Kita 1992;
Koós & Tepper, 2002; Zhou et al, 2002).
ACh, the output transmitter of ChAT+ interneurons, is thought to alter MSN
activity primarily by acting on M1 and M4 muscarinic receptors located on both types of
MSNs (Hersch et al, 1994, Yan et al, 2001). Activation of these receptors will modulate
voltage-gated ion channels and alter MSN excitability. ACh may reduce striatal
glutamatergic transmission at corticostriatal synapses through presynaptic muscarinic
receptors (Hernández-Echeagaray et al, 1998; Malenka & Kocsis, 1988; Sugita et al,
1991; Calabresi et al, 2000; Pakhotin & Bracci, 2007) and attenuate GABAergic
inhibition of MSNs through postsynaptic nicotinic receptors on GABAergic interneurons
(Koos & Tepper, 2002; Perez-Rosello et al, 2005).
b. The GABAergic Calretinin-Positive Interneuron
The least well described type of striatal GABAergic interneuron expresses
calretinin (CR), a calcium binding protein, and GAD67, an enzyme used in GABA
synthesis (Kubota et al, 1993). However, no other biochemical marker is expressed to
19
allow differentiation of these neurons, and they have not been described
electrophysiologically. Immunostaining has revealed that CR+ interneurons are medium
sized, and contain few aspiny, infrequently branched, dendrites (Bennett & Bolam, 1993).
In the rodent, these cells account for less than 1% of striatal neurons (Tepper & Bolam,
2004), but are the most abundantly expressed interneuron in the human striatum
(Cicchetti et al, 1998). Human striatal immunochemistry shows that CR is also expressed
in a subset of large, cholinergic interneurons (Cicchetti et al, 1998) further compounding
the role of CR+ interneurons in striatal physiology.
c. The GABAergic Fast-Spiking Interneuron.
A second type of aspiny striatal GABAergic interneuron, which expresses the
calcium binding protein parvalbumin (PV) (Gerfen et al, 1985), has been characterized
biochemically and electrophysiologically. In addition to expressing PV, these neurons
also express GAD67 and the Kv3.1 potassium channel (Chesselet & Robbins, 1989; Lenz
et al, 1994).
These neurons are also called fast-spiking (FS) interneurons, based on their firing
patterns evoked by depolarization. Just above threshold, FS interneurons fire several
spikes in bursts, followed by a quiescent period (Kawaguchi, 1993; Koós & Tepper,
1999; Kubota & Kawaguchi, 2000), a pattern also known as “stuttering” (Figure 4A).
With stronger depolarization, these interneurons fire repetitively with frequencies around
200 Hz (Koós & Tepper, 1999; Plotkin et al, 2005; Taverna et al, 2007) with largeamplitude afterhyperpolarizations and abrupt peaking (Koós & Tepper, 1999). These
neurons are also characterized by their low input resistance and RMPs that are more
20
Figure 4. Fast Spiking Interneuron Characteristics. (A) Representative trace from a
current clamp recording of a striatal FS/PV+ interneuron with a set holding potential of 60 mV. Current injection steps are 10 pA. Upon depolarizing current injections at
threshold, FSI fire action potentials in bursts followed by a short quiescent period. Scale
bars are 20 pA and 500 ms. (B) Biocytin injected FS/PV+ interneuron from rat.
Calibration bar: 25 µm. Panel B reprinted with permission from Planert et al, 2010.
See appendix for permission rights.
21
A
B
22
negative than other striatal interneurons (approximately -75 mV) (Kawaguchi, 1993;
Kubota & Kawaguchi, 2000; Taverna et al, 2007). Because these interneurons are
identified by both biochemical and physiological characteristics, they will be called
FS/PV+ interneurons for the entirety of this thesis.
Morphologically, these cells‟ somata are slightly larger than MSNs, averaging 17
μm in diameter (Kita et al, 1990; Kawaguchi et al, 1995). Their aspiny dendrites form a
restricted, yet compact and elaborate, arborization (Cowan et al, 1990; Kawaguchi, 1993)
(Figure 4B). Electron microscopy studies have shown that FS/PV+ cells form synaptic
connections on the soma and proximal dendrites of MSNs (Kita et al, 1990; Kubota &
Kawaguchi, 2000) and other FS/PV+ interneurons (Kita et al, 1990; Chang & Kita,
1992). These findings have been confirmed electrophysiologically, indicating that
FS/PV+ interneurons synaptically innervate MSNs (Taverna et al, 2007; Gittis et al,
2010) and other FS/PV+ interneurons (Gittis et al, 2010). In addition to the classical
chemical synapse, FS/PV+ interneurons have also been shown to form gap junctions, or
electrical synapses, with other FS/PV+ interneurons (Kawaguchi et al, 1995; Gibson et al,
1999; Koos & Tepper 1999; Hjorth et al, 2009; Galarreta & Hestrin 2001), suggesting
that they integrate excitatory input on a much larger scale than the single cell.
FS/PV+ cells receive cortical excitatory input onto their soma and proximal
dendrites (Plotkin et al, 2005), while cortical-MSN asymmetric synapses are formed on
distal dendritic spines (Bennett & Bolam, 1994). In addition, these interneurons receive
multiple contacts from a single corticostriatal axon within a short distance (Ramanathan
et al, 2002; Plotkin et al, 2005), priming the FS/PV+ interneuron with more powerful
excitatory input than the MSN. Paired recordings with a presynaptic MSN and a
23
postsynaptic FS/PV+ cell have not found MSN-FS/PV+ connections (Koós & Tepper
1999; Taverna et al, 2007), suggesting that inhibitory input on the FS/PV+ cells originate
from other striatal interneurons. Inhibitory pallidal axons may provide inhibitory input to
striatal interneurons (Bevan et al, 1998; Bolam et al, 2000). A subpopulation of neurons
originating in the globus pallidus project to the striatum and were anatomically shown to
form synaptic contacts with PV+ interneurons (Bevan et al, 1998), although these results
have not been electrophysiologically verified.
Dopamine D5 (D1-like) and D2 receptors are also expressed on FS/PV+
interneurons. Dopamine mediates the depolarization of FS/PV+ cells via postsynaptic
D5 receptors, while presynaptic D2 receptors are known to decrease inhibitory synaptic
input onto these cells (Bracci et al, 2002). As described previously, FS/PV+ interneurons
also receive cholinergic input that depolarizes the postsynaptic cell through nondesensitizing nicotinic receptors (Chang and Kita, 1992; Koós & Tepper, 2002).
d. The GABAergic Low-Threshold Spiking Interneuron.
The third type of striatal GABAergic interneuron co-expresses neuropeptide Y
(NPY), somatostatin (SS), nitric oxide synthase (NOS), and NADPH diaphorase
(Figueredo-Cardenas et al, 1996), and represents approximately 1-2% of striatal neurons
(Kawaguchi et al, 1995). These aspiny interneurons were first electrophysiologically
characterized by Dr. Kawaguchi, and based on their firing pattern are called persistent
low thresholding spiking (PLTS) neurons due to their persistent depolarizing spikes in
response to depolarizing current injection (Kawaguchi, 1993). Further studies revealed
another type of striatal interneuron, similar to the PLTS, but that lacks the persistent
24
depolarization (Koós & Tepper, 1999). These cells were named low-threshold spiking
(LTS) cells. Electrophysiological characteristics between the PLTS and LTS cells are
similar, with a relatively depolarized RMP compared to FS/PV+ interneurons and MSNs,
large input resistance, and action potential firing to small depolarizing current injections
(Kawaguchi, 1993; Koós & Tepper, 1999; Kubota & Kawaguchi, 2000). These cells are
also prone to firing “rebound spikes” after cessation of hyperpolarizing current pulses
(Kawaguchi, 1993) and a time dependent Ih voltage sag during hyperpolarization
(Kawaguchi, 1993; Koós & Tepper, 1999; Tepper et al, 2008) (Figure 5A). Because
these interneurons are identified by both biochemical and physiological characteristics,
they will be called LTS/NPY+ interneurons for the entirety of this thesis, although these
cells co-express other peptides and have other physiological characteristics.
Morphologically, LTS/NPY+ interneurons‟ soma is somewhat larger than that of
a MSN (approximately 18 µM in diameter) (Kawaguchi, 1993; Kubota & Kawaguchi,
2000). Their aspiny dendrites radiate longitudinally with infrequent branching
(Kawaguchi, 1993) (Figure 5B). These cells target the dendrites of spiny neurons, with
smaller synaptic junctional areas (a morphological measure of postsynaptic receptor
number) than FS/PV+ cells (Kubota & Kawaguchi, 2000).
These LTS/NPY+ striatal interneurons receive their excitatory drive from the
cortex (Vuillet et al, 1989), but the origin of their inhibitory drive remains poorly
understood. Like FS/PV+ interneurons, LTS/NPY+ cells may also receive inhibitory
inputs from the globus pallidus (Bevan et al, 1998), although it has not yet been shown
electrophysiologically. In addition, LTS/NPY+ cells may be electrically coupled like
striatal FS/PV+ interneurons (Kawaguchi, 1995; Koós & Tepper, 1999; Galarreta &
25
Figure 5. Characteristics of Low Threshold Spiking Interneurons. (A) Representative
trace from a current clamp recording of a striatal LTS/NPY+ cell with a set holding
potential of -60 mV. Current injection steps are 10 pA. Small depolarizing current
injections are sufficient for LTS/NPY+ interneuron action potential firing (i). At
cessation of hyperpolarizing current injection steps, LTS/NPY+ cells often have rebound
firing (ii). Upon hyperpolarizing current injections, LTS/NPY+ cells display a voltage
sag (iii). Scale bars are 40 pA and 1 s. (B) Z-stack image of biocytin injected NPYexpressing, LTS interneuron with long apical dendrites. Calibration bar: 50 µm.
26
A
B
i
ii
iii
27
Hestrin, 2001) and neocortical LTS neurons (Gibson et al, 1999), providing an added
layer of complexity to their physiology.
Paired recordings have shown that these striatal interneurons may participate in
feedforward inhibition with MSNs (Koós & Tepper, 1999), although other studies have
been unable to find traditional synaptic connections between these two types of cells, or
any other striatal neuron (Gittis et al, 2010). These conflicting results will need to be
fleshed out to more fully understand the role of LTS/NPY+ cells in striatal physiology.
Dopamine D1Rs are also expressed on LTS/NPY+ interneurons (Rivera et al,
2002), and activation of these receptors has been shown to increase action potential firing
through a membrane depolarization (Centonze et al, 2002).
Upon stimulation, these cells are thought to also co-release nitric oxide (NO), SS,
and NPY, and therefore can regulate brain physiology aside from inhibitory
neurotransmission (Kawaguchi et al, 1995; Fu & van den Pol, 2007). NO is known to
promote vasodilation, and therefore, LTS/NPY+ cells are likely to control striatal blood
flow (Kelly et al, 1994). In addition, NO may act on ion channels and modulate the
release of striatal neurotransmitters (Manzoni et al, 1992; Kawaguchi et al, 1995). A
recent study showed that neocortical interneurons with similar biochemical and
electrophysiological characteristics are inhibited by both NPY and SS application,
suggesting an intrinsic control in LTS/NPY+ excitability (Fu & van den Pol, 2007).
28
V. Feedforward and Feedback Inhibition.
Both GABAergic interneurons and MSNs provide striatal MSNs with local
synaptic GABAergic input. The feedforward circuit of striatal inhibition consists of
GABAergic interneurons which synaptically inhibit both D1+ and D2+ MSNs, while the
feedback circuit with MSN lateral connections provides substantially less GABAergic
input to MSNs (Planert et al, 2010).
Anatomical studies show that both FS/PV+ and LTS/NPY+ interneurons form
symmetric synapses with spiny cells (Koós & Tepper, 1999). The synaptic connections
between FS/PV+ cells and MSNs are more widely studied than those connections
between LTS/NPY+ cells and MSNs, and therefore much of the current knowledge
regarding feedforward inhibition relies on the FS/PV+ type of interneuron. Extensive
research with immunostaining, single cell filling, and paired recordings has shown that
the predominant target of FS/PV+ cells is the soma and proximal dendrites of MSNs
(Kita et al, 1990; Bennett & Bolam, 1994; Koós & Tepper, 1999; Kubota & Kawaguchi,
2000; Taverna et al, 2007). Paired recordings have shown high connection rates between
these cell types and that single evoked spikes in FS/PV+ cells can evoke large IPSCs in
connected MSNs, decreasing the transitory MSN firing rate (Koós & Tepper, 1999; Koós
et al, 2004; Gustafson, et al 2006; Gittis et al, 2010). Two recent studies independently
investigated FS/PV+ interneuron input onto both types of MSNs, and found that these
interneuron target both D1+ and D2+ MSNs (Gittis et al, 2010; Planert et al, 2010).
Because spiny cells receive inhibitory inputs from as many as 27 FS/PV+ interneurons
and one FS/PV+ cell may be connected to 130 MSNs (Koós & Tepper, 1999),
29
feedforward inhibition is both powerful and widespread, regulating striatal output of both
pathways.
When LTS/NPY+ cells‟ connections onto MSNs were studied, presynaptic spikes
evoked IPSCs with a high failure rate in the postsynaptic MSN, suggesting few
connections between these cell types (Koos & Tepper, 1999; Gittis et al, 2010). Further
insight between LTS/NPY+ and MSN connections will be offered below (see Discussion,
Section X).
GABAergic inhibition onto MSNs through MSN axon collaterals, also known as
feedback inhibition, was once widely thought to provide the majority of inhibition onto
MSNs because the major contact of MSN collaterals is other MSNs (Wilson & Groves,
1980; Somogyi et al, 1982; Bolam et al, 1983). These axons form synapses with MSN
distal dendrites (Wilson & Groves, 1980), a poor location for extensive control, and it is
currently thought that feedback inhibition does not provide the majority of GABAergic
inhibition in spiny cells. In recent years, paired recordings between MSNs show synaptic
connections, albeit small and with a high failure rate (Czubayko & Plenz, 2002; Tunstall
et al, 2002; Koós et al, 2004; Taverna et al, 2004; Venance et al, 2004; Gustafson et al,
2006; Planert et al, 2010). These studies also found that MSN-MSN synaptic
connections were unidirectional (Tepper et al, 2008). A brief hyperpolarization in a
presynaptic MSN has been shown to delay action potential firing in a postsynaptic MSN
(Koós & Tepper, 1999), and therefore feedback inhibition may function to help
synchronize neuronal population activity (Plenz, 2003) or provide strong effects on local
dendritic processing.
30
Immunostaining with SubP and Enk initially showed that D1+ and D2+ MSNs
formed connections with each other (Bolam et al, 1983; Yung et al, 1996), but more
comprehensive studies have shown that D1+ MSNs primarily form synapses with other
D1+ MSNs, whereas D2+ MSNs form unidirectional connections with both types of
MSNs (Taverna et al, 2008; Planert et al, 2010). Taverna et al. (2008) also showed that
synapses with presynaptic D2+ MSNs are stronger due to the number of postsynaptic
receptors that these synapses target, suggesting that the connectivity between MSNs is
highly ordered and systematic in controlling output.
The presence of gap junctions among MSNs is controversial as some groups have
seen evidence for such coupling (Czubayko & Plenz 2002; Venance, 2004), while others
have not (Taverna et al, 2008; Koós et al, 2004; Taverna et al, 2004; Tecuapetla et al,
2007). Although the age of mice may influence the presence or absence of electronic
coupling, the role of gap junctions among striatal MSNs remains unknown. Therefore,
although the majority of GABAergic contacts onto MSNs are made from axon
collaterals, the primary source of GABA input comes from local GABAergic
interneurons.
VI. Modulation of Striatal MSNs
a. Dopamine
Dopamine‟s importance in proper striatal function is sufficiently illustrated by the
detrimental effects of Parkinson‟s disease (PD), where the degeneration of dopaminergic
cells in the SNpc results in dopamine loss in the striatum. Because dopamine receptors
31
are GPCRs, receptor activation leads to numerous downstream effects through various
second messenger systems (see Introduction, Section VIIbi). Early studies investigated
dopamine‟s regulation of MSN excitability, showing that D1 receptor (D1R) activation
decreases spike activity in response to current injections (Uchimura et al, 1986; Akaike et
al, 1987; Calabresi et al, 1987), while D2 receptor (D2R) activation enhances (Uchimura
et al, 1986; Akaike et al, 1987) or suppresses MSN firing (Hooper et al, 1997). Although
dopamine receptor agonists may not significantly alter D1+ or D2+ striatal MSN RMP,
(cf. Uchimura et al, 1986 and Calabresi et al, 1987; Onn et al, 2003), many studies have
investigated dopamine‟s influence on individual ionic currents, which may ultimately
affect cell excitability (reviewed in Nicola et al, 2000).
D1R agonists have been shown to decrease peak Na+ currents (Zhang et al, 1998;
Surmeier et al, 1992; Schiffmann et al, 1995) and increase rectifying Kir2 currents
(Pacheco-Cano et al, 1996), which set the RMP of striatal MSNs (Mermelstein et al,
1998). D1R activation has also been shown to increase L-type Ca2+ currents (Surmeier et
al, 1995; Song & Surmeier, 1996; Hernández-López et al, 1997; Nicola et al, 2000),
while decreasing P/Q/N- type Ca2+ currents (Surmeier et al, 1995; Salgado et al, 2005).
These modulations underlie D1R activation‟s ability to promote the “down” state of MSN
RMP, reducing cell excitability. However, at subthreshold membrane potentials, the
increased L-type Ca2+ currents may promote D1+ MSN excitability.
D2R mediated changes to MSN ionic conductances are less clear, as the predicted
effects (opposite to those of D1Rs) are not often seen. For example, Na+ channels can be
enhanced or suppressed by D2R agonists (Surmeier et al, 1992; Perez et al, 2006). It has
also been shown that D2R agonists suppress L-type Ca2+ channel currents (Olson et al,
32
2005; Salgado et al, 2005), decreasing D2+ MSN excitability (Hernández-López et al,
2000), further compounding original theories of D2R function in striatal MSN
physiology. A recent computational study included these alterations to ion channels, and
the resultant model suggested that dopamine decreases the excitability of D2+ MSNs,
while increasing D1+ MSN excitability (Moyer et al, 2007).
Dopamine‟s effect on inhibitory neurotransmission is not completely understood.
In general, D1R agonists increase GABAergic transmission (Harsing & Zigmond 1997;
Radniknow & Misgeld, 1998; Arias-Montaño et al, 2007; Tecuapetla et al, 2007), while
D2R agonists decrease inhibitory current (Delgado et al, 2000; Cooper & Stanford, 2001;
Momiyama & Koga, 2001; Centonze et al, 2002; Guzmán et al, 2003; Tecuapetla et al,
2007) onto both D1+ and D2+ MSNs via a presynaptic mechanism (Tecuapetla et al,
2009). However, one study found that dopamine does not alter inhibitory currents in the
dorsal striatum (Nicola & Malenka, 1998), suggesting that general statements about
dopamine‟s influence over GABA currents are too simplistic. Indeed, dopamine may
modulate both pre- and post-synaptic receptors, adding to the confusion over their effects
on GABAergic currents.
Further evidence of dopamine‟s role in the striatum comes from animal models of
dopamine depletion. MSN excitability is enhanced when animals are subjected to
dopamine depletion (Fino et al, 2007; Azdad et al, 2009); this modulation was attributed
to a decrease in inactivating potassium currents, which play an important role in MSN
repetitive spiking characteristics (Azdad et al, 2009). However, these studies did not
differentiate between D1+ and D2+ neurons, which are likely to respond differently to
dopamine depletion. Other studies have shown specifically that D2+ MSN excitability is
33
increased by dopamine depletion (Day et al, 2006; Day et al, 2008; Mallet et al, 2006;
Shen et al, 2007). In addition, dopamine depletion has been shown to markedly increase
glutamatergic input onto MSNs (Calabresi et al, 1993), while the inhibitory connections
between MSNs decreases (Taverna et al, 2008), suggesting further implications in
dopamine modulation in striatal MSN connectivity.
b. Adenosine
Adenosine is produced locally in the striatum, and therefore is an intrinsic
signal/modulator for striatal function. With increased workload and cellular firing,
intracellular ATP becomes dephosphorylated, causing adenosine levels to rise.
Membrane transporters move the intracellular adenosine into the extracellular space
where adenosine is able to modulate striatal function (Mori & Shindou, 2003; Schiffmann
et al, 2007) by activating A1 and A2A receptors. Additionally, neuronal firing activates
vesicular release of ATP (Cunha, 2001), and offers another mechanism to increase
adenosine levels at the synapse. A1 receptors are found throughout the brain, while A2A
receptors are found primarily in the striatum, nucleus accumbens, and the olfactory
tubercle (Jarvis et al, 1989). Striatal A1 receptors are known to colocalize with D1Rs in
striatonigral MSNs, while A2A receptors colocalize with D2Rs in striatopallidal MSNs
(Fink et al, 1992; Schiffmann & Vanderhaeghen, 1993; Augood et al, 1994;
Svenningsson et al, 1997). In these unique locations, adenosine and dopamine receptors
have antagonistic functions because A1 receptors are inhibitory (D1Rs are faciliatory)
and decrease presynaptic release, while A2A receptors have faciliatory actions (D2Rs are
inhibitory) (Ferré et al, 1991; Ferré et al, 1997).
34
In addition, both A1 and D1 receptors and A2A and D2 receptors are thought to
form heteromeric complexes (Ginés et al, 2000; Hillion et al, 2002; Canals et al, 2003;
Ciruela et al, 2004), and intermembrane interactions may further antagonize receptor
signaling. Studies have shown that stimulation of A1 receptors decreases dopamine‟s
binding affinity to D1Rs (Ferré et al, 1998; Ginés et al, 2000). Similarly, A2A
stimulation decreases dopamine‟s binding to the D2R (Ferré et al, 1991).
Although the majority of A2A receptors are located post-synaptically (Rosin et al,
2003), adenosine modulates both excitatory and inhibitory transmission in the striatum.
Intrastriatal stimulation in the presence of A2A agonists decreases evoked IPSCs in D2+
neurons (Mori et al, 1996), whereas agonists enhance GABA release in the GP through
pre-synaptic mechanisms in striatopallidal terminals (Floran et al, 2005). Stimulation of
presynaptic A2A receptors at glutamate terminals has been shown to increase glutamate
release (Popoli et al, 1995; Rosin et al, 2003), whereas postsynaptic receptors reduce the
amplitude of excitatory currents in D2+ MSNs (Nörenberg et al, 1997).
In periods of high activity, adenosine provides additional fine-tuning in striatal
function by increasing the efficiency of excitatory transmission in striatopallidal neurons.
However, when considering striatal modulating transmitters, it is crucial to not only
evaluate dopamine and adenosine, but the effects of their antagonistic, and complex,
signaling.
For the studies presented in this thesis, adenosine receptor activation is not
considered although previous work in our lab has shown that A2A receptors are active in
our striatal slice preparation (Ade, unpublished observations), and other studies have
shown effects with A1 receptor antagonists (Choi & Lovinger, 1995).
35
VII.
Post-translational Modifications of MSN GABAergic Currents.
Post-translational modifications can alter receptor number and spatial orientation,
as well as receptor biophysical properties. These modifications are essential to inhibitory
network efficiency, and are a critical component in understanding the basic physiology of
GABAA receptors. Although many of the experiments referenced here were not
conducted in the striatum, these concepts may be generalized to the striatum, where
similar events are likely to occur.
a. Receptor Assembly and Membrane Insertion
Receptor assembly begins in the endoplasmic reticulum where individual subunits
interact to form heteromeric channels that typically contain 2α-, 2β-, and 1γ-subunits
(Moss & Smart, 2001; Lüscher & Keller, 2004). Subsequent expression in the plasma
membrane relies on the interplay of several key anchoring and receptor targeting
proteins. The protein Plic-1 has been shown to enhance membrane insertion by
increasing the half-life of intracellular pools of GABAA receptors and inhibiting receptor
degradation (Bedford et al, 2001; Saliba et al, 2008). Blocking the interactions between
Plic-1 and GABAA receptors has been shown to decrease GABAA receptor mediated
currents (Bedford et al, 2001), presumably through a decrease in receptor insertion into
the plasma membrane.
Surface transport and synapse targeting is another area in which the GABAA
receptor is under tight regulation by proteins such as the GABAA receptor-associated
protein (GABARAP). This protein binds specifically in the intracellular domain of γ
GABAA receptor subunits (Nymann-Anderson et al, 2002) and has been shown to play an
36
important role in membrane trafficking as well as anchoring a receptor to the
cytoskeleton (Kittler & Moss, 2003).
Once receptors arrive at the synapse, additional proteins provide receptor stability
within the plasma membrane. The majority of inhibitory synaptic targeting is thought to
depend on potential interactions between the γ2 receptor subunit and the gephyrin protein
(Kneussel & Betz, 2000; Jacob et al, 2005), as deletion of subunit or protein disrupts the
number of receptors that reach the cell surface (Essrich et al, 1998; Kneussel et al, 1999).
Therefore, intracellular and cell-membrane mediated GABAA receptor stability is
dependent upon various proteins that help to maintain the efficiency of fast synaptic
inhibition.
It has been suggested that receptor insertion primarily occurs at extrasynaptic sites
(Lüscher & Keller, 2004; Bogdanov et al, 2006), and GABAA receptors may utilize
lateral mobility to increase synaptic receptor numbers in the post-synaptic zone
(Bogdanov et al, 2006; Bannai et al, 2009). Indeed, unique receptor binding studies
showed that when synaptic receptors were blocked, extrasynaptic receptors diffused
through the plasma membrane to become functional „synaptic‟ receptors (Thomas et al,
2005). The investigators also found that this lateral mobility only takes approximately
two minutes for extrasynaptic receptors to move into synaptic locations (Thomas et al,
2005), suggesting that receptor diffusion may provide a means for receptor number
consistency and maintaining homeostasis.
37
b. Phosphorylation
Kinases are a group of proteins that catalyze the phosphorylation of many
proteins. This constitutively active intracellular process involves the transfer of ATP‟s
highly charged phosphate group to the hydroxyl group on a serine or threonine residue.
Hydrolysis of the phosphate group is aided by a phosphatase. The protein‟s charge is
altered after phosphorylation, often resulting in a conformational change and changes in
protein activity. Biochemical studies have shown that various protein kinases target ion
channels, and therefore a great number of studies have been devoted to determining the
effects and implications to GABAA receptor phosphorylation.
Biochemical studies have shown that GABAA receptor subunits can be
phosphorylated by 3'-5'-cyclic adenosine monophosphate (cAMP) dependent kinase
(PKA) (Heuschneider & Schwartz, 1989), Ca2+/phospholipid-dependent protein kinase
(PKC) (Sigel & Baur, 1988), type II Ca2+/calmodulin-dependent protein kinase (Machu
et al, 1993), and protein tyrosine kinase (Moss et al, 1995). This thesis will only focus on
PKA and PKC actions because most of the phosphorylation studies on striatal GABAA
receptors have shown effects with these two kinases.
PKA becomes activated when cAMP binds to the inactive form of the kinase
which frees the catalytic subunit from the regulatory domains. PKC, on the other hand, is
activated when Ca2+ binds to the kinase‟s regulatory domain, separating it from the
catalytic domain. Protein phosphatase 1 (PP-1) and calcineurin are phosphatases that
have been shown to inhibit both PKA and PKC activity in vitro (Surmeier et al, 1995;
Yan & Surmeier, 1997; Flores-Hernandez et al, 2000; Foster et al, 2003; Hourez et al,
2005), providing additional regulation to the phosphorylation cascade. PP-1 also controls
38
the phosphorylation state of many other phosphoproteins including receptors, ion
channels, and transcription factors.
PKA phosphorylates serine residues (S) in β1 (S409) and β3 (S408/9) GABAA
receptor subunits, while the β2 subunit is not phosphorylated by this kinase (McDonald et
al, 1998). PKC targets all GABAA receptor β subunits on a conserved serine residue
(S409 in β1 and β3 subunits and S410 in β2 subunits) in the intracellular domain
(McDonald et al, 1998). This latter kinase has also been shown to phosphorylate γ2
GABAA receptor subunits on S327 (Moss et al, 1992a).
The mechanisms behind PKA phosphorylation appear to rely on key signaling
scaffold molecules because PKA itself is unable to directly bind to the GABAA receptor
subunits (Brandon et al, 2003). AKAP79/150, a neuronal A-kinase anchoring protein,
has been shown to bind to PKA as well as both β1 and β3 subunits, effectively targeting
PKA to these GABAA receptor subunits (Brandon et al, 2003). Similar studies have
shown that PKC is able to bind directly and, with the help of the receptor for activated C
kinase (RACK-1), to target β residues (Brandon et al, 1999). Because RACK-1 is not
necessary for PKC to bind to these subunits, it may increase affinity between kinase and
subunit (Brandon et al, 1999).
GABAA receptor function is altered by PKA phosphorylation, although its effects
on GABAA receptors appears diverse, since some studies show an enhancement in
GABAergic whole-cell currents (Kano & Konnerth 1992; Feigenspan & Bormann, 1994;
Veruki & Yeh, 1994; Kapur & Macdonald, 1996; Nusser et al, 1999), while others show
inhibition (Porter et al, 1990; Moss et al, 1992b; Robello et al, 1993; Brünig et al, 1999).
These discrepancies are likely due to the varying brain regions investigated since GABAA
39
receptor β subunit expression differs throughout the brain. Indeed, PKA‟s effects on β1
and β3 GABAA receptor subunits are quite different. PKA increases whole-cell GABAA
currents in cells expressing the β3 subunit (McDonald et al, 1998; Nusser et al, 1999),
while phosphorylation of the β1 subunit decreases whole-cell GABAA currents (Moss et
al, 1992b; Flores-Hernandez et al, 2000). Mutation of S408 to an uncharged alanine
residue on the β3 subunit showed effects of phosphorylation similar to those seen with
the β1 subunit, suggesting that distinct phosphorylated serine residues underlie the
functional differences in β subunit phosphorylation (McDonald et al, 1998). It has also
been found that β3 subunits exhibit basal phosphorylation by PKA (McDonald et al,
1998; Poisbeau et al, 1999; Brandon et al 2003), which may also be due to the additional
phosphorylation site on the β3 subunit.
PKC‟s effects on GABAA receptors‟ functional activity are also confounded as
PKC has been shown to enhance (Poisbeau et al, 1999; Choi et al, 2008) and inhibit
GABAA receptors (Brandon et al, 2000; Brussaard et al, 2000; Filappova et al, 2000;
Herring et al, 2005).
Although GABAA receptor phosphorylation may affect cell surface expression,
and changes in receptor levels may modulate inhibitory conductance (see Introduction,
Section VIIc), short-term effects of phosphorylation have also been noted. PKA
phosphorylation of GABAergic currents has been shown to decrease mIPSC amplitude in
cortical granule cells (Poisbeau et al, 1999) and cerebellar Purkinje cells (Kano &
Konnerth, 1992), but increase it in olfactory granule neurons (Nusser et al, 1999); these
differences are likely due to β subunit expression. On the other hand, many studies have
shown that PKC phosphorylation increases mIPSC amplitude (Poisbeau et al, 1999;
40
Jovanovic et al, 2004; Terunuma et al, 2008) and tonic current (Choi et al, 2008) in
cortex and hippocampus.
Many studies suggest that phosphorylation may alter GABAergic currents
through receptor desensitization, changes in single-channel open probability, and ligandreceptor interactions. Experiments in rat hippocampal neurons showed that
phosphorylation induces a significant conformational change that directly affects and
destabilizes ligand affinity for the receptor (Jones &Westbrook, 1997). Further, a study
investigating both β1- and β3- containing receptors expressed in HEK 293 cells showed
that PKA phosphorylation regulates desensitization and deactivation parameters by
increasing the fast phases of desensitization and prolonging deactivation (Hinkle &
Macdonald, 2003). A recent study found that PKA phosphorylation increased current
through α4β3δ receptors by increasing their single channel mean open frequency (Tang et
al, 2010), although a previous study by Angelotti et al. (1993) failed to discern changes in
open and close times, bursting parameters, and conductance due to PKA phosphorylation.
i.
Dopamine’s influence on phosphorylation.
Dopamine receptors are GPCRs whose second messenger system provides
another layer of regulation to PKA phosphorylation. D1Rs are coupled to the Gs protein,
which promotes adenylyl cyclase (AC) and further activates cAMP and PKA
phosphorylation (Stoof & Kebabian, 1981; Walaas & Greengard, 1991; Stoof &
Kebabian, 1984). On the other hand, D2Rs are inhibitory as they activate the Gi/o protein
that blocks cAMP accumulation, preventing protein phosphorylation (Stoof & Kebabian,
1981). Additionally, all striatal MSNs express the dopamine- and cAMP- regulated-
41
Figure 6. PKA Phosphorylation Cascade is Regulated by Dopamine. D1R stimulation
(left) promotes AC activation and allows cAMP to accumulate and activate PKA. PKA
phosphorylates target proteins such as β subunits of the GABAA receptor that affect the
amount of current passing through receptors. PKA also phosphorylates DARPP-32 at
T34, which blocks PP-1 activity. PP-1 dephosphorylates target proteins. PKA also
activates PP-2A which dephosphorylates T75 on DARPP-32. The phosphorylated T75
protein further blocks PKA activity. Cdk-5 is the kinase responsible for phosphorylating
T75 of DARPP-32. D2R activation (right) inhibits AC activity and further blocks PKA
phosphorylation by activating PP-2B, a phosphatase that dephosphorylates DARPP-32 at
T34. Abbreviations: AC, adenylyl cyclase; cAMP, 3'-5'-cyclic adenosine monophosphate;
PKA, protein kinase A; DARPP-32, dopamine- and cAMP- regulated-phosphoprotein of
32 kD; PP-2A, protein phosphatase 2A ; T, threonine residue; PP-1, protein phosphatase
1; Cdk-5, cyclin-dependent kinase 5; PP-2B, protein phosphatase 2B.
42
D1R
D2R
Gi/o
Gs
AC
cAMP
PKA
PP-2A
D32 T75
D32 T34
D32 PT75
Cdk-5
D32 PT34
PP-2B
Target protein
Target protein P
PP-1
β3
β1
β3P
GABA currents
β1P
GABA currents
43
phosphoprotein of 32 kD (DARPP-32) (Ouimet et al, 1984; Walaas & Greengard, 1984;
Ouimet & Greengard, 1990; Matamales et al, 2009; Rajput et al, 2009). This protein is
phosphorylated at threonine residue (T) T34 by PKA (Hemmings et al, 1984), and in this
phosphorylated state, DARPP-32 acts as a key inhibitor of PP-1 (Hemmings et al, 1984;
reviewed in Greengard et al, 1999) to further regulate the phosphorylation cascade.
Under low cAMP and PKA levels, DARPP-32 is phosphorylated on T75 by cyclindependent kinase 5 (Cdk5); in this state, DARPP-32 inhibits PKA activity (Bibb et al,
1999). When PKA levels rise, protein phosphatase 2A (PP-2A) catalyzes the
dephosphorylation of T75, providing a positive feedback loop in PKA phosphorylation
(Nishi et al, 2000).
D1R agonists have been shown to increase DARPP-32 phosphorylation (Nishi et
al, 1997; Svenningsson et al, 1998; Kuroiwa et al, 2008), while D2 agonists decrease this
phosphorylation (Nishi et al, 1997; Lindskog et al, 1999) due to the receptors‟ influence
over cAMP. Thus, D1R activation will activate PKA phosphorylation by both cAMP
accumulation and phosphorylated T34-DARPP-32 activity; D2R stimulation will block
PKA phosphorylation by blocking AC activity and dephosphorylating T75-DARPP-32,
rending the protein unable to block PP-1 activity (Figure 6).
Although dopamine is not thought to directly activate PKC in young mice (Rashid
et al, 2007), dopamine may regulate downstream players involved in the inactivation of
PKC. Dopamine receptors are linked to the DARPP-32/PP-1 pathway that primarily
regulates PKA activity and function, yet PP-1 has also been shown to dephosphorylate
PKC-phosphorylated residues in the nucleus accumbens (Snyder et al, 1998), suggesting
that dopamine may regulate PKC activity though indirect mechanisms.
44
A relationship between dopamine, phosphorylation, and GABA receptor function
was established in hippocampal slices (Terunuma et al, 2004): a D1R agonist was shown
to increase GABAA currents in D1+ neurons via a PKA phosphorylated β3 subunit. A
study by Jim Surmeier‟s group has also made this link in striatal MSN GABAergic
currents. They showed a reduction in MSN GABA currents in response to D1R
activation, through the PKA/DARPP-32/PP-1 signaling cascade‟s phosphorylation of the
GABAA receptor β1 subunit (Flores-Hernandez et al, 2000). This thesis serves to
provide the essential link among dopamine, PKA phosphorylation, and MSN tonic
currents.
c. Endocytosis and Recycling
Receptor recycling is a common feature of GABAA receptor populations that
affects receptor numbers in the cell membrane and, therefore, the extent of GABAergic
inhibition. GABAA receptor endocytosis is predominately mediated through a clathrindependent internalization process (Kittler et al, 2000). Under basal conditions,
approximately 25% of β3-containing receptors can be internalized within 30 minutes
(Kittler et al, 2004), suggesting that receptor numbers are dynamic.
A clathrin-adaptor protein 2 (AP2) complex is critical in recruiting cell surface
proteins into clathrin-coated pits. Direct binding sites between the GABAA receptor β1-3
and γ2 subunits and the μ2 subunit of AP2 link the two proteins together (Kittler et al,
2000; Kittler et al, 2005). The β2 GABAA receptor subunit contains a di-leucine motif
that is important for clathrin-dependent endocytosis (Herring et al, 2003), while β1 and
β3 subunits bind to AP2 in an atypical basic binding pocket (401KTHLRRRSSQLK412 in
45
Figure 7. β3 Subunit-Mediated Endocytosis. Endocytosis is blocked when the β3
GABAA receptor subunit is phosphorylated (left). Phosphorylation of this subunit also
increases current through the receptor. Upon dephosphorylation, AP2 binds to the β3
subunit and mediates endocytosis, with the help of clathrin and dynamin (right).
Dephosphorylation of the subunit also results in decreased current through the receptor.
Abbreviations: P, phosphorylated; AKAP, neuronal A-kinase anchoring protein; PKA,
protein kinase A; PP-1, protein phosphatase 1; AP2, adaptor protein 2.
46
β3 subunit
β3 subunit
P S408/409
PP1
A
K
A
P
Cl-PKA
AP2
Cl-
Clathrin
Dynamin
AP2
Endocytosis
47
the β3 subunit), which also contains the major PKA and PKC phosphorylation sites
(S408/409 in the β3 subunit) (Kittler et al, 2005). Phosphorylation of these serine residues
reduces subunit association with AP2 (Kittler et al, 2005), increases receptor surface
expression (Jacob et al, 2009), and increases GABAergic inhibition (Kittler et al, 2005).
Likewise, blockade of the phosphorylation site (with peptide blockade or mutations of
serine residues to alanine residues) increases mIPSC amplitudes (Kittler et al, 2005; Chen
et al, 2006; Jacob et al, 2009) (Figure 7). Further evidence for an interaction between
endocytosis and PKA/PKC phosphorylation on GABAA receptor β3 subunits comes from
a study that pharmacologically enhanced β3 subunit PKC phosphorylation and reported
increased cell-surface levels of β3-containing GABAA receptors and decreased AP2
binding (Brandon et al, 2002).
The γ2 subunit has two distinct AP2 binding sites which can regulate receptor
endocytosis. AP2 can bind at tyrosine residue (Y) binding site 365YGYECL370 with high
affinity (Kittler et al, 2008). Both tyrosine residues are principal phosphorylation sites
for Src tyrosine kinases and phosphorylation of these residues decreases AP2 binding to
the γ2 subunit, resulting in increased cell surface receptor expression and mIPSC
amplitudes (Kittler et al, 2008; Smith et al, 2008). Another AP2 binding site on the γ2
subunit is similar to the binding pocket for β subunits as it is highly basic
(324RKPSKDKDKKK335) (Smith et al, 2008). Phosphorylation of these serine residues in
the γ2 subunit blocks AP2 binding, resulting in increased IPSC amplitude (Smith et al,
2008).
Because dopamine is known to alter phosphorylation rates in the brain, this
neuromodulator may alter the integrity of inhibitory transmission through subunit
48
phosphorylation state and receptor numbers at the cell surface. Indeed, activation of a
dopamine D3 receptor (of the D2R family) was shown to suppress the efficacy of
GABAergic transmission by increasing phospho-dependent GABAA receptor endocytosis
(Chen et al, 2006). It was further shown that decreased β3 phosphorylation due to status
epilepticus induced GABAA receptor internalization, contributing to compromised
GABAergic signaling (Terunuma et al, 2008).
When AP2 binds to the membrane-associated receptor, other key elements of the
endocytotic mechanism, clatherin and dynamin, are recruited to form the clathrin coat
(Marsh &McMahon, 1999; Takei et al, 1999). Associations with dynamin have been
shown to support endocytosis since blocking this protein, and therefore inhibiting
endocytosis, has been shown to increase receptor numbers at the cell surface (Kittler et al,
2000) and increase mIPSC amplitudes (Kittler et al, 2000; Herring et al 2003; van
Rijnsoever et al 2005; Chen et al, 2006). Upon internalization, clatherin coats are
removed and some GABAA receptors are degraded by lysosomes (Jacob et al, 2009),
while the majority are recycled to the plasma membrane (Kittler et al, 2004; Thomas et
al, 2005).
49
HYPOTHESIS: GABAergic medium spiny neuron tonic current and excitability is
largely regulated by dopamine receptor activation and PKA phosphorylation of the
GABAA receptor β3 subunit.
50
MATERIALS AND METHODS
I.
Animals
Bacterial artificial chromosome (BAC) Drd2 EGFP (Gong et al, 2003; courtesy of
Dr. Lovinger, National Institutes of Health), BAC Drd1a tdTomato (Shuen et al, 2008;
courtesy of Dr. Calakos, Duke University) mice, and their progeny (BAC Drd2
EGFP;BAC Drd1a tdTomato) were used for the reliable detection of D2+ and D1+ MSNs
in the same animal. GABAA receptor δ subunit knock-out (KO) (Mihalek et al, 1999; Dr.
Huntsman, Children‟s Hospital) mice were also used in a subset of experiments.
In addition, GABAA receptor subunit β3 conditional KO mice were generated
from floxβ3 mice (Jackson Lab, B6;129-Gabrb3tm2.1Geh/J; Ferguson et al, 2007) and
either Drd2-Cre (Gong et al, 2007) or Dlx5/6-Cre (Stenman et al, 2003) (both courtesy of
Dr. Xu, Georgetown University) mice. In some experiments D2+ MSNs were visually
identified by a cross with the Rosa-EGFP reporter mouse where cells that express Cre
recombinase also express EGFP (Jackson Lab, B6;129-Gt(Rosa)26Sor<tm2Sho>; Mao et
al, 2001). To accurately identify NPY+ interneurons, BAC NPY mice (Jackson Lab,
B6.FVB-Tg(Npy-hrGFP)1Lowl/J; Fu & van den Pol, 2007; courtesy of Dr. Zukowska,
Georgetown University) were used and crossed with BAC Drd1a tdTomato mice for
simultaneous visualization of NPY+ interneurons and D1+ MSNs.
In general, mice of postnatal day (p) 15-21 were used for the experiments, but in a
subset of studies, adult mice (p33-38) were used as well. The sex of the animal was
noted, but as there were no detectable electrophysiological differences between males and
females, these data were pooled.
51
Figure 8. Generation of Conditional β3 Subunit KO Mice using the Cre-Lox System.
(A) Mice that express the floxed β3 allele were crossed with mice that express Cre
recombinase under the expression of the D2R promoter. Their progeny had D2R
expressing neurons that lacked the β3 subunit, while non-D2R expressing neurons still
contained the β3 subunit. (B) Mice that express EGFP under the ROSA promoter, with a
STOP codon between, were crossed with Drd2-Cre recombinase expressing mice, so
progeny would have EGFP+, D2+ neurons that expressed Cre recombinase. Black arrow
is loxP site.
52
A
X
Floxed β3
subunit
Cre under D2
promoter
Excised β3
subunit
B
Gt(ROSA)26Sor
STOP
EGFP
X
Drd-2
Drd-2 EGFP+ Cells expressing Cre
53
CRE
II. Cre-lox System
The Cre-lox recombination system uses the enzyme Cre recombinase to remove a
targeted sequence of DNA. In short, the target gene is flanked by two 34- base pair loxP
sequences situated in the same direction, and Cre recombinase (with telomerase- and
restriction enzyme-like activities) excises portions of each loxP site. The strands of DNA
are reannealed with DNA ligase, and in this new strand of DNA, the gene of interest is
deleted. For a conditional KO animal, Cre recombinase is expressed under a promoter
that is specific for a certain cell type or tissue. Therefore, a conditional KO animal lacks
the gene of interest only in Cre-expressing tissue.
Floxβ3 mice express two loxP sites that flank exon 3 of the GABAA receptor β3
subunit gene (flox = flanked by loxP). Excision of the 68 basepair exon 3 will leave a
mutant β3 subunit product with a premature stop codon, rendering the subunit nonfunctional, as exon 3 contains the genetic code for all transmembrane domains of the
subunit (Ferguson et al, 2007).
Drd2-Cre mice express Cre recombinase under the dopamine D2 receptor
promoter, and therefore, Cre recombinase is solely expressed in D2+ striatopallidal
neurons (Figure 8A). Dlx5/6-Cre mice express Cre recombinase under the Dlx5/6
promoter, and therefore Cre recombinase is expressed in GABAergic forebrain neurons
(Stenman et al, 2003). Rosa-EGFP mice express EGFP under the ubiquitous Rosa
promoter, with a floxed STOP codon between them. When crossed with mice expressing
Cre recombinase, progeny will express EGFP in neurons where Cre recombinase is
present (Figure 8B).
54
Dlx5/6-Cre+/-;floxTrkB+/- mice were originally obtained (Dr. Xu, Georgetown
University), and crossed with wild-type C57BL/6J mice to yield pure Dlx5/6-Cre+/mice. These mice were then crossed with floxβ3+/+ animals to yield
Dlx5/6-Cre+/-;floxβ3+/- mice, which were crossed with floxβ3+/+ mice to yield
conditional β3 subunit KO (Dlx5/6-KO) and heterozygous animals (Dlx5/6-Cre;Hetβ3)
that were used for experiments. Drd2-Cre+/- mice were bred in a similar fashion
(described thereafter as Drd2-KO, Drd2-Cre;Hetβ3) (Figure 8A). Rosa-EGFP+/+
reporter mice were crossed with Drd2-Cre+/- mice and floxβ3+/+ mice, and their progeny
were crossed (Drd2-Cre+/-;Rosa-EGFP+/- X Rosa-EGFP+/-;floxβ3+/-). Progeny
(Drd2-Cre+/-;Rosa-EGFP+/+;floxβ3+/-) were mated with Rosa-EGFP+/-;floxβ3+/- mice
to generate the Drd2-Cre+/-;Rosa-EGFP+/+;floxβ3+/+ mouse. Therefore, these mice
have the β3 subunit knocked out in EGFP+, D2+ neurons.
III. Genotyping
BAC Drd1a tdTomato, BAC Drd2 EGFP;BAC Drd1a tdTomato, and BAC NPY
mice were genotyped as 1-2 day old pups using a fluorescence microscope. Heads were
placed under the lens, and fluorescent light allowed visualization of fluorescent cortical
areas. This method proved to be nearly 100% accurate in determining if an animal
expressed a fluorescent protein. However, this method of genotyping is not useful for
BAC Drd2 EGFP mice because levels of D2R expressing neurons are low in cortical
areas.
δ subunit KO mice were bred as heterozygotes and genotyped for the specific δ
subunit deletion by Peijun Li with Southern blot analysis.
55
Table 1. PCR Reaction Protocols. Details for Cre recombinase and Rosa-EGFP PCR
thermocycler protocols.
56
Cre
Recombinase
(400 bp)
Rosa-EGFP
(Mutant; 173
bp)
Rosa-EGFP
(Wild Type;
410 bp)
Holding
92°C; 2 min
95°C; 15 min
95°C; 15 min
Melting
92°C; 30 sec
94°C; 30 sec
94°C; 30 sec
Annealing
61°C; 45 sec
60°C; 1 min
66.8°C; 1 min
Holding
72°C; 1 min
72°C; 1 min
72°C; 1 min
Repeat steps 24
30 cycles
35 cycles
35 cycles
Capping
72°C; 7 min
72°C; 2 min
72°C; 2 min
Maintain
4°C
10°C
10°C
57
Conditional β3 KO mice were genotyped using the polymerase chain reaction
(PCR) method for the floxβ3 allele, Cre recombinase expression, and (when appropriate)
Rosa-EGFP. Snips of mouse tails were cut between p7-10, and total genomic DNA was
isolated using the DNeasy Tissue Kit (Qiagen, Valencia, CA) according to the
manufacturer‟s instructions. Genomic DNA was amplified using primers (all from
Invitrogen) for the loxP site in exon 3 of the β3 subunit (FATTCGCCTGAGACCCGACT, R- GTTCATCCCCACGCAGAC), Cre recombinase (FGGATGAGGTTCGCAAGAACC, R-CCATGAGTGAACGAACCTGG), Rosa-EGFP
(Mutant F- AAFTTCATCTGCACCACCG, R- TCCTTGAAGAAGATGGTGCG; Wild
Type F- CGTGATCTGCAACTCGACTC, R- GGAGCGGGAGAAATGGATATG).
The floxβ3 PCR product was quite difficult to detect with standard PCR, so samples were
sent to Transnetyx, Inc., where the presence of this allele was determined using real time
PCR.
Forward and reverse primers (1 µL of each), 2 µL of isolated DNA, and distilled
water (to a final volume of 25 µL) were added to Ready-to-Go Beads (Amersham
Pharmacia Biotech, Piscataway, NJ). The PCR assay for Rosa-EGFP required the use of
Thermo-Start (Thermo Scientific), and therefore 12.5 µL of 2X Thermo-Start PCR
Master Mix, 1 µL of each primer, 2 µL of DNA, and distilled water (to a final volume of
25 µL) were added to PCR reaction tubes. DNA was amplified in a PTC-100
thermocycler (MJ-Research, Inc.) with varying protocols, based on the gene of interest
(Table 1).
Amplified DNA (10 µL) and 6x Loading dye (2 µL) were mixed together and
added to a 2% agarose gel. DNA samples were separated by electrophoresis at 90 V for
58
approximately 40 minutes. Gels were stained with ethidium bromide (Gibco BRL) and
bands were visualized with a Kodak EDAS 290 camera (Kodak, Rochester, NY) and
Foto/UV 21 lamps (Fotodyne, Harland, WI).
IV. Acute Slice Preparation
Mice were sacrificed by decapitation in agreement with the guidelines of the
AMVA Panel on Euthanasia and the Georgetown University ACUC. The whole brain
was removed and placed in an ice-cold slicing solution containing (in mM): NaCl (85),
KCl (2.5), CaCl2 (1), MgCl2 (4), NaH2PO4 (1), NaHCO3 (25), glucose (25), sucrose (75)
(all from Sigma). Corticostriatal coronal or sagittal slices (250 – 300 µm) were prepared
using a Vibratome 3000 Plus Sectioning System (Vibratome) and were incubated in
slicing solution at 32°C for 30 minutes. Slices recovered for 30 minutes at 32°C in
artificial cerebrospinal fluid (aCSF) containing (in mM): NaCl (124), KCl (4.5),
Na2HPO4 (1.2), CaCl2 (2), MgCl2 (1), and dextrose (10) of 305 mOsm and were
maintained at room temperature. During experiments, slices were submerged in the
recording chamber and continuously perfused (2-3 mL/min) with aCSF at room
temperature, 22-24°C, or physiological temperature, 32°C, where noted. All solutions
were maintained at pH 7.4 by continuous bubbling with 95% O2/5% CO2.
V. Cell Identification.
Although BAC Drd2 EGFP;BAC Drd1a tdTomato mice allow for simultaneous
visualization of D2+ and D1+ MSNs (Shuen et al., 2008), these mice were not available
for the entirety of this thesis research. When BAC Drd2 EGFP mice were used, “green”
59
neurons were identified as D2+ neurons, and “non-green” neurons as D1+ neurons.
When BAC Drd1a tdTomato mice were used, “red” neurons were identified as D1+
MSNs and “non-red” neurons as D2+ MSNs. No remarkable differences were observed
between D1+ and D2+ cells from either mouse strain, and data was pooled as D2+ and
D1+ MSNs, regardless of the transgenic mouse from which they originated.
NPY cells in the BAC NPY strain were identified as “green” neurons, and “nongreen” cells with MSN-like firing properties were deemed to be MSNs. When BAC
NPY; BAC Drd1a tdTomato mice were used to aid in the detection of MSNs, NPY+
interneurons were “green”, while “red” neurons were identified as D1+ MSNs. MSN
properties observed in both BAC NPY strains were confirmed with MSNs from other
strains where MSNs were fluorescently labeled.
In experiments where the β3 subunit was deleted, MSNs were not tagged with
fluorescent proteins, and MSN identification was largely determined by soma size. In a
few experiments, Rosa-EGFP expression allowed visualization of Cre-expressing D2+
MSNs, and “green” neurons were assumed to be D2+ neurons, while the “non-green”
cells were assumed to be D1+ MSNs.
VI. Whole Cell Recordings
Slices were visualized under an upright microscope (E600FN; Nikon) equipped
with Nomarski optics and an electrically insulated 60X water-immersion objective with a
long working distance (2 mm) and a high numerical aperture (1.0). Recording pipettes
were pulled on a vertical pipette puller from borosilicate glass capillaries (Wiretrol II;
60
Drummond) and filled with CsCl-, KCl- or KGluconate-based internal solutions. The
CsCl-based internal solution (CsCl internal) contained (in mM): CsCl (145), HEPES
(10), ATP.Mg (5), GTP.Na (0.2), EGTA (10), adjusted to pH 7.2 with CsOH. In KClbased internal solution (KCl internal), CsCl was replaced with equimolar KCl and pH
was adjusted with KOH. For Kgluconate-based internal solutions (Kgluconate internal),
CsCl was replaced with equimolar Kgluconate and pH was adjusted with KOH.
Single and dual voltage-clamp recordings were performed using the whole-cell
configuration of the patch-clamp technique at a pipette voltage of -60 mV using the
Axopatch 200B and 1D amplifiers (Molecular Devices). Access resistance was
monitored during the recordings, and experiments with > 20% change were discarded.
When potassium based solutions were used, the baseline membrane potential for currentclamp recordings was set at -70 mV or -60 mV, as noted, before each series of current
step injection protocols. Rheobase current was defined as the first current step, within a
series of 10 or 20 pA steps, from the set membrane potential that elicited an action
potential.
For evoked current recordings, a single bipolar stimulating electrode was placed
within the striatal tissue (in coronal slices) or the globus pallidus (in sagittal slices).
Stimulation parameters were altered to evoke inhibitory currents of 100 – 400 pA in
amplitude.
For anatomical reconstructions, biocytin (AnaSpec, Fremont, CA) was added at a
final concentration of 1% to the intracellular solution. Upon achieving whole-cell
recordings, biocytin was allowed to diffuse through the cell for approximately 5 minutes.
After the whole cell recording, the pipette was gently removed to form an outside-out
61
patch, and the slices were fixed in 4% paraformaldehyde (PFA) for 30 minutes. After
fixation, slices were washed in phosphate buffer saline (PBS) and stained with Texas redconjugated avidin-D dye (Invitrogen, Carlsbad, CA) at 2.5 µL/mL for 2 hours. Slices
were mounted on microscope slides and processed for confocal imaging as described in
Methods, Section X.
VII.
Drugs and Peptides
Stock solutions of bicuculline methbromide (BMR), 6-chloro-1-phenyl-2,3,4,5tetrahydro-1H-3-benzazepine-7,8-diol (SKF-81297), quinpirole, sulpiride, 7-chloro-3methyl-1-phenyl-1,2,4,5-tetrahydro-3-benzazepin-8-ol (SCH 23390), GABA, 1,2,3,4Tetrahydro-6-nitro-2,3-dioxo-benzo[f]quinoxaline-7-sulfonamide disodium salt hydrate
(NBQX), and (±)-3-(2-Carboxypiperazin-4-yl)propyl-1-phosphonic acid (CPP) (all from
Sigma) were prepared in water. Tetrodotoxin (TTX), from Alamone Labs, and
Neuropeptide Y, a kind gift from Dr. Kitlinska (Georgetown University), were also
dissolved in water. Etomidate and taurine (Sigma) were dissolved in dimethylsulfoxide
(DMSO; <0.0001% final concentration). Drugs were diluted into aCSF prior to experiments,
and applied to the slice through the Y-tube method (Murase et al., 1989), modified for
optimal solution exchange in brain slices (Hevers and Luddens, 2002). This method
allows rapid solution exchange in the immediate area of the target cell, without affecting
the entire slice, as does bath application of drug.
Additionally, phosphorylation peptides were supplemented into the internal
solution in a subset of experiments: catalytic subunit of PKA (PKA), PKA Inhibitor
Fragment 6-22 amide (PKI), and Protein Kinase C Fragment 19-36 (PKC-I) (all from
62
Sigma). For evoked IPSC experiments, lidocaine N-ethyl bromide (QX-314; Sigma) was
added to the internal solution.
VIII.
Measurement of GABA currents
Internal solutions with isotonic chloride were used to detect GABAergic currents,
setting the reversal potential for Cl- to 0 mV and allowing increased detection of
inhibitory currents with a holding potential of -60 mV. Currents were filtered at 2 kHz
with a low-pass Bessel filter and digitized at 5-10 kHz using a personal computer
equipped with Digidata 1322A data acquisition board and both pCLAMP9 and
pCLAMP10 software (all from Molecular Devices). Off-line data analysis, curve fitting,
and figure preparation were performed with Clampfit 9 and Clampfit 10 software
(Molecular Devices).
a. Phasic GABAergic Measurements
Spontaneous and miniature inhibitory postsynaptic synaptic currents (sIPSCs and
mIPSCs) were identified using a semiautomated threshold based minidetection software
(MiniAnalysis; Synaptosoft) and were visually confirmed. Event detection threshold was
set at 5 times the root mean square (RMS) level of baseline noise. NBQX was not
included in IPSC measurements so as not to perturb network activity. AMPA-mediated
sEPSCs could easily be identified by the rapid decay kinetics (<2 ms) (Ortinski et al.,
2004), and were excluded from the analysis. IPSC averages were based on more than 50
events, and decay kinetics were determined using double exponential curve fittings and
reported as weighted time constants (Tw):
63
Tw = η1*A1/(A1 + A2) + η2*A2/(A1 + A2)
where ηx is the decay time constant for a particular component of the curve and Ax is the
peak amplitude of the corresponding component. mIPSCs were isolated with Y-tube
application of TTX (0.5 µM). All detected events were used for event frequency, but
superimposing events were eliminated for amplitude, rise time, and decay kinetic
analyses.
b. GABAergic Tonic Current Measurements
Although much of the tonic current data presented in this thesis was analyzed
with an all-points histogram that measured the mean holding current 10 seconds before
and during BMR application (Ade et al, 2008), recent studies have shown that this
method may not detect small changes in tonic current (Glykys & Mody, 2007).
Therefore, when indicated, changes in tonic current were also measured by changes in
RMS noise before and during BMR application. These analyses were based on an allpoints histogram that was fitted to the Gaussian function:
(x) = A·exp[–(x – µ)2/2 2]
where ζ represents the RMS noise during the 10 second period before and during drug
application and µ represents the mean holding current. Tonic noise was then measured as
a difference in RMS noise between two conditions.
When peptides were supplemented in the internal solution, phasic and tonic
currents were analyzed at least 4 minutes after break-in to allow proper peptide function
and equilibration with the cellular internal components. Likewise, effects of
64
dopaminergic agents were not analyzed until 5 minutes of application to allow proper
downstream functions.
c. Evoked Current Measurements
Evoked IPSCs (eIPSCs) were isolated with NBQX (5 µM) and CPP (10 µM), and
weighted decay kinetics were analyzed as described in Introduction, Section VIIIa with
averages of at least 10 eIPSC events. For short term plasticity measurements, postsynaptic plasticity responses to 16 and 33 Hz stimulations were measured with two
distinct methods: Each of the responses were measured from the original baseline
(baseline plasticity) and from the individual response‟s baseline (global plasticity). Short
term plasticity ratios were calculated:
Plasticity ratio = [amplitude of IPSC7/amplitude of IPSC1]
to demonstrate the degree of depression or facilitation. A ratio less than 1.0 represents
depression, while a ratio greater than 1.0 represents facilitation. BMR was applied at the
end of each experiment to verify that all measured currents were mediated through
GABAA receptors.
IX. HEK 293 Cell Culture and Transfection
Human embryonic kidney 293F (HEK 293) cells (American Type Culture
Collection; CLF1573) were grown in minimal essential medium, supplemented with 10%
fetal bovine serum, 100 units/mL penicillin, and 100 units/mL streptomycin (all from
Invitrogen) in a 5% CO2 incubator at 36°C. The colony was maintained by replacing the
65
medium twice a week and spitting the cells once a week. For transfection, growing cells
were dispersed with trypsin and seeded at approximately 2 x 105 cells/35 mm dish in 2
mL of culture medium on 12 mm glass coverslips coated with poly-D-lysine. After 24
hours from plating, the cells were transfected with rat GABAA receptor subunit cDNAs,
because of their high homology to mouse receptors, and EGFP using calcium phosphate
precipitation. The following GABAA receptor subunit plasmid combinations were used:
α2β1γ2, α2β3γ2, α5β1γ2, and α5β3γ2 at a ratio of 1:1:4. Mixed plasmids (5 µg total)
were added to the dish containing 2 mL culture medium for 8–12 hours at which point the
media was refreshed. The cells were used for electrophysiological recording 2-3 days
after transfection. EGFP expression in these HEK 293 cells was used as a marker for
successful transfection, although EGFP uptake does not guarantee receptor subunit
expression. This method was often successful for about 70% transfection of total HEK
293 cells plated.
GABAA receptor dose-response curves were measured with four GABA
subsaturating concentrations which were normalized to a saturating GABA concentration
(3 mM) in each cell. Dose-response curves were fitted using GraphPad Prism (La Jolla,
CA) software with the logistic function:
Ipeak = Imin + (Imax – Imin/1 + ([Drug]slope/EC50))
where Imin and Imax are minimal and maximal evoked currents, [Drug] is the GABA
concentration, and slope is slope of the curve.
66
X. Immunofluorescence and Confocal Imaging
Brain sections were prepared from BAC Drd2 EGFP and BAC Drd2 EGFP;BAC
Drd1a tdTomato mice aged ~3 weeks postnatally. Whole brains were dissected and
stored in 4% PFA overnight at 4°C. 100 μm coronal or sagittal sections were cut with a
Lancer Vibrotome (Series 1000, Sherwood Medical, St. Louis, MO). Fixed, free floating
tissue sections were blocked with 4% normal donkey serum in PBS for 1 hour at room
temperature, then washed 3 x 10 minutes in PBS/0.1% Triton-X100 (Tx). The rabbit αGABAA receptor β3 1° antibody (Millipore, Temecula, CA; AB5563; 1:1000) was
diluted in PBS/Tx/1% bovine serum albumin (BSA). The 1° antibody incubation step was
12-18 hours in duration at 4°C, and slices were then washed 3 x 10 minutes in PBS/Tx.
Indocarbocyanine (Cy3)-conjugated 2° antibodies (Jackson ImmunoResearch, West
Grove, PA) were diluted 1:1000 in PBS/Tx/BSA and exposed to tissue for 2-4 hours at
room temperature. The 2° antibody was washed 3 x 10 minutes with PBS/Tx and sections
were placed on microscope slides and sealed under glass cover slips with VectaShield H1000 mounting media (Vector Labs Inc., Burlingame, CA).
Images were captured using an Olympus Fluoview-FV300 laser scanning
confocal microscope (Olympus Optical, Tokyo, Japan) or the Nikon Eclipse E600
microscope (Nikon Instruments, Melville, NY), exciting endogenous EGFP and Alexa555 fluorophores. For confocal imaging, Plan-Acromat objectives with sequential
acquisition of separate color channels were used. Stacks of consecutive sections (Z-stack
images; 1 μm thick) were processed with MetaMorph software (Universal Imaging,
Downingtown, PA). When noted, confocal images represent a projection image of 14-16
z-stacks.
67
XI. Statistics.
Box and whisker plots were generated for more complete representation of certain
data. The whiskers include the minimum and maximum values, while the box outlines
the 25th and 75th percentile of data points. The mean value is represented by a bar inside
the box. Scatterplots of data points are also included in these plots to further show data
spread.
Statistical significance was determined using the paired two-tailed Student's t test
to compare predrug conditions with recordings made under drug conditions of the same
cell population. Unpaired two-tailed Student‟s t test was used for comparisons across cell
groups. Significance criteria was set at p < 0.05, and all values in text and figures are
expressed as mean ± SEM. n represents the number of cells/animals. In text and figures,
*p < 0.05, **p < 0.005, and ***p < 0.0005.
68
RESULTS
I. GABAergic Tonic Conductances in Striatal MSNs
a. Identification of MSNs in Acute Slice Preparation
Transgenic mice where EGFP was driven under the promoter for the D2 receptor
and tdTomato fluorescent protein was driven under the D1 receptor promoter (BAC Drd2
EGFP;BAC Drd1a tdTomato mice) were used when available to accurately and
efficiently compare tonic currents between D2+ and D1+ MSNs. In these acute slices,
there was very little overlap of fluorescent proteins (< 1%), suggesting the two primary
striatally expressed dopamine receptors are largely segregated onto different striatal
neurons. Additionally, images taken from sagittal sections of this mouse brain showed
distinct, non-overlapping pathways to the GP (D2+ neurons) and SNr (D1+ neurons),
confirming distinct striatopallidal and striatopallidal pathways (Figure 9A). While these
results agree with those found recently in the same strain of mice (Shuen et al, 2008),
previous reports found that D1Rs and D2Rs colocalize within the same neuron (Surmeier
et al, 1993; Surmeier et al, 1996; Aizman et al, 2000). Therefore, under acute slice
preparations, D1+ and D2+ MSNs were identified by their unique red and green
fluorescence, respectively. No recordings were made from the few cells that expressed
both fluorescent proteins because their dopamine receptor identity remained ambiguous.
Because the majority of experiments were conducted using CsCl internal
solutions, neuronal firing patterns could not be used to confirm MSN identity. Therefore,
in many cases, fluorescent proteins were the only identifying marker used to identify
MSNs in the slice preparation. In a subset of experiments, to be described later,
69
Figure 9. Striatopallidal and Striatonigral Pathways are Distinct. (A) Sagittal slice
taken from a BAC Drd2 EGFP;BAC Drd1a tdTomato mouse, showing distinct, nonoverlapping striatonigral (red) and striatopallidal pathways (green). (B) Confocal image
of BAC Drd2 EGFP;BAC Drd1a tdTomato striatal slice (75 µm) with DIC and EGFP (i)
and Tomato red (ii) fluorescence. Merged image (iii) of EGFP and Tomato red shows
little overlap. Dotted box denotes magnified section shown in (iv). The yellow cell is the
only doubly labeled cell in view. Calibration bar: 150 µm.
70
A
B
A
i
B
ii
C
iii
D
iv
71
Kgluconate internal solutions were used to determine MSN firing patterns. In these
experiments, MSN identity was confirmed by both fluorescence and firing pattern.
Additionally, slices from β3 subunit conditional KO mice lacked fluorescently
labeled cells. CsCl internal solutions further complicated accurate MSN identification
since firing patterns could not be recorded. In these cases, MSNs were visually identified
by soma size, and therefore, these data sets may contain a few GABAergic interneurons.
However, the large sample population size coupled with the high percentage of MSNs in
striatal slices is likely to offset potential inaccuracies.
b. Unique GABAA Receptor Subunits Mediate MSN Tonic Current.
A previous study in our lab (Ade et al, 2008), showed that D2+ MSNs have
significantly larger tonic current than D1+ MSNs in young mice (p16-25). I have
confirmed these results in BAC Drd2 EGFP;BAC Drd1a tdTomato mice and see distinct
differences in D2+ and D1+ tonic conductances (Figure 10) in the absence of glutamate
blockers (which may affect neuronal excitability and alter tonic current) and any uptake
blockers that are often used to increase tonic current visualization (Santhakumar et al,
2010). Ade et al. (2008) hypothesized that differences in tonic current were due to
different GABAA receptor composition between the two types of MSNs. Indeed,
pharmacological studies showed that the α5 GABAA receptor subunit mediated some
tonic current in D2+ MSNs, but none in D1+ MSNs (Ade et al, 2008).
A δ subunit KO mouse was used to determine the role of this subunit in young
MSN tonic current, as it is implemented in tonic current elsewhere in the rodent brain
(Nusser and Mody 2002; Stell et al, 2003; Cope et al, 2005; Drasbek & Jensen 2005; Jia
72
Figure 10. Tonic Current Expression in BAC Drd2 EGFP;BAC Drd1a tdTomato
Mice. (A) Representative current traces displaying tonic current in striatal D2+ and D1+
MSNs from BAC Drd2 EGFP;BAC Drd1a tdTomato mice. Right, all-points histogram
and Gaussian fit from each segment. (B) Summary graph for the tonic current expressed
in D2+ (n = 10/5) and D1+ (n = 15/5) MSNs from BAC Drd2 EGFP;BAC Drd1a
tdTomato mice.
73
A
B
BMR
Tonic Current (pA)
30
D2+
BMR
D1+
D2+
20
10
***
0
30
pA
5s
74
D1+
Figure 11. δ Subunits do not Mediate MSN Tonic Current. (A) Representative
current traces from two MSNs in δ subunit KO mice. (B) Summary graph of the tonic
current expression pattern from δ subunit KO mice (n = 8/1), which resembles the
expression pattern seen in BAC D2 EGFP mice (D2+: n = 8/2; D1+: 8/2).
75
BMR
B
Tonic Current (pA)
A
20 pA
15 s
BMR
76
30
D1+
D2+
20
10
0
δ -/
-/-
BAC Drd2
EGFP
et al, 2005; Mangan et al, 2005; Mtchedlishvili & Kapur 2006; Glykys et al, 2007).
These animals did not express fluorescent proteins, and D1+ and D2+ MSNs could not be
identified, but the pattern of tonic current in the δ subunit KO mouse resembled the
pattern in BAC Drd2 EGFP mice, suggesting that the δ subunit does not contribute to
tonic current in young striatal MSNs (Figure 11).
In addition to the α5 subunit, α4 GABAA receptor subunits are also known to
mediate tonic inhibition (Jia et al, 2005; Mangan et al, 2005), and are expressed in the
striatum (Pirker et al, 2000). Therefore, pharmacological sensitivity to the α4 GABAA
receptor subunit agonist taurine (Jia et al, 2008) was investigated for striatal MSNs, and
compared between the two MSN subtypes to determine if the α4 subunit contributes to
the differential tonic current pattern expressed by D1+ and D2+ MSNs. Although this
drug selectively activates glycine receptors at low concentrations, taurine activates α4containing GABAA receptors at much higher concentrations (Jia et al, 2008). Therefore,
to investigate taurine‟s effects on MSNs, a high concentration was used (50 µM), which
was also likely to activate glycine receptors. Yet, in 3 D2+ MSNs, taurine (50 μM)
produced a substantial amount of inward tonic current (24.5 ± 13.4, n = 3/1). The effect
of this α4 subunit selective agonist was smaller in D1+ MSNs (7.2 ± 2.5 pA, n = 3/1, p =
0.2), although this difference was not significant, likely due to the small number of cells
in each group. Follow up experiments are planned to further investigate the potential
differences in α4 subunit expression in MSNs and the subunit‟s importance in mediating
tonic inhibition.
77
Figure 12. β3 Subunit Expression in Striatal MSNs. (A) Fluorescent image of
endogenous EGFP in striatal BAC Drd2 EGFP slice. (B) Fluorescent image of β3-subunit
antibody staining. (C) Merged image of panels A, B. (D) Magnification of boxed area in
(C), showing β3-antibody staining on both green (D2+ MSN) and non-green (D1+ MSN)
cells. Images shown in A,B,C show the same field of view. Calibration bar: 20 µm for
A,B,C.
78
A
B
C
D
79
i. Importance of β Subunit Expression in MSNs.
The next step in identifying the receptor composition required for MSN tonic
current was to investigate the β subunit composition in these cells. Immunostaining in
adult striatum suggested that all β subunits are expressed (Pirker et al, 2000), however a
single-cell PCR study showed that D1+ MSNs have β1 and β3 mRNA, while β2 mRNA
was absent from MSNs (Flores-Hernandez et al, 2000). However, this study did not
investigate mRNA levels for D2+ MSNs, but it remains likely that D2+ MSNs also lack
the β2 subunit as the subunit is proposed to be expressed solely in striatal interneurons
(Schwarzer et al, 2001). To confirm the presence of β3 subunit expression in MSNs, I
performed immunohistochemistry on BAC Drd2 EGFP slices and stained for the β3
subunit. As shown in Figure 12, both D1+ and D2+ MSNs express this subunit, and
although fluorescence intensity analysis has not been conducted, the subunit appears to
be more highly expressed on D2+ MSNs.
Although β subunit expression is not often investigated in studies of tonic current,
one study from Dr. Lambert‟s group found that a component of dentate gyrus tonic
current is mediated through the β2 subunit, while β1 and β3 GABAA receptor subunits
are located in synaptic areas (Herd et al, 2008). Therefore, the contributions of β1 and β3
subunits to striatal MSN tonic current were investigated subsequently. To identify
differences in β1 and β3 function, I used etomidate, a general anesthetic with selective
agonist properties at β2/β3 subunits of the GABAA receptor (Belelli et al, 1996; Herd et
al, 2008). Since MSNs are presumed to lack the β2 subunit, this drug should be specific
for β3 subunits in striatal MSNs.
80
Another anesthetic, loreclezole, has also been shown to be highly selective for
β2/β3 over β1 GABAA receptor subunits (Wafford et al, 1994). However, etomidate
offers a potential experimental benefit over loreclezole. Etomidate‟s ability to potentiate
GABAA mediated currents is greater compared to the actions of loreclezole (Wafford et
al, 1994), offering greater disparity between β3 and β1 subunits in my experimental
setup. However, loreclezole has been shown to inhibit α1β1γ2 single channel units when
applied with high doses of GABA (Fisher et al, 2000), offering a potential means to
pharmacologically identify the presence of the β1 subunit.
ii.
Etomidate is Selective for β3 Subunits in Recombinant
Receptors
It remains necessary, however, to investigate the selectivity of this compound in
recombinant receptors as interactions with other subunits may alter etomidate‟s
selectivity. The general anesthetic‟s selective properties to β2/β3 GABAA receptor
subunits were maintained in recombinant receptors that contained the α1-, α2-, α3-, or α6
subunits, with γ2 (Slany et al, 1995; Hill-Venning et al, 1997; Sanna et al, 1997).
Because previous studies showed the importance of α5 subunits in MSN tonic currents
(Ade et al, 2008), etomidate‟s pharmacological selectivity needed to be tested in
recombinant receptors expressing α5 and γ2 subunits. For these experiments, HEK 293
cells were transfected with striatally relevant α2β1γ2, α2β3γ2, α5β1γ2, and α5β3γ2
receptors. Etomidate has both direct effects and potentiating effects (when combined
with GABA) on GABAA receptors, and therefore, both effects were investigated in cells
expressing these recombinant GABAA receptors. Each transfected cell was subjected to a
81
Figure 13. GABA Dose Response Curves for Recombinant GABAA Receptors. Cells
were subjected to 4 submaximal doses of GABA, and responses were compared to 3 mM
GABA. α5β1γ2 receptors (n = 12, black solid line) have increased GABA sensitivity
compared to α2β1γ2 receptors (n = 5, grey solid line). The α2β3γ2 receptors (n = 5, grey
dashed line) showed enhanced GABA sensitivity to the α2β1γ2 receptors (n = 5, grey
solid line) at 3 µM and 10 µM GABA.
82
% Current
100
80
*
60
α5β3γ2
α5β1γ2
α2β3γ2
α2β1γ2
*
40
20
0
-7
-6
-5
-4
log [GABA]
83
-3
-2
series of GABA concentrations (250 nM, 1 µM, 3 µM, 10 µM, and 3 mM saturating
dose) to effectively determine the EC10 with which to compare etomidate‟s direct effects
with those of GABA potentiation. α5β1γ2 receptors had increased GABA sensitivity
compared to α2β1γ2 receptors, suggestive of their role in tonic current (p < 0.05).
Interestingly, in α2-containing receptors, the β3 subunit dictated enhanced GABA
sensitivity over β1-containing receptors, shifting the dose-response curve to the left (p <
0.05) (Figure 13). A similar shift in GABA sensitivity was not observed in α5-containing
receptors.
Etomidate (3 µM) selectively activated α2β3- and α5β3-containing receptors (p <
0.05), confirming etomidate‟s selective direct effects on β3-containing receptors. When
etomidate and each cell‟s EC10 for GABA were applied together, etomidate selectively
potentiated α2β3γ2 currents (α2β1γ2: p = 0.6; α2β3γ2: p < 0.05), while this distinction
was not apparent between α5β1γ2 and α5β3γ2 transfected cells (α5β1γ2: p < 0.0005;
α5β3γ2: p < 0.05) (Figure 14) and etomidate potentiated GABA currents in both types of
α5-containing receptors. It should also be noted that the degree of potentiation did not
differ between α5β3- and α5β1-containing receptors (p = 0.3). These data confirm
previous reports of etomidate‟s selectivity for direct activation of β3-containing receptors
(Hill-Venning et al, 1997), although the drug‟s GABA potentiating role is not selective in
α5-containing receptors. As MSNs are known to express the α5 subunit, care will be
taken to interpret data involving etomidate‟s effects on MSNs.
84
Figure 14. Etomidate’s Direct Effects are Selective for β3 Subunit-Containing
Recombinant Receptors. (A) Representative current traces from HEK 293 cells
transfected with α2β1γ2 or α2β3γ2 receptors with the EC10 GABA concentration (3 µM
for α2β1γ2 and 1 µM for α2β3γ2) and etomidate (3 µM) application, showing β3-subunit
selectivity for direct and potentiating effects. Calibration bars: 200 pA, 10 s. (B)
Representative current traces from HEK 293 cells transfected with α5β1γ2 or α5β3γ2
receptors with the EC10 GABA concentration (250 nM) and etomidate (3 µM)
application, showing β3-subunit selectivity for direct effects only. Calibration bars: 50
pA, 10 s. (C) Summary of etomidate‟s direct effects on striatally relevant GABAA
receptors (α2β1γ2, n = 5; α2β3γ2, n = 10; α5β1γ2, n = 5; α4β3γ2, n = 7). (D) Summary of
etomidate‟s potentiating effects of GABA currents evoked by EC10 concentrations of
GABA on each receptor type (α2β1γ2, n = 5; α2β3γ2, n = 4; α5β1γ2, n = 6; α6β3γ2, n =
13).
85
β1
A
GABA
β3
GABA
Etom GABA + Etom
Etom GABA + Etom
α2
B
GABA
Etom GABA + Etom
GABA
Etom
GABA + Etom
α5
β1
β3
*
50
*
D
800
% GABA
Response
100
Etom Response
(pA)
C
0
α2
400
0
α5
86
**
α2
α5
iii.
MSNs have Different Etomidate Responses
Taking these potential restrictions on etomidate selectivity into account, etomidate
was applied in the acute striatal slice preparation to determine β3 subunit activity in D1+
and D2+ MSNs. Etomidate (3 µM) was applied to both D1+ and D2+ MSNs, where it
produced substantial tonic current in D2+, but not D1+, MSNs (D2+: 42 ± 13.2 pA, n =
12/3; D1+: 9.0 ± 3.0 pA, n = 14/3; p < 0.05). Because local interneurons may express
β2/β3 GABAA receptor subunits, etomidate‟s activation of these receptors may increase
GABA levels in the acute slice (Ade et al, 2008), these experiments were repeated in
TTX (500 nM). D2+ MSN etomidate responses remained significantly greater than those
from D1+ cells (p < 0.005, Figure 15), suggesting that D2+ MSNs express more β3
GABAA receptor subunits than D1+ MSNs.
Etomidate‟s potentiating role was also assessed as it may give a more accurate
account of MSN physiology, because low levels of ambient GABA are always present in
the slice and contribute to tonic GABAA currents. Therefore, etomidate‟s potentiating
roles were determined by comparing exogenously applied GABA (1 µM) to coapplication of etomidate and GABA, in the presence of TTX. Etomidate potentiated
GABA currents 188 ± 68.6% (n = 9/4, p < 0.005) in D2+ MSNs, but only 56.6 ± 29.6%
(n = 3/3, p = 0.09) in D1+ MSNs, also suggesting that D2+ MSNs have a greater number
of β3-containing GABAA receptors that may mediate tonic current.
iv.
Etomidate does not Affect mIPSC Properties
Because the composition of synaptic GABAA receptors also remains unknown, I
investigated etomidate‟s effects on mIPSCs in both types of MSNs. Although etomidate
87
Figure 15. Etomidate Selectively Activates Extrasynaptic Receptors in D2+ MSNs.
(A) Representative current traces of a D2+ and a D1+ MSN in 0.5 µM TTX showing
greater etomidate-mediated currents in the D2+ MSN. (B) Representative traces of two
individual MSNs, showing the direct effect of etomidate (3 µM), response to 1 µM
GABA, and etomidate‟s potentiating role with 1 µM GABA, all in 0.5 µM TTX. (C)
Summary data of etomidate‟s direct (D2+: n = 21/9; D1+: n = 17/8) and potentiating
(D2+: n = 10/4; D1+: n = 6/4) effects on D2+ and D1+ MSN tonic current.
88
A
D2+
D1+
Etom
BMR
Etom
BMR
30 pA
40 s
B
Etom
GABA
GABA + Etom
D2+
100
pA 20 s
D1+
C
GABA
D2+
**
GABA +
Etom
Response (pA)
150
100
D1+
D2+
50
D1+
**
0
Direct
Potentiation
89
Figure 16. Etomidate does not Affect Striatal Synaptic GABAA Receptors. (A)
Examples of mIPSCs in D2+ and D1+ neurons before (grey) and after (black) etomidate
application. Averaged mIPSC traces are normalized and overlaid (right) to demonstrate
that etomidate had little effect on current decay. (B) Summary graph of mIPSC data
demonstrating that etomidate had little effect on frequency (D2+: n = 13/4; D1+: n =
11/4), amplitude (D2+: n = 13/4; D1+: n = 11/4), weighted tau (D2+: n = 12/4; D1+: n =
8/4), or rise time (D2+: n = 3/2; D1+: n = 3/2) in both D2+ and D2+ MSNs.
90
mIPSC
mIPSC + Etom
91
did not significantly alter mIPSC frequency, amplitude, weighted tau, or rise time (Figure
16), the presence of β3 subunits in synaptic receptors cannot be ruled out. Heterogeneity
in β subunit expression at this site may mask any effects of etomidate on β3 subunitcontaining GABAA receptors. Additionally, β1 and β3 subunit expression within the
same synaptically-located GABAA receptor is a unique possibility which may underlie
these results.
c. PKA Phosphorylation Affects MSN Tonic Conductance
i. Intracellular PKA Application Modulates D1+ MSN BMRSensitive Tonic Current
The large etomidate response in D2+ MSNs suggests that β3 subunits are present
in D2+ cells and that this subunit contributes to MSN tonic current. Because both β1 and
β3 GABAA receptor subunits are targets of PKA phosphorylation (McDonald et al,
1998), it was crucial to determine the role PKA phosphorylation plays in mediating and
regulating MSN tonic current. In order to alter the post-synaptic cell‟s phosphorylation
environment, many studies apply cell-permeable drugs to the extracellular space that will
activate the PKA phosphorylation cascade in neurons. For example, cell-permeable
cAMP or forskolin is often applied exogenously to activate PKA phosphorylation in
target neurons (McDonald et al, 1998; Flores-Hernandez et al, 2000). However, these
drugs are permeable to every neuron, and therefore affect not only the target postsynaptic neuron, but also pre-synaptic terminals and release probability as well.
Therefore, these drugs add another layer of complexity in understanding a post-synaptic
neuron‟s response to changes in PKA phosphorylation. To investigate an individual
92
Figure 17. Internal PKA Application Regulates GABA-Mediated Tonic Current. (A)
Representative traces of two individual MSNs where PKA was supplemented in the
internal solution, showing BMR-sensitive tonic current in both cells. (B) Summary graph
for tonic current in D2+ and D1+ MSNs in control conditions (D2+: n = 16/10; D1+: n =
12/9) and with internal PKA application (D2+: n = 10/3; D1+: n = 15/7). (C)
Representative traces from simultaneous dual recording of D2+ and D1+ MSNs, showing
etomidate responses with internal PKA application. (D) Summary graph for current
induced by etomidate with internal PKA application. D2+ MSN responses decreased
slightly (CsCl: n = 21/9, CsCl + PKA: n = 5/2), while etomidate responses in D1+ MSNs
were significantly greater with internal PKA application (CsCl: n = 17/8, CsCl + PKA: n
= 9/4).
93
C
Tonic Current (pA)
B
CsCl
40
D
40
D2+
30
20
PKA
*
30
D1+
20
**
10
10
0
0
94
D2+
D1+
*
neuron‟s response to phosphorylation, kinases and phosphatases were included in the
internal recording solution in this study. The catalytic subunit of PKA (50 – 75 μg/mL;
used for only 3 days following dilution) was supplemented into the CsCl internal solution
for ideal phosphorylation of PKA substrates. The first step in identifying the effects of
phosphorylation on striatal MSNs was to monitor tonic current in both D1+ and D2+
MSNs upon intracellular application of PKA. In these conditions, tonic current in D1+
MSNs increased (p < 0.005), while D2+ MSN tonic current decreased (p < 0.05) (Figure
17).
Since β3 subunit phosphorylation results in larger currents (McDonald et al, 1998;
Nusser et al, 1999), the increase in D1+ MSN tonic current could reasonably be attributed
to a phosphorylated β3 GABAA receptor subunit. Etomidate‟s effects were also
measured in the presence of TTX and intracellular application of PKA. In these
conditions, the D1+ MSN etomidate response increased (p < 0.05), while the D2+ MSN
response was slightly decreased (p = 0.2) (Figure 17C&D). Interestingly, etomidate
responses between D1+ and D2+ MSNs did not differ with intracellular PKA application
(p = 0.5), indicating that the two MSN subtypes contain similar amounts of extrasynaptic
β3 subunit-containing GABAA receptors which may mediate tonic current when
phosphorylated. These data suggest that D1+ MSN tonic current is mediated through a
phosphorylated β3 subunit.
95
ii.
Basal Phosphorylation of β3 Subunits in D2+ MSNs
Because intracellular PKA application did not increase D2+ MSN tonic current,
the next obvious question to investigate was if D2+ MSN β3 subunits were basally
phosphorylated to mediate tonic current. Indeed, many studies have also suggested that
β3 GABAA receptor subunits are basally phosphorylated by PKA (McDonald et al, 1998;
Poisbeau et al, 1999; Brandon et al 2003). If D2+ MSNs mediate their tonic current
through basally phosphorylated β3 subunits, PKA blockade should eliminate tonic
current. Therefore, I investigated the PKA phosphorylation blockade next by including
the PKA inhibitor, PKI (20 μM), in the internal recording solution and measuring MSN
tonic current. In these conditions, D2+ MSN tonic current decreased (p < 0.0005), while
D1+ tonic current remained unaffected (p = 0.3), suggesting that D2+ MSNs are basally
phosphorylated by PKA (Figure 18B). Because D1+ MSN tonic current was unaltered
with internal PKI application, but increased with internal PKA application, β3 subunits in
these cells are unlikely to be basally phosphorylated.
Basal phosphorylation has also been attributed to PKC activity in cortical neurons
(Brandon et al, 2000), so I also supplemented the specific PKC inhibitor, PKC fragment
19-36 (PKC-I, 10 µM), into the internal solution to determine its effects on D2+ MSN
tonic current. In these conditions, D2+ MSNs expressed just 8.0 ± 1.13 pA (p < 0.0005)
of tonic current, while D1+ MSN tonic current was largely unaffected (p = 0.09) (Figure
18B). Therefore, it appears that both PKA and PKC may be responsible for basal
phosphorylation of D2+ MSNs, although it is likely that the pharmacological inhibitors
are not selective enough for assigning the role of basal phosphorylation to PKA or PKC
exclusively.
96
Figure 18. D2+ MSNs are Basally Phosphorylated by PKA and PKC. (A)
Representative traces of normal D2+ tonic current (left) and D2+ tonic current with
intracellular PKI application (right). (B) Summary graph for D2+ and D1+ MSN tonic
current in normal conditions (D2+: n = 16/10; D1+: n = 15/7), with intracellular
application of PKI (D2+: n = 15/8; D1+: n = 4/3), and intracellular application of PKC-I
(D2+: n = 12/2; D1+: n = 4/2).
97
A
D2+ MSN
CsCl
BMR
D2+ MSN
CsCl+PKI
BMR
30 pA
5s
Tonic Current (pA)
B
30
CsCl
CsCl+PKI
CsCl+PKC-I
20
***
10
***
0
D2+
D1+
98
Figure 19. Synaptic Receptors are Unaffected by PKA and PKI. (A) Summary graph
showing no changes in sIPSC frequency in control conditions (D2+: n = 31/14; D1+: n =
26/11), internal PKA application (D2+: n = 16/5; D1+: n = 21/5), and internal PKI
application (D2+: n = 16/5; D1+: n = 7/5). (B) Summary graph showing no changes in
sIPSC amplitude in control conditions (D2+: n = 31/14; D1+: n = 26/11), internal PKA
application (D2+: n = 16/5; D1+: n = 20/5), and internal PKI application (D2+: n = 16/5;
D1+: n = 7/5). (C) Summary graph of changes in weighted tau among control conditions
(D2+: n = 31/14; D1+: n = 26/11), internal PKA application (D2+: n = 14/5; D1+: n =
21/5), and internal PKI application (D2+: n = 15/5; D1+: n = 7/5). Internal application of
PKI significantly decreased D2+ MSN decay time from control.
99
Frequency
(Hz)
A
3
2
1
Amplitude
(pA)
0
B
CsCl
CsCl+PKA
CsCl+PKI
40
D2+
D1+
D2+
D1+
30
20
10
0
30
Tau (ms)
C
20
**
10
0
D2+
D1+
100
However, due to striatal dopamine‟s importance in regulating the PKA second messenger
cascade (Stoof & Kebabian, 1981), I have largely focused on PKA‟s influence on MSN
tonic current. Future studies are warranted to further investigate the potential role for
PKC in this system.
iii.
sIPSC Properties are Largely Unaffected by PKA and PKI
To better understand the role of PKA phosphorylation in striatal MSNs, sIPSC
properties were also measured with intracellular PKA and PKI application and compared
to those properties measured in control conditions. Intracellular application of PKA did
not affect sIPSC frequency, peak amplitude, or decay time in MSNs as shown in Figure
19. Because PKA phosphorylation modulates β1 and β3 subunits differently, these
results are somewhat expected since synaptic receptor β subunit composition is likely
heterogeneous, and presence of both subunits will likely mask the effects of the other.
Additionally, intracellular application of PKI did not affect sIPSC properties in MSNs,
although it decreased D2+ MSN decay time (p < 0.005, Figure 19). The decrease in
decay kinetics may also suggest that β3 subunits in D2+ MSN synaptic receptors are
basally phosphorylated, as dephosphorylation will decrease the amount of current
through the channel.
101
d. Dopamine’s Regulation of MSN Tonic Current.
i. Little Basal Dopamine Present in Acute Slice Preparation.
Given dopamine‟s extensive control over PKA phosphorylation and PKA
phosphorylation‟s role in MSN tonic current, I next sought to reconcile these two
observations and determine how dopamine may modulate striatal MSN tonic current.
Striatal dopamine will promote PKA activity in D1+ MSNs, while inhibiting it in D2+
MSNs, and ambient dopamine affects the system in drastically different ways. Although
basal dopamine levels are not usually measured with real-time voltammetry studies, one
study investigated dopamine release in the nucleus accumbens of rat acute slices, and
found that the neuromodulator is only released when electrical or pharmacological
stimulus is provided (Lee et al, 2001). Although conducted in the nucleus accumbens
where dopamine concentrations are lower than the dorsal striatum, these studies suggest
that dopamine is not present in the acute slice preparation, and dopamine receptors are
unaffected. Therefore, to investigate the basal levels of dopamine in the dorsal striatum
of the acute slice preparation, I applied D1R and D2R selective antagonists to MSNs and
measured tonic currents. In 4 D2+ MSN whole-cell recordings, the D2R antagonist
sulpiride (2 µM) did not affect tonic currents (19.5 ± 2.1 pA, n = 4/3, p = 0.2). Likewise,
SCH23390 (10 µM), the D1R antagonist, had no effect on D1+ MSN tonic current (1.8 ±
1.0 pA, n = 4/2, p = 0.2), suggesting that basal levels of dopamine do not affect D1 and
D2 receptors in young animals.
102
ii.
Dopamine Receptor Agonists Alter MSN Tonic Current.
In order to determine if dopamine affects the PKA phosphorylation cascade in
striatal MSNs, dopamine‟s effects on MSN tonic current were assessed by applying D1Rand D2R-like agonists to the slice, and measuring tonic current in D1+ and D2+ MSNs,
respectively. The endogenous compound dopamine was not applied because it will bind
and activate both D1R and D2Rs, and may alter presynaptic functions, muddling the
effects of dopamine on postsynaptic MSNs. Quinpirole (10 µM), the D2R-like agonist,
was applied to D2+ MSNs, and BMR (25 µM) was applied following at least 5 minutes
of whole-cell recording (to allow full GPCR effects). In these conditions, quinpirole
decreased the D2+ MSN tonic current (p < 0.05, Figure 20), while the D1R-like agonist
(SKF-81297, 10 µM), increased D1+ MSN tonic current (p < 0.05). To be confident that
these effects were due to activation of their dopamine receptors, I applied SKF-81297 and
quinpirole to D2+ and D1+ MSNs, respectively. In these conditions, the D1R-like
agonist did not alter the D2+ MSN tonic current (p = 0.3) nor did the D2R-like agonist
alter the D1+ MSN tonic current (p = 0.9). Therefore, D2R activation decreases tonic
current, which is in line with a GPCR-mediated inhibition of PKA phosphorylation which
I found to decrease D2+ MSN tonic current. On the other hand, D1R activation increases
tonic current; this effect is likely mediated through PKA activation, which I found to
increase D1+ MSN tonic current.
These same experiments were repeated at more physiological temperatures (32
ºC) since phosphorylation rates are likely altered under such conditions. In these
conditions, D2+ MSN tonic currents remained greater than those expressed by D1+
MSNs (D2+: 21.7 ± 11.4 pA, n = 3/2; D1+: 7.0 ± 2.5 pA, n = 3/2, p = 0.2). At
103
Figure 20. Dopamine Agonists Alter MSN Tonic Conductance. (A) Representative
current traces from individual D2+ and D1+ MSNs illustrating that the D2R agonist,
quinpirole, reduces tonic current in the D2+ MSN, whereas it does not affect tonic current
in the D1+ MSN. (B) Representative traces of a simultaneous dual recording between a
D2+ and D1+ MSN illustrating that the D1R agonist, SKF-81297, induces a tonic current
in the D1+ MSN, while not affecting tonic current in the D2+ MSN. (C) Summary graph
showing effects of tonic current with quinpirole and SKF-81297 application on D2+ (n =
5/3, 7/3) and D1+ neurons (n = 5/3, 3/3).
104
% Control Tonic
Current
C
300
D2+
D1+
*
Quinpirole
200
SKF- 81297
100
*
0
105
physiological temperatures, quinpirole continued to decrease the D2+ MSN tonic current
to 38.9 ± 18.3 % of control (n = 3/2; p = 0.1), while SKF-81297 continued to increase the
D1+ tonic current to 183.6 ± 33.9 % of control (n = 3/2, p = 0.08). Although these
findings were not significant, likely due to the small numbers of cells where control tonic
current could be compared to the effects of agonists within the same cell, the effects seen
at room temperature are consistent with the trends seen at physiological temperatures.
These experiments suggest that the dopamine-PKA phosphorylation-tonic current
relationships remain intact at more physiological temperatures.
iii.
The Link Between Dopamine Receptor Activation,
Phosphorylation, and GABA-Mediated Tonic Current
To confirm that the increased D1+ MSN tonic current with SKF-81297
application was due to a phosphorylated β3 subunit, etomidate was applied alone and
after the cell was bathed in SKF-81297 for over 5 minutes. When co-applied with the
D1R-like agonist, etomidate produced a significantly greater response than when it was
applied alone (etomidate, 8.3 ± 2.2 pA; SKF-81297 + etomidate, 16.0 ± 4.2 pA, n = 4/1, p
< 0.05; Figure 21). These data support the hypothesis that D1+ MSNs express tonic
current through phosphorylated β3 subunit-containing GABAA receptors upon dopamine
receptor activation.
iv.
Tonic Current in Adult MSNs.
While such experiments in young mice (p 15-21) are necessary and important to
the understanding of neuronal physiology, experiments in adult animals offer additional
106
Figure 21. SKF-81297 Increases Etomidate Response in D1+ MSNs. Representative
current trace from a D1+ MSN where etomidate was given before and during SKF-81297
application. SKF-81297 was given for over 5 minutes before co-application with
etomidate. In a total of 4 cells, SKF-81297 + etomidate currents were significantly larger
than etomidate currents alone from the same cells (p < 0.05).
107
Etom
SKF
- 81297
20 pA
20 ms
108
Etom
insight into potential disruptions that occur in primarily adult-onset diseases, like PD.
For this reason, I recorded MSN tonic current from adult mice (p 33-37) and investigated
how tonic current in these cells was modulated by dopamine receptor agonists and
regulators of PKA phosphorylation. Strikingly, older D1+ MSNs expressed significantly
more tonic current than young neurons (18.3 ± 1.19 pA, n = 6/2, p < 0.0005), while tonic
current was decreased in D2+ MSNs (8.25 ± 3.1 pA, n = 4/2, p < 0.05) (Figure 22).
These findings were confirmed by a recent study in adult mice by Santhakumar et al.
(2010) who found that adult (p > 30) D1+ MSNs express more tonic current than D2+
MSNs, the opposite pattern from young (p 16-25) MSNs.
Basal dopamine levels are unable to activate receptors in young mice, but
increased dopamine release in the adult striatum may provide a reasonable mechanism for
the developmental changes in MSN tonic current expression. Application of the D1Rlike antagonist decreased the adult D1+ MSN tonic current to 35.1 ± 14.9 % of control (n
= 4/1, p = 0.05), suggesting that basal levels of dopamine may be altered in the adult
animal, and underlie the observed changes in MSN tonic current.
To investigate the role of PKA phosphorylation in these older animals, PKI was
supplemented in the internal solution and tonic currents from D1+ and D2+ MSNs were
measured. In older animals with intracellular PKI application, tonic current in D2+
MSNs did not change (p = 0.9), while D1+ MSN tonic current was significantly reduced
(p < 0.0005) (Figure 22). Although the dopamine receptor profile for tonic current is
reversed in adult mice (likely due to altered dopamine release), the relationship between
dopamine, PKA phosphorylation, and tonic current remains intact throughout
development.
109
Figure 22. Adult Animals have Different Tonic Current Expression. Summary graph
showing the amount of tonic current expressed in young MSNs (p 15-21) (D2+: n =
16/10; D1+: n = 12/9), old MSNs (p 33-37) (D2+: n = 4/2; D1+: n = 6/2), and old MSNs
with intracellular PKI application (D2+: n = 4/2; D1+: n = 4/2). * denotes significance
between young and old mice. # denotes significance between control and intracellular
PKI application in old mice.
110
Tonic Current (pA)
40
30
D2+
D1+
***
20
*
##
10
0
111
v.
Dopamine Regulates MSN Excitability
Because dopamine modulates MSN tonic currents and GABAergic tonic current
regulates cell excitability (Ade et al, 2008), dopamine‟s effects on MSN rheobase and
firing frequency were also investigated. For these experiments, the Kgluconate internal
solution was used with the current-clamp technique. Cells were held at a pre-determined
membrane potential (-70 mV), and subjected to 1 s hyperpolarizing and depolarizing
current injections before and during dopamine receptor agonist application. As
previously reported, D2+ MSNs exhibited a lower rheobase compared to D1+ MSNs
(Figure 23C), suggesting that D2+ MSNs are more excitable (Ade et al, 2008; Gertler et
al, 2008). Quinpirole (10 µM) significantly increased the rheobase and significantly
decreased the firing frequency in D2+ MSNs (Figure 23). However, no changes to
rheobase or firing frequency were observed with the D1R agonist, SKF-81297 (10 µM).
These data suggest that activation of D2Rs reduces D2+ MSN excitability, feasibly
through dopamine regulation of the D2+ MSN tonic current. Further investigation is
necessary to make a definitive statement on how D1Rs regulate D1+ MSN excitability.
vi.
Dopamine Receptor Agonists do not Affect sIPSC Properties
In order to determine the effects of dopamine receptor agonists on D2+ and D1+
MSN synaptic receptors, I measured sIPSC properties in these neurons after they were
exposed to quinpirole or SKF-81297. No changes to decay kinetics were observed in
these conditions (D2+: 124.6 ± 17.7 % control, n = 4/3, p = 0.09; D1+: 99.5 ± 11.3 %
control, n = 10/7, p = 0.8), in agreement with a study from Robert Malenka‟s lab (Nicola
& Malenka, 1998) where dopamine failed to affect IPSCs in the dorsal striatum.
112
Figure 23. Dopamine Receptor Agonists Modulate MSN Excitability. (A)
Representative current-clamp recording from a D2+ MSN illustrating the responses to a
series of depolarizing current injections (20 pA steps) from -70 mV, recorded with
Kgluconate internal in the absence and presence of quinpirole and BMR. (B)
Representative example of a D1+ MSN in the same conditions as (A), but with the D1Rlike selective agonist, SKF-81297. (C) Summary plot showing the averaged rheobase
current in D2+ (n = 5/2) and D1+ (n = 8/3) MSNs with dopamine receptor agonist and
BMR application. Rheobase measured from -70 mV. (D) Summary of action potential
firing frequency in response to increasing depolarizing current injections in D2+ MSNs
(black square) in the absence and presence of quinpirole (white square) and BMR (black
circle) (n = 5/2). (E) Summary of action potential firing frequency in D1+ MSNs (black
square) in the absence and presence of SKF-81297 (white square) and BMR (black
circle) (n = 7/3). * denotes significance to D2+ control cells. # denotes significance
between D2+ and D1+ MSNs. Calibration bar: 20 µM and 500 ms.
113
D2+
A
D1+
B
Control
Control
40 pA
Quinpirole
60 pA
SKF-81297
80 pA
60 pA
BMR
BMR
60 pA
80 pA
Rheobase (pA)
C80
*****
0
Quinpirole
0
Control
Quinpirole
BMR
100
Frequency (Hz)
E
**
**
*
0
#
BMR
20
10
Control
SKF
D2+
30
D1+
40
D
Frequency (Hz)
D2+
D1+
30
20
Control
SKF-81297
BMR
10
0
200
0
I (pA)
100
I (pA)
114
200
e. The Importance of the GABAA Receptor β3 Subunit in MSN Tonic
Current
Because global β3 subunit KO mice are prone to developmental problems
resulting in neonatal death (Homanics et al, 1997; Ferguson et al, 2007), conditional β3
subunit KO mice were generated to identify the importance of this subunit in mediating
striatal MSN tonic conductance. Two strains of conditional KO animals were generated
using the Cre-lox system, which as previously described, excises a gene of interest from a
particular neuronal tissue or cell type. Drd2-β3 subunit KO mice have Cre-mediated
excision of the β3 GABAA receptor subunit only in cells that express the D2 receptor;
cells that lack the D2 receptor still contain the GABAA receptor subunit. Dlx5/6-β3
subunit KO animals have Cre-mediated excision of the β3 subunit in cells that express
Dlx5/6, which has been characterized in neurons that originate from the lateral ganglionic
eminence (Stenman et al, 2003). Thus, the β3 subunit is excised in all GABAergic
forebrain neurons, including both types of striatal MSNs and interneurons, in Dlx5/6-β3
subunit KO mice.
i. Cre-lox Method Decreases β3 GABAA Receptor Subunit
Expression
Western blot analysis on adult pan-neuronal β3 subunit KO animals showed a
significant Cre recombinase-mediated reduction in the β3 GABAA receptor subunit
expression in all areas studied (Ferguson et al, 2007). Although the subunit was not
completely deleted, these animals offer unprecedented insight into the importance and
function of the β3 subunit. Western blot analysis on the conditional KO mice discussed
115
in this thesis was not conducted due to the complexity of the conditional KO tissue. For
example, D2R expressing neurons need to be effectively sorted from non-D2R expressing
neurons for a meaningful Western blot analysis. It can be assumed, however, that Cre
recombinase expression in a conditional KO excises a similar amount of β3 GABAA
receptor subunits as reported in the pan-neuronal KO because these two studies share the
floxed β3 mouse strain.
ii.
Conditional β3 Subunit KO Mice Show Enhanced Lethality
While a global deletion of the β3 GABAA receptor subunit resulted in 90%
lethality within 24 hours, possibly due to issues involving cleft palate (Homanics et al,
1997), pan-neuronal deletion of the subunit was found to cause neonatal lethality
unrelated to cleft palate (Ferguson et al, 2007). A similar finding was observed with the
Dlx5/6-β3 subunit KO mice when the number of Cre expressing animals that were
heterozygous for the floxβ3 allele (Hetβ3) surviving to p7 was compared to the number
of Cre expressing animals with the homozygous floxβ3 allele (KO). The number of Cre
recombinase expressing animals that were Hetβ3 was 75%, while Cre recombinase
expressing animals with both floxβ3 alleles represented just 25% of animals (n = 8). This
ratio of 3:1 differs from the predicted 1:1 ratio with my breeding scheme and Mendelian
genetics, and suggests that the conditional Dlx5/6-β3 subunit KO mice may be prone to
neonatal lethality before p7. Neonatal lethality was not observed in Drd2-β3 subunit KO
animals (n = 10).
Despite these neonatal deaths, both Dlx5/6- and Drd2-β3 subunit KOs lacked any
abnormal phenotypes like cleft palate and hyperactivity, which are observed in global β3
116
subunit KOs (Homanics et al, 1997), but not pan-neuronal KOs (Ferguson et al, 2007).
Under general observation, conditional β3 subunit KOs were not behaviorally different
from heterozygous littermates.
iii.
Conditional β3 Subunit KO Mice have Decreased Tonic
Current
Although dopamine receptor identity was not able to be determined in these mice,
a large number of cells were sampled, and therefore the sample population likely contains
both D1+ and D2+ MSNs. Because cell identity was not known, box and whisker plots
were generated to observe the spread and pattern of tonic current. Presenting only
averages and SEM would be misleading as these data contain two types of cells with
differences in the measured characteristics. However, averages and SEM were used to
determine significance in these cells for lack of a better way to present statistical data.
Tonic inhibition was measured and compared between Drd2-β3 subunit KO and
Drd2-Cre;Hetβ3 mice to verify that any differences observed in tonic current were due to
the lack of the β3 subunit. As seen in Figure 24B, the presence of the wide box
representing the 25th and 75th percentile demonstrates the high degree of variability in
tonic current amplitudes (0 to 25.1 pA, n = 14/4) from MSNs in Drd2-Cre;Hetβ3 mice.
This wide range is consistent with the inclusion of D1+ and D2+ MSN tonic currents
among the recorded neurons, and suggests that any potential changes to tonic current in
Drd2-β3 subunit KO mice is due to the lack of β3 subunit expression. Indeed, Drd2-β3
subunit KO mice had tonic current amplitudes that were confined to a much more narrow
117
Figure 24. Tonic Current Patterns in β3 Subunit KO Mice. (A) Individual
representative current traces displaying tonic current in Drd2-Cre;Hetβ3 mice (left) and
Drd2-β3 subunit KO mice (right). (B) Summary box and whisker plots displaying the
tonic current patterns in Drd2-Cre;Hetβ3 (n = 14/4), Drd2-β3 subunit KO (n = 26/4),
Dlx5/6-Cre;Hetβ3 (n = 13/3), and Dlx5/6-β3 subunit KO (n = 8/2) mice. Small squares
represent each cell‟s tonic current. (C) Summary box and whisker plots displaying the
tonic current patterns in Floxβ3 (n = 13/2) and wild type BAC Drd2 EGFP;BAC Drd1a
tdTomato mice from D1+ (n = 15/5) and D2+ (n = 10/5) MSNs. Small squares represent
each cell‟s tonic current.
118
Cre;Hetβ3
A
KO
BMR
BMR
BMR
10 s
60 pA
C
Tonic Current (pA)
40
Drd2
Dlx5/6
20
40
Tonic Current (pA)
B
20
0
0
Het
KO
Het
KO
119
Floxβ3
range (0 to 6.4 pA, n = 26/4), suggesting that the tonic current expression in Drd2-β3
subunit KO mice does not differ between D1+ and D2+ MSNs. In addition, the average
tonic current between Drd2-β3 subunit KO and Drd2-Cre;Hetβ3 was significantly
different; amplitudes were smaller in Drd2-β3 subunit KO animals (Drd2-Cre;Hetβ3:
11.0 ± 2.3 pA, n = 14/4; Drd2-β3 subunit KO: 2.8 ± 0.4 pA, n = 26/4, p < 0.0005). These
results suggest that β3 subunit deletion in D2+ MSNs decreases the D2+ MSN tonic
current to levels characteristic of D1+ MSNs.
Tonic current was also measured by RMS noise analysis in these cells. Although
the difference was not significant, the average RMS noise difference tended to be lower
in Drd2-β3 subunit KO animals (1.0 ± 0.15, n = 26/4) than Drd2-Cre;Hetβ3 animals (1.5
± 0.24, n = 14/4, p = 0.07). Again, this trend suggests that Drd2-β3 subunit KO animals
express a lower average tonic current amplitude than the Drd2-Cre;Hetβ3 mice.
Experiments conducted in Dlx5/6-β3 subunit KO and Dlx5/6-Cre;Hetβ3 mice
gave similar results (Figure 24B). While Dlx5/6-Cre;Hetβ3 mice showed a tonic current
pattern suggestive of D1+ and D2+ MSNs (range of 0 to 22.3 pA), the spread of tonic
current was more narrow in Dlx5/6-β3 subunit KO animals (0.4 to 12.7 pA). The average
tonic current between Dlx5/6-β3 subunit KO and Dlx5/6-Cre;Hetβ3 mice was not
significantly different (Dlx5/6-Cre;Hetβ3: 10.9 ± 2.8 pA, n = 13/3; Dlx5/6-β3 subunit
KO: 5.8 ± 1.6 pA, n = 8/2, p = 0.2), although may become significant with increased
numbers of experimental Dlx5/6-KO animals. These results suggest that β3 subunit
deletion in striatal MSNs and interneurons decreases MSN tonic current.
It is also possible that the floxβ3 allele alters β3 subunit and functionality, and
therefore tonic currents were measured from mice that lacked Cre recombinase
120
expression, but were homozygous for the floxβ3 allele (Floxβ3). Suggesting inclusion of
both D1+ and D2+ MSNs in the sample population, Floxβ3 mice showed quite varied
tonic current amplitudes (0 to 34.3 pA) (Figure 24C), agreeing with the Western blot
analysis (Ferguson et al, 2007) that suggested that the subunit was not affected by the
inclusion of loxP sites.
iv.
Etomidate Sensitivity in Conditional β3 Subunit KO Mice.
Based on experiments already presented, etomidate (3 µM) is a selective
pharmacological agent that identifies β3 subunit-containing GABAA receptors.
Therefore, the effects of etomidate in TTX were tested on Drd2-β3 subunit KO and Drd2Cre;Hetβ3 mice. Responses to etomidate (3 µM) averaged 43.6 ± 9.3 pA (n = 9/2) in
Drd2-Cre;Hetβ3 mice, with a wide range of amplitudes (4.3 to 95.4 pA), suggesting that
this population of MSNs contains both etomidate-sensitive D2+ MSNs and relatively
etomidate-insensitive D1+ MSNs. Interestingly, a similar wide range of etomidate
responses was found in the Drd2-β3 subunit KO animals (0.4 to 34.6 pA), while the
average was significantly smaller (14.9 ± 2.7 pA, n = 15/4, p < 0.005).
These same experiments were repeated in Dlx5/6-KO mice with similar results.
Although Dlx5/6-Cre;Hetβ3 mice had etomidate currents averaging 44.3 ± 13.6 pA (n =
6/2) with a wide range of amplitude (6.5 to 95.2 pA), Dlx5/6-β3 subunit KO mice
expressed somewhat lower average etomidate responses (33.4 ± 9.2 pA, n = 7/2, p = 0.5),
although the range of currents was still quite wide (4.8 to 65.9 pA). Data from both types
of conditional β3 KO mice suggest that etomidate responses in β3 KOs are smaller
compared to heterozygous littermates.
121
As previously reported, responses to 1 µM GABA in TTX are significantly
smaller in D1+ MSNs compared to D2+ neurons (Ade et al, 2008). Therefore GABA
sensitivity was also tested in β3 subunit Drd2-β3 subunit KO mice in the presence of
TTX. The average response to GABA (1 µM) in the Drd2-Cre;Hetβ3 mice was 61.5 ±
13.1 pA (n = 7/4) with a range of 15.3 to 100.5 pA. In contrast, Drd2-β3 subunit KO
mice expressed an average GABA current of 14.0 ± 2.7 pA (n = 6/2, p < 0.05), with a
more narrow range of amplitudes (9.1 to 24.3 pA). These data suggest that the β3 subunit
may also affect GABA sensitivity in some receptors.
v.
Synaptic Responses in β3 Subunit KO Mice
Although D1+ and D2+ MSNs do not differ in their mIPSC profile (Ade et al,
2008), I sought to more fully understand the composition of phasic GABAA receptors,
and mIPSC characteristics were compared between β3 subunit KO and Cre;Hetβ3 mice.
As shown in Figure 25C, averaged mIPSC decay times were significantly shorter in
Drd2-β3 subunit KO mice compared to Drd2-Cre;Hetβ3 mice. On the other hand, both
mIPSC frequency and peak amplitudes did not differ between the two transgenic animal
strains. Although there was no significant difference between mIPSC decay times in the
Dlx5/6-β3 subunit KO and Dlx5/6;Hetβ3 mice (p = 0.4), β3 subunit KO animals tended
to have more rapid decay kinetics. As seen in the Drd2-β3 subunit KO mice, mIPSC
frequency and peak amplitudes were no different from their Cre;Hetβ3 littermates (p =
0.9, p = 1.0).
122
Figure 25. Synaptic Responses in Drd2-β3 Subunit KO Mice. (A) Summary graph for
mIPSC frequencies in Drd2-β3 subunit KO (n = 17/4) and Drd2-Cre;Hetβ3 (n = 9/4)
mice. (B) Summary graph for mIPSC peak amplitudes in Drd2-β3 subunit KO (n = 17/4)
and Drd2-Cre;Hetβ3 (n = 9/4) mice. (C) Summary graph for mIPSC decay time in Drd2β3 subunit KO (n = 14/4) and Drd2-Cre;Hetβ3 (n = 9/4) mice.
123
Frequency (Hz)
A
Drd2-Cre;Hetβ3
Drd2-β3 subunit KO
1
0.5
B
Amplitude (pA)
0
30
20
10
0
C
Tw (ms)
40
**
20
0
124
II. Characterizing NPY+ Interneurons.
a. Identification of LTS/NPY+ Interneurons in Acute Slice Preparation.
To accurately identify LTS/NPY+ interneurons and compare their
electrophysiological characteristics with those of MSNs, BAC NPY mice were used that
express EGFP under the NPY promoter. Therefore, in acute slice preparations made
from these mice, “green” neurons were assumed to be NPY+ interneurons. Because
firing pattern was not tested in all “green” NPY+ interneurons, these cells will be labeled
as NPY+ interneurons for the purposes of this results section.
In these acute slices, NPY+ interneurons were sparse in the striatum compared
with cortical areas (Partridge et al, 2009), consistent with the observation that striatal
NPY+ interneurons represent just 1-2% of the neuronal population (Kawaguchi et al,
1995). Because these experiments were conducted with a KCl-based internal solution,
“green” cells were also confirmed with previously established characteristic firing
patterns of LTS and PLTS-type interneurons (Kawaguchi, 1993; Koós & Tepper, 1999).
In these slices, MSNs were identified as “non-green” cells with MSN characteristic firing
patterns (Ade et al, 2008). To confirm the MSN properties found in these slices, these
experimental conditions were repeated in fluorescently labeled animals, where MSN
identity was known.
b. Intrinsic NPY+ Interneuron Characterization.
Striatal NPY+ interneuron electrophysiology had remained largely unexplored
since initial work by Kawagushi in 1993, until Dr. John Partridge and I began a study that
utilized the BAC NPY strain of mice to identify these cells in the acute slice preparation
125
Figure 26. Intrinsic NPY+ Interneuron Characteristics. (A) Representative cellattach recording of spontaneous firing in an NPY+ interneuron. (B) Superimposed
representative current-clamp traces to hyperpolarizing and depolarizing current injections
in distinct examples from NPY+ cells (left, center) and an MSN (right). (C) Spikefrequency plots of NPY+ interneurons (n = 8/4) and MSNs (n = 8/3) as a function of
depolarizing injection current amplitude. All cells held at -70 mV. (D) Box and whisker
plot shows the range of input resistance values in NPY+ interneurons (n = 8/3) and MSNs
(n = 6/3).
126
A
60 pA
2s
B
NPY+
MSN-
NPY+
20 mV
35
30
25
20
15
10
5
0
NPY+
MSN
**
0
50
D
**
100
**
150
R input (MΩ)
C
Frequency (Hz)
500 ms
200
1000
800
600
400
*
200
0
Injected Current (pA)
NPY+
127
MSN
(Partridge et al, 2009). These cells were previously identified only by firing pattern
characteristics and post-hoc immunohistochemistry, and were difficult to study due to
their low abundance in rodent striatum.
One of the first characteristics we observed was that about 85% of “green” NPY+
cells displayed spontaneous firing (16 of 19/7, Figure 26A), while “non-green” MSNs did
not when a Kgluconate internal solution was used. These findings suggest that in the
acute slice preparation, NPY+ interneurons are continually releasing GABA, and may be
providing the ambient GABA needed to activate tonic current in striatal MSNs. Based on
this hypothesis, further characterization was necessary to determine basic properties of
these striatal interneurons and their potential role in providing ambient GABA in the
acute slice preparation.
To identify firing pattern characteristics of NPY+ interneurons and MSNs from
BAC NPY mice, I performed current clamp recordings with KCl internal solutions in
both types of cells. Each cell was subjected to 1 s hyperpolarizing and depolarizing
current injection steps of 10 pA from a set membrane potential of -60 mV for NPY+
interneurons and -70 mV for MSNs based on their reported RMPs. Of 20 NPY+
interneuron recordings, most cells exhibited rebound action potentials in response to
hyperpolarizing steps and repetitive firing in response to depolarizing current injections
(n = 15/9; Figure 26B, left). The remaining cells also exhibited the rebound action
potentials, but featured persistent depolarization in response to depolarizing current
injections (n = 5/4; Figure 26B, center). These defining characteristics have been
previously noted for LTS and PLTS interneurons (Kawaguchi, 1993; Tepper & Bolam,
128
2005), and the striatal NPY+ interneuron population highlighted in the BAC NPY mice is
likely to contain both types of these cells.
Further analysis of these firing patterns showed that MSNs had a greater rheobase
(55.0 ± 5.3 pA, n = 8/3) than NPY+ interneurons (27.5 ± 8 pA, n = 8/4, p < 0.005) when
measured from -70 mV. The relationship between frequency of action potentials and
amount of injected current was also measured, and the frequencies were greater in
LTS/NPY+ interneurons compared to MSNs from the same animals (Figure 26C). These
data suggest that LTS/NPY+ cells fire action potentials with greater frequency within a
physiological membrane potential range than MSNs due to their Kv1.2 channel
expression (Shen et al, 2007), and the interneurons may also provide a source of ambient
GABA to the striatal acute slice preparation. In addition, NPY+ interneurons had a
significantly greater input resistance than MSNs (Figure 26D). These findings agree with
previously reported characteristics of LTS/PLTS interneurons (Kawaguchi, 1993), and
verify the use of BAC NPY mice in the study of striatal LTS/NPY+ interneurons.
c. GABAergic signaling in NPY+ interneurons.
Although much is known about pre-synaptic inputs onto MSNs, much less is known
about pre-synaptic input to NPY+ interneurons. GABAergic IPSC data has not been
described for striatal NPY+ interneurons, and therefore, I also investigated the
differences in GABAergic signaling between striatal NPY+ interneurons and MSNs.
GABAergic synaptic events were recorded with a KCl internal solution, and the cells
were held at -60 mV in the voltage-clamp configuration. There were no major
differences in whole-cell synaptic activity parameters between NPY+ interneurons and
129
Figure 27. GABA Mediated Synaptic Transmission in NPY+ Interneurons. (A)
Representative traces of GABAergic sIPSCs in an NPY+ interneuron (top) and MSN
(bottom) with KCl-based internal solution. (B) Summary graph showing no differences
between NPY+ interneurons and MSNs in sIPSC (NPY+: n = 9/3; MSN: 7/3) and mIPSC
(NPY+: 9/3; MSN: 9/3) frequency. (C) Summary graph showing no differences between
NPY+ interneurons and MSNs in sIPSC and mIPSC amplitude. (D) Summary graph
showing no differences between NPY+ interneurons and MSNs in sIPSC and mIPSC
weighted decay kinetics.
130
NPY+
A
MSN
20 pA
D
Amplitude (pA)
C
Tw (ms)
B
Frequency (Hz)
500 ms
2.5
2
1.5
1
0.5
0
NPY+
MSN
sIPSC
mIPSC
sIPSC
mIPSC
sIPSC
mIPSC
30
20
10
0
40
30
20
10
0
131
MSNs (Figure 27), suggesting that these two neuronal populations contain GABAA
receptors with similar subunit composition.
However, evoked GABAergic current responses (eIPSCs) to intrastriatal
stimulation were significantly different between these types of neurons. It must be noted,
however, that intrastriatal stimulation does not stimulate a particular type of pre-synaptic
cell (as dual recordings are able to control), and currents from intrastriatal stimulation are
evoked from a population of striatal neurons. eIPSCs were pharmacologically isolated
with application of NBQX (5 µM) and CPP (10 µM), glutamatergic receptor antagonists.
At the end of each experiment, BMR (25 μM) was applied to further ensure pure
GABAergic eIPSCs. In whole-cell recordings with KCl internal solutions supplemented
with QX-314 (4 mM), the decay time of eIPSCs in NPY+ interneurons and MSNs were
significantly longer than sIPSCs from the same cells (NPY+: 213.3 ± 21.5 % sIPSC
decay, n = 19/9, p < 0.0005; MSNs: 459.4 ± 74.0 % sIPSC decay, n = 9/4, p < 0.005)
(Figure 28B). In addition, MSN eIPSCs were significantly longer than NPY+
interneuron eIPSCs (MSN: 175.6 ± 28.0 ms, n = 9/4; NPY+: 69.5 ± 6.6.ms, n = 19/9; p <
0.0005), suggesting that MSNs receive more inhibitory input than NPY+ interneurons.
MSN data from BAC NPY strains was confirmed in BAC Drd2 EGFP;BAC Drd1a
tdTomato mice, and the eIPSC properties were found to be similar in confirmed MSNs
(322.6 ± 41.0 % of sIPSC decay, n = 11/2, p = 0.1). Because there were no differences
between MSNs from BAC NPY mice and those from BAC Drd2 EGFP;BAC Drd1a
tdTomato mice, the majority of the MSN data was obtained from the latter mouse strain
so distinctions could be made between the two MSN subtypes.
132
Figure 28. Evoked GABAergic Currents in NPY+ Interneurons and MSNs. (A)
Representative current traces of eIPSCs in the presence of NBQX and CPP in response to
intrastriatal stimulation (black lines). BMR was applied to confirm a purely GABAergic
event (grey line). (B) Summary graph comparing decay kinetics between sIPSCs and
eIPSCs in the same NPY+ (n = 18/10) interneuron or MSN (n = 9/5). * denotes
significance between sIPSCs and eIPSCs of the same cell type. # denotes significance
between eIPSCs in NPY+ interneurons and MSNs.
133
A
NPY+
MSN
50 pA
20 pA
200 ms
200 ms
###
B
Tw (ms)
250
**
200
150
***
100
50
0
sIPSC eIPSC
NPY+
134
sIPSC
eIPSC
MSN
Application of the modulating neuropeptide NPY was shown to decrease the
spontaneous firing of action potentials in cortical NPY+ interneurons (Fu & van den
Pol,2007), and the effects of the NPY peptide (1 µM) were investigated on striatal eIPSC
measurements with CsCl-based internal solutions supplemented with QX-314. While
these experiments were only conducted in 3 NPY+ interneurons from one mouse, the
NPY peptide tended to reversibly decrease the eIPSC amplitude (control: 128.8 ± 67.3
pA; NPY peptide: 97.7 ± 44.5 pA, n = 3/1, p = 0.3), suggesting that striatal NPY+
interneurons may also be inhibited by NPY peptide application.
d. Inhibitory Short Term Plasticity
Differences in short term plasticity were characterized next to discern differences
in pre-synaptic influences due to the apparent differences in GABAergic input between
striatal NPY+ interneurons and MSNs. In this set of experiments, intrastriatal stimulation
was set at 33 Hz with 7 pulses spaced 30 s apart, and cells were recorded with CsClbased internal solutions supplemented with QX-314 (4 mM). Figure 29A shows
examples of these stimulus train eIPSC traces for both striatal cell types. In these
conditions, NPY+ interneurons displayed short term depression (STD) with an STD ratio
([amplitude of IPSC7/amplitude of IPSC1]) of 0.18 ± 0.02 (n = 42/14), with both D1+ and
D2+ MSNs from BAC Drd2 EGFP;BAC Drd1a tdTomato mice also expressing STD
with a ratio of 0.32 ± 0.03 (n = 73/22). However, the STD ratio was significantly greater
in NPY+ cells than MSNs (p < 0.0005). When this type of measurement of short term
plasticity is used in this thesis, it will be referred to as baseline plasticity (Figure 29B).
135
Antidromic pallidal stimulation has also produced STD in striatal MSNs that was
enhanced by D1R agonist application in the striatum (Tecuapetla et al, 2007). In my
hands, pallidal stimulation produced STD in MSNs (0.47 ± 0.15, n = 4/3) from sagittal
slices in BAC Drd2 EGFP;BAC Drd1a tdTomato mice. To determine if dopamine
affects baseline plasticity differently between NPY+ interneurons and MSNs with
intrastriatal stimulation, modulation by dopamine receptor agonists and antagonists was
investigated. In these experiments, the D1R agonist was applied to NPY+ interneurons
for over 5 minutes because they are known to express D1-like receptors (Rivera et al,
2002). In 4 NPY+ interneurons, SKF-81297 (10 µM) failed to alter STD (NPY+: 0.15 ±
0.04, SKF-81297: 0.16 ± 0.08, n = 4/2, p = 0.8). In these experiments, D1R and D2R
agonists also failed to significantly alter STD in D1+ and D2+ MSNs (D1+: 0.36 ± 0.05,
SKF-81297: 0.41 ± 0.06, n = 14/7, p = 0.9; D2+: 0.31 ± 0.04, Quinpirole: 0.31 ± 0.05, n
= 20/10, p = 0.9). In order to determine whether striatal stimulation was evoking
dopamine release in the striatum and preventing dopamine receptor agonists from having
any significant effects, these same experiments were conducted in the presence of
dopamine receptor antagonists. However, SCH 23390 (10 µM) failed to have an effect
on either NPY+ interneurons (NPY+: 0.08 ± 0.03, SCH 23390: 0.12 ± 0.02, n = 3/1, p =
0.4) or D1+ MSNs (D1+: 0.29 ± 0.04, SCH23390: 0.36 ± 0.08, n = 14/8, p = 0.6), while
Sulpiride (2 µM) slightly decreased the D2+ MSN STD (D2+: 0.26 ± 0.03, Sulpiride:
0.38 ± 0.05, n = 16/8, p < 0.05). Effects of D2R antagonists may be reflective of the
increased dopamine sensitivity at D2Rs (Missale et al, 1998).
136
Figure 29. Short Term Plasticity in NPY+ Interneurons. (A) Representative traces of
postsynaptic responses in NPY+ interneurons (left) and MSNs (right) to intrastriatal
stimulation of 7 pulses (arrows) at 33 Hz. (B) Summary graph showing baseline STD in
NPY+ interneurons (n = 42/14) and MSNs (n = 73/22). (C) Summary graph showing
global depression in some NPY+ interneurons (n = 15/8), while others showed
facilitation (n = 15/7). MSNs invariably expressed global facilitation (n = 78/22).
137
A
NPY+
D2+
MSN
NPY+
D1+
MSN
40 pA
B
Baseline Plasticity
Ratio
1.0
NPY+
MSN
.75
.50
.25
0
0
1
2
3 4 5 6
Stimulus #
7
138
Global Plasticity Ratio
100 ms
C
NPY+ (facil)
NPY+ (depr)
MSN
3.0
2.0
1.0
0
0
1 2
3 4 5
Stimulus #
6
7
Upon closer examination of individual short term plasticity traces, two types of
NPY+ interneurons could be identified if the baseline was set at the cell‟s holding
current. If short term plasticity was measured this way, a population of NPY+
interneurons expressed short term facilitation (STF) (1.64 ± 0.07, n = 15/7), while others
expressed STD (0.67 ± 0.02, n = 15/8), or no change at all (1.0 ± 0.03, n = 11/5).
When recorded from BAC Drd2 EGFP;BAC Drd1a tdTomato mice, both D1+ and D2+
MSNs showed STF (2.28 ± 0.17, n = 78/22) with this analysis method. Although this
short term plasticity measurement is not used in the literature, it may suggest that there
are two populations of NPY+ interneurons that receive inhibitory connections with
differing release probabilities. When this type of measurement of short term plasticity is
used in this thesis, it will be referred to as global plasticity (Figure 29C).
Due to the differences in global plasticity among NPY+ interneurons, their
plasticity was also measured with a stimulus frequency of 16 Hz to potentially identify
the origin of differences in these interneurons. In a population of 10 NPY+ interneurons,
5 expressed global facilitation with an STF ratio of 1.33 ± 0.02 (n = 5/2), while the other
5 expressed global depression (0.72 ± 0.03, n = 5/3) when stimulated with 33 Hz. In
response to 16 Hz stimulation, the 5 cells that expressed global facilitation with 33 Hz
stimulation showed neither facilitation nor depression (0.92 ± 0.06, n = 5/2, p < 0.005).
The 5 cells that showed depression with 33 Hz stimulation continued to show global
depression with 16 Hz stimulation (0.68 ± 0.05, n = 5/3, p = 0.6). These data do not
clearly indicate a presynaptic or postsynaptic origin for differences between these two
types of NPY+ interneurons as these data can be explained by a frequency dependent
presynaptic release or differences in postsynaptic receptor desensitization characteristics.
139
To determine if there are differences in presynaptic release probabilities onto
these two types of striatal neurons, NPY+ interneurons and MSNs were subjected to two
differing concentrations of Ca2+ and Mg2+, to alter presynaptic release conditions. The
extracellular solution contained 2 mM Ca2+, 1 mM Mg2+ (2 Ca / 1 Mg), and was altered
to contain 4 mM Ca2+, 1 mM Mg2+ (4 Ca /1 Mg) or 1 mM Ca2+, 2 mM Mg2+ (1 Ca / 2
Mg). The 4 Ca / 1 Mg solution was hypothesized to increase the presynaptic release of
neurotransmitter, making the postsynaptic response as much as four times larger. On the
other hand, the 1 Ca / 2 Mg solution was hypothesized to decrease neurotransmitter
release as the greater Mg2+ concentration would block many presynaptic Ca2+ binding
sites.
As shown in Figure 30B, enhancing presynaptic release significantly increased
the first evoked current amplitude in MSNs, but did not alter any other characteristics in
MSNs or NPY+ interneurons. Decreasing presynaptic release probability, however,
significantly decreased the amplitude of the first evoked current and the charge transfer in
both NPY+ interneurons and MSNs. Additionally, 1 Ca / 2 Mg tended to increase the
baseline short term plasticity in both striatal cell types, further enhancing their existing
STD, and suggesting that these two types of striatal interneurons receive presynaptic
inputs with similar release probabilities. If short term plasticity was measured as global
plasticity, 4 Ca / 1 Mg and 1 Ca / 2 Mg largely had no impact on NPY+ interneurons,
while they decreased and increased global facilitation in MSNs, respectively (Figure
30C). Thus, these experiments did not reveal any striking differences in presynaptic
release probabilities between NPY+ interneurons and MSNs suggesting that differences
between NPY+ interneuron and MSN global plasticity may be due to differences in
140
Figure 30. Alterations to Presynaptic Release Probabilities. (A) Representative
current traces from a MSN in response to different concentrations of Ca2+ and Mg2+.
Calibration bars: 100 pA and 50 ms. (B) Summary graph showing % control changes
with 4 Ca / 1 Mg and 1 Ca / 2 Mg solutions on 1st amplitude, baseline plasticity, and
charge transfer in NPY+ interneurons (n = 10/4) and MSNs (n = 12/3). (C) Summary
graph showing % control changes with 4 Ca / 1 Mg and 1 Ca / 2 Mg solutions on global
plasticity in NPY+ interneurons (facil: n = 3/2; depr: n = 7/3) and MSNs (n = 12/3).
141
A
2 Ca / 1 Mg
B
2 Ca / 1 Mg
200
120
*
*
150
80
*
*
50
4 Ca / 1 Mg 1 Ca / 2 Mg
0
% Control
Global Plasticity
150
100
*
*
50
0
4 Ca / 1 Mg
*
1st Ampl.
Baseline Plasticity
Charge
4 Ca / 1 Mg 1 Ca / 2 Mg
200
C
BMR
*
MSN
100
40
0
1 Ca / 2 Mg
250
NPY+
160
% Control
4 Ca / 1 Mg
1 Ca / 2 Mg
142
NPY + (facil)
NPY + (depr)
MSNs
postsynaptic receptors. Although not investigated in this thesis, it is possible that the two
groups of NPY+ interneurons differ in the sheer number of active synapses or
postsynaptic receptor desensitization properties. For example, if MSNs have greater
GABAergic synaptic inputs than NPY+ interneurons, as suggested with the eIPSC decay
shown in Figure 28B, GABAergic synapses on NPY+ interneurons are likely to become
desensitized faster than GABAergic synaptses on MSNs.
Although both globally facilitating and depressing cells were seen within the
same slice, the discrepancy between these two could be an issue of maturation. For
example, globally depressing cells may be the result of less pre-synaptic contacts
due to their relative immaturity compared to globally facilitating cells within the same
slice.
Because NPY+ interneurons showed two different firing patterns and two
different types of global plasticity, experiments in KCl-based solutions were used to
determine if these two characteristics were related. However, NPY+ interneurons with
the PLTS-like firing patterns expressed both types of global plasticity and cells with
LTS-like firing patterns also expressed both types of global plasticity, suggesting that
these two characteristics are not related. Although these distinct groups of neurons may
be regulated by development, the distinctive firing properties of both neuron types, as
well as distinct plasticity characteristics were observed within the same slice at various
ages tested. These data argue against these characteristics‟ developmental regulation.
143
DISCUSSION
I. Summary
The major finding of these studies indicates that tonic GABAergic conductance
expression patterns differ between striatonigral and striatopallidal MSNs based on their
expression of phosphorylated GABAA receptor β3 subunits. D2+ MSNs express tonic
current in the acute slice preparation without pharmacological manipulation due to
basally phosphorylated β3 receptor subunits. Intracellular application of the PKA
inhibitor, PKI, significantly decreases D2+ MSN GABA-mediated tonic currents.
Quinpirole, the D2R-like agonist also decreases D2+ MSN tonic current through G
protein-coupled inhibition of the PKA phosphorylation cascade. Further, intracellular
PKA phosphorylation was shown to induce significant β3 GABAA receptor subunitmediated tonic current in D1+ MSNs. Application of SKF-81297, the D1R-like agonist,
also induces D1+ MSN tonic current by promoting the PKA phosphorylation cascade. In
addition, studies using the β2/β3 selective agonist etomidate and conditional Drd2-β3
subunit KO animals show that this subunit is essential to the GABA-mediated tonic
current characteristic of these striatal neurons.
Prior to my thesis work, both the players and mechanism behind striatal
GABAergic tonic current was unknown. My findings provide novel insight into the
modulation and regulation of striatal MSN output, as well as the pathogenesis of PD.
My work also characterizes the striatal LTS/NPY+ interneuron, which may
provide the striatal slice with the ambient GABA necessary for tonic current. The
importance of these neurons in striatal physiology is only beginning to be recognized and
understood.
144
II. Etomidate Sensitivity
As a general anesthetic, etomidate is an agonist at GABAA receptors containing
either the β2 or the β3 subunit (Hill-Venning et al, 1997). Although this drug directly
affects GABA receptors, and therefore has GABA-mimetic activity, etomidate also
modulates or potentiates GABA currents. Because striatal MSNs are reported to lack the
β2 subunit (Flores-Hernandez et al, 2000), etomidate proved to be an important
pharmacological tool to investigate the role of the β subunit in mediating GABAA
receptor tonic current.
Previous studies have tested etomidate sensitivity in α1-, α2-, α3-, and α6containing recombinant GABAA receptors (Hill-Venning et al, 1997), and investigation
into α5-containing recombinant receptors was needed to understand etomidate‟s effect in
striatal MSNs since this subunit mediates tonic current in the striatum (Ade et al, 2008).
My results show that etomidate lacks GABA potentiating specificity to β3 subunits since
it potentiated GABA currents in α5β1γ2 and α5β3γ2 receptors to the same degree (see
Figure 14). Etomidate‟s GABA-mimetic actions on these recombinant receptors were
specific for the β3 subunit. β2 subunit specificity was not investigated since this subunit
is not expressed in striatal MSNs (Flores-Hernandez et al, 2000).
Because this is the first study to suggest that etomidate is not selective at β2/β3
subunits when combined with the α5 subunit, one can only speculate on potential causes
for its lack of specificity. It is possible that etomidate‟s selectivity is determined by the β
subunit, while maximal effects may be determined by interactions with other subunits. It
was shown that etomidate‟s maximal potentiation was greater for β2- than β1- containing
receptors in α1, α2, and α6-containing receptors, the maximal enhancement of the inward
145
currents produced by etomidate was no different between α3β2- and α3β1-containing
receptors (Hill-Venning et al, 1997). Results from these recombinant receptor studies
suggest that etomidate‟s ability to potentiate GABA responses is likely to depend on the
identity of both α and β isoforms present in the receptor.
The presence of the δ subunit may also increase etomidate‟s efficacy in
recombinant receptors. One study showed that etomidate-potentiated GABA currents
were approximately ten times greater in α4β3δ receptors than α4β3γ2 receptors, whereas
the responses to other anesthetics did not differ between the δ- and γ-containing
recombinant receptors (Brown et al, 2002). This study did not, however, determine the
selectivity of etomidate in α4β1δ receptors. These three studies suggest that etomidate‟s
ability to potentiate GABA responses in β2/β3 subunit-containing receptors are both
influenced by and dependent upon the α subunit isoform and the presence of δ or γ
subunits.
Because etomidate‟s GABA-mimetic effects are likely dependent upon other
subunits present in the GABAA receptors, pharmacological effects in the slice preparation
are further complicated as the exact receptor composition of GABAA receptors in striatal
MSNs remains unknown. It cannot be simply concluded that D2+ MSNs express
substantially more β3 subunits than D1+ MSNs due to larger etomidate responses (see
Figure 15) because other subunits may be influencing etomidate‟s effects in both types of
striatal output neurons. However, it is likely that in TTX, and without presynaptic
GABA release, etomidate‟s effects in the slice may more closely resemble the direct
effects seen in the recombinant study, where etomidate showed selectivity for the β3containing receptors over those expressing the β1 subunit, independent of the α subunit.
146
Therefore, the data presented in this thesis suggests that because striatopallidal MSNs had
greater etomidate responses, D2+ MSNs have more functional β3 subunits than D1+
MSNs.
Intracellular PKA application and the D1-like receptor agonist, SKF-81297,
increases the etomidate response in striatonigral MSNs and provides two important
details: 1) Etomidate‟s direct effects are modulated by β subunit phosphorylation, and 2)
D1+ MSNs also express functional β3-containing receptors when they are
phosphorylated. This first finding is to be expected as β3 subunit phosphorylation has
been reported to enhance GABA whole cell currents (McDonald et al, 1998), but implies
that basal phosphorylation of GABAA receptor subunits may also modulate etomidate‟s
activity and selectivity of β2 and β3 subunit-containing receptors. The second finding
from these studies regarding a larger etomidate response in D1+ MSNs under certain
intracellular conditions suggests that the difference between striatonigral and
striatopallidal MSNs does not lie in their β3 subunit expression, but rather the extent of
phosphorylation on their β3 subunits.
III. PKA Phosphorylation of GABAA Receptor Subunits
Due to the importance of β3 subunits in mediating tonic current and their distinct
regulation by PKA phosphorylation (McDonald et al, 1998), the role of PKA
phosphorylation in modulating GABA-mediated MSN tonic currents was subsequently
investigated. To study the purely postsynaptic effects of PKA phosphorylation on MSN
tonic current, kinases and phosphatases were supplemented into the internal solution to
avoid unwanted effects on presynaptic terminal release of neurotransmitter (Asaumi et al,
147
2006). Due to these experimental parameters, many of the changes seen with PKA
phosphorylation modulators are likely due to postsynaptic regulation. These experiments
do not, however, rule out potential retrograde influences of the postsynaptic cell on
presynaptic terminals (Sivakimaran et al, 2009), but they certainly decrease potential
presynaptic effects.
Although PKA phosphorylation was shown to decrease whole cell currents from
acutely-dissociated striatal MSNs (Flores-Hernandez et al, 2000), the results presented in
this thesis suggest, for the first time, that PKA phosphorylation regulates GABAmediated tonic current and that PKA phosphorylated β3 subunits regulate striatal MSN
tonic conductance. Blockade of the PKA phosphorylation cascade and
dephosphorylation of β3 subunits dramatically reduces tonic current in striatopallidal
MSNs (see Figure 18). On the other hand, promoting intracellular PKA phosphorylation
with PKA‟s catalytic subunit increases striatonigral MSN tonic current through a
phosphorylated β3 subunit (see Figure 17). As tonic current regulates cell excitability in
striatal output neurons (Ade et al, 2008), these studies suggest that a neuron‟s
phosphorylation state may regulate tonic current as well as striatal excitability and output.
However, a particularly noticeable caveat to this experimental method is that
intracellular application of kinases and phosphatases also affects other target proteins
within the postsynaptic neuron. PKA phosphorylation has been shown to modulate
intracellular processes that lead to cell survival and cell division (Cross et al, 2000), as
well as the function of many neurotransmitter channels (Moss et al, 1992b; Carvalho et
al, 2000; Chen & Roche, 2007) and ion channels (Schiffmann et al, 1995; Chahine et al,
2005) which may affect cell excitability themselves. Therefore, intracellular application
148
of these peptides does not ensure that the changes observed in MSN tonic current are
specifically due to the phosphorylation state of the β3 GABAA receptor subunit as PKA
phosphorylation of other channels may also affect RMP and cell excitability themselves.
Recently, a new transgenic mouse was generated by Dr. Moss‟s laboratory at
Tufts University, where the PKA targeted serine residues of the β3 receptor subunit were
mutated to alanine residues (β3(S408/9A)). Therefore, in these mice the GABAA receptor
β3 subunit is unable to be phosphorylated. I expect that MSN tonic currents in this
transgenic mouse will represent a narrow range of amplitudes, suggestive of a decrease in
D2+ MSN tonic current, confirming the present studies that suggest the phosphorylation
state of the β3 GABAA receptor subunit is responsible, at least in part, for mediating
MSN tonic current. In a recent collaborative effort between Drs. Moss and Vicini, I have
obtained these mice and plan to conduct these experiments to further verify the
phosphorylated β3 subunit‟s role in striatal GABA-mediated tonic current and cell
excitability.
IV. Dopamine Receptor Regulation of BMR-Sensitive Tonic Current
Although dopamine has been shown to affect whole cell currents in D1+ MSNs
through interactions with the PKA phosphorylation cascade, the results presented here
suggest that dopamine affects not only MSN tonic current, but also cell excitability as
well. D2+ MSNs express GABA-mediated tonic current in the absence of dopaminergic
tone in young striatal slices, while D1+ MSNs lack tonic current due to inactivated D1Rs.
In fact, while pharmacologically stimulating the D2R with quinpirole significantly
decreases D2+ MSN tonic current, stimulating the D1R with SKF-81297 significantly
149
increases the D1+ MSN tonic current due to its interactions with the PKA
phosphorylation cascade (see Figure 20). Therefore, the dopaminergic tone of the striatal
slice largely regulates the tonic current expression in striatal output neurons.
It has been shown that MSN tonic current is excitatory and facilitates MSN cell
excitability (Ade et al, 2008; Janssen et al, 2009). Indeed, application of quinpirole
significantly decreases the D2+ MSN cell excitability by decreasing tonic current.
Although the lack of tonic current in D1+ cells makes them less excitable than D2+
MSNs (Ade et al, 2008; Day et al, 2008; Gertler et al, 2008; Janssen et al, 2009),
increasing tonic current with SKF-81297 application failed to affect young MSN
excitability.
The reasons why the D1R-like agonist failed to affect cell excitability while
increasing tonic current remains unknown. It is possible that presynaptic activation of
D1Rs on striatal interneurons will affect D1+ MSN excitability. For example, D1R
agonists have been shown to depolarize LTS/NPY+ and FS/PV+ GABAergic
interneurons (Chang & Kita, 1992), and their increased activity may enhance D1+ MSN
tonic current due buildup of extracellular, ambient GABA. Additionally, D1R activation
will also activate cholinergic interneurons, and increase their release of ACh (Aosaki et
al, 1998; Damsma et al, 1990; Consolo et al, 1992). Downstream effects of ACh are
complex, however, and vary with the type of postsynaptic receptor they activate. It is
also likely that activation of postsynaptic dopamine receptors will alter the function of
other proteins, including other ion channels. Dopamine-mediated modifications to these
channels may also affect cell excitability, and counter any changes in cell excitability due
to increased GABA-mediated tonic current. Although no mechanism has been
150
established to explain the lack of increased cell excitability on D1+ MSNs with D1R
activation, it is likely to depend on the striatal physiology and abundance of striatal
D1Rs.
Several years ago, it was thought that the striatal output pathways were not
distinct due to co-expression of D1R and D2R mRNA in single MSNs (Surmeier et al,
1996). However, two pieces of data presented in this thesis argue against this theory.
First, receptor co-localization, as visualized with BAC Drd2 EGFP;BAC Drd1a tdTomato
mice, is largely absent in young striatal brain slices (see Figure 9), as suggested by Shuen
et al. (2008) with this same transgenic mouse. In addition, pharmacological studies
presented here also support the theory of separate striatal output pathways with distinct,
non-overlapping dopamine receptor expression. Application of D1R agonists had no
effect on D2+ MSN synaptic or extrasynaptic receptors, and D2R agonists had no effect
on D1+ MSNs. Taken together, these data strongly suggest that D1+ MSNs primarily
express D1Rs, while D2+ MSNs primarily express D2Rs with little overlap in receptor
expression. These data also indicate that dopamine regulates specific striatal output
nuclei, offering more specific avenues for PD therapeutics.
Based on my studies with etomidate, PKA phosphorylation, and dopamine
receptor agonists, I propose the following mechanisms regulate MSN GABAergic tonic
conductance (Figure 31): First, in basal conditions where little dopamine is released in
the striatal slice preparation, D2+ MSN tonic current is mediated through a
phosphorylated β3 subunit since the Gi/o protein remains inactive. The phosphorylated β3
subunit passes more current than the dephosphorylated subunit and D2+ MSNs express
tonic current. Under the same conditions, D1+ MSNs lack tonic current because their β3
151
Figure 31. Tonic Conductance is Mediated through a Phosphorylated β3 Subunit.
Under basal conditions (little to no dopamine), D2Rs do not activate the Gi/o protein to
inhibit PKA phosphorylation, and β3 subunits are basally phosphorylated (green β3).
Because the phosphorylated β3 subunit yields increased currents and may be more
plentiful than extrasynaptic β1 subunits, D2+ MSNs exhibit GABA-mediated tonic
current. Without dopamine, D1Rs do not activate the Gs protein to promote PKA
phosphorylation, and the dephosphorylated β3 (red β3) subunits yield smaller tonic
current in the D1+ than the D2+ MSNs. When stimulated, the D2R activates the Gi/o
protein to inhibit PKA activity, dephosphorylating the β3 subunits. A dephosphorylated
β3 subunit results in smaller tonic currents compared with basal conditions, reflective in
the amount of tonic current observed. During D1R stimulation, the Gs protein activates
cAMP and PKA phosphorylates the β3 subunit and increases D1+ MSN tonic currents.
152
Basal Conditions
D1R
D2R
β3
β3
β3
Overall:
β3
PKA
β1
β3
β1
β3
β3
Tonic current
β1
PKA
β1
β3
Tonic current
Quinpirole
SKF-81297
D2R
D1R
β3
β3
β3
β1
cAMP, PKA
β1
cAMP, PKA
β1
β3
β3
β3
Overall:
β3
Tonic current
β1
β3
Tonic current
153
subunits remain dephosphorylated since the PKA phosphorylation cascade remains
inactive due to the unstimulated D1R-coupled Gs protein. Next, when the D2R-like
agonist quinpirole is applied, the D2R is stimulated and cAMP levels drop. Thus, the β3
subunits become dephosphorylated and tonic current is significantly reduced. When the
D1R-like agonist SKF-81297 is applied, β3 subunits become phosphorylated due to Gs
stimulation and increased levels of cAMP. β3 subunit-containing receptor currents
increase and D1+ MSN tonic current is observed.
V. Potential Role for GABAA Receptor Endocytosis
The data presented here suggest that dopamine and intracellular phosphorylation
regulate MSN tonic current. However, enhancement or suppression of GABAA receptor
endocytosis may also explain the results presented in this thesis. As explained in the
Introduction, Section VIIc, GABAA receptor endocytosis is regulated by PKA
phosphorylation of the β3 subunit, and possibly the γ2 subunit. Blockade of
phosphorylation allows the proper endocytotic machinery to bind to the β3 subunit. The
receptors undergo endocytosis and the number of receptors at the cell surface decreases,
leading to reduced current (Terunuma et al, 2008). In this dissertation I show that
intracellular PKI application decreases D2+ MSN tonic current. While it is presumed
that this decrease in current is due to decreased current through β3 subunits, it is possible
that decreased cell surface β3-containing receptors may also be contributing to this
observation.
On the other hand, phosphorylation prevents the endocytotic machinery from
binding to the β3 subunit, and effectively increases the numbers of GABAA receptors at
154
the cell surface (Kittler et al, 2000). Indeed, intracellular PKA application increases D1+
MSN tonic current. Again, while it is presumed that this increase in current is due to
increased current through phosphorylated β3 subunits, it is possible that increased cell
surface β3 subunit-containing receptors may also be contributing to this observation.
Therefore, the results presented here may be due to complementing effects between
altered current and altered receptor numbers at the cell surface although significant
receptor endocytosis may take longer to occur than the 5 minute observation periods
tested in this thesis (Kittler et al, 2004). Further experiments to address the endocytosis
mechanism in these experimental conditions are planned. For such experiments, the
dynamin inhibitory p4 peptide (QVPSRPNRAP, 50 µM) and PKA modulators will be
added to the internal pipette solution as in Chen et al. (2006), and MSN tonic currents
will be measured. This peptide blocks interactions between dynamin and amphiphysin,
preventing endocytosis.
Because the δ subunit was shown to not mediate tonic inhibition in young mice
(Ade et al, 2008), the γ2 subunit remains important to striatal tonic current. The role that
PKA phosphorylation has over this subunit and endocytosis was not investigated in this
thesis, and therefore could also be playing a role in observed changes to tonic current.
While altered rates of endocytosis may play a complementing role in the tonic
current modulation presented in this thesis, I believe that the majority of the effects are
indeed mediated through changes in individual receptor conductances.
155
VI. Interpretations of Conditional β3 Subunit KO
Because the pharmacological sensitivity of etomidate does not give a definitive
picture of β3 subunit expression and GABA-mediated tonic current in MSNs, I
complemented these pharmacological studies with genetic studies where the β3 subunit
was deleted. Conditional β3 subunit KO mice were generated in which the subunit was
deleted from Drd2-expressing and Dlx5/6-expressing cells since pan-neuronal β3 subunit
KO animals experience a high degree of neonatal mortality (Homanics et al, 1997). As
with any KO animal, it is important to remain cognizant that since the β3 subunit is
absent since birth, adaptive changes through development may affect normal physiology,
making it difficult to make definitive statements about the protein of interest from genetic
manipulation alone.
The most significant, yet hypothesized, finding with conditional β3 subunit KO
mice was the dramatic reduction in tonic current that was shown to be specifically due to
the lack of the GABAA receptor β3 subunit (see Figure 24). Tonic current remained
unchanged with Cre recombinase expression or homozygous floxed β3 alleles. These
data strongly indicate the importance of this subunit in mediating D2+ MSN tonic
current. These experiments do not address, however, the role of subunit phosphorylation
in mediating tonic current. As previously mentioned, future experiments will further
address this issue using a transgenic mouse where the specific β3 subunit PKA
phosphorylation sites are mutated.
It was originally hypothesized that β3 subunit KO mice should not respond to the
β2/β3 subunit agonist etomidate due to its relatively specific actions at β3 subunitcontaining GABAA receptors in striatal MSNs. Surprisingly, mice from both strains of
156
conditional β3 subunit KOs expressed etomidate-mediated inward currents, although the
average etomidate-mediated current was smaller in β3 subunit KO mice. Several
explanations can be offered as to why etomidate responses are still intact, albeit reduced,
in β3 subunit KO mice. First, Western blot data conducted in pan-neuronal β3 subunit
KO mice suggest that the subunit is still present in small amounts (Ferguson et al, 2007)
and, therefore, remaining β3 subunits may be responsible for the reduced etomidate
response. Second, deletion of the β3 subunit may result in upregulation of β2 subunit
expression to maintain homeostasis, and observed etomidate responses could be due to
etomidate‟s actions on β2-containing GABAA receptors in MSNs. As presented in the
Results, Section Ibii, etomidate‟s potentiating effects did not differ between α5β1- and
α5β3-containing GABAA recombinant receptors. Therefore, another possible explanation
for the etomidate responses seen in β3 subunit KO animals is due to its effects at α5β1containing receptors. Following this latter scenario, etomidate currents in wild-type mice
would be mediated by a combination of α5β3- and α5β1-containing receptors. Thus,
smaller etomidate currents would be expected in the β3 subunit KO mice as etomidate
would be only affecting α5β1-containing receptors.
Support for the theory that a homeostatic mechanism dictates the observed
etomidate response is reflected in synaptic receptor properties in the β3 subunit KO mice.
Since a reduction in postsynaptic receptors is electrophysiologically reflected by
decreased IPSC amplitude, and the mIPSC peak amplitudes did not differ between
Cre;Hetβ3 and KO mice, it is likely that another type(s) of GABAA receptor is
upregulated to take the place of the non-functional β3-subunit containing receptors. The
results presented here suggest that the α2 subunit primarily clusters with the β3 subunit,
157
as previously shown by Ramadan et al. (2003), since deletion of the β3 subunit reveals
mIPSCs with significantly more rapid mIPSC decay kinetics. Deletion of the β3 subunit
and removal of its associated receptors from the plasma membrane may leave more
rapidly decaying α1 subunit-containing GABAA receptors. Additionally, it is possible
that α1β2- or α1β1-containing receptors are upregulated upon β3 subunit deletion to
further speed mIPSC decay.
Because GABA-mediated tonic current has been shown to affect striatal MSN
excitability and the β3 subunit affects tonic current, further experiments are planned to
link the β3 GABAA receptor subunit with changes in MSN excitability. Furthermore,
global β3 subunit KO mice were observed to have epilepsy (Homanics et al, 1997),
suggestive of the subunits‟ essential role in neuronal excitability.
Many studies have noted the crucial importance of the GABAA receptor β3
subunit; this subunit has been linked to many autism spectrum disorders (Buxbaum et al,
2002; Handforth et al, 2005) and childhood absence epilepsy (Feucht et al, 1999; Urak et
al, 2006). Although the mechanism that links the β3 subunit with these developmental
disorders is unknown, data presented in this thesis suggests that the β3 subunit is
important in cell excitability and tonic current. It is plausible, therefore, that improper
excitation and GABAergic tonic currents may underlie many of the physiological
alterations characteristic of these disorders.
VII.
Potential GABAA Receptor Composition in Striatal MSNs
One of the original goals for my thesis research was to determine the composition
of GABAA receptors in striatonigral and striatopallidal MSNs. Although much of the
158
work presented in this thesis investigates receptor composition one subunit at a time,
together these studies offer unprecedented pharmacological insight into MSN GABAA
receptor composition. Indeed, the studies presented here investigated the function of α4,
β2/β3, and δ subunits using a combination of pharmacological and genetic techniques.
It is possible that D1+ and D2+ MSNs have a similar synaptic receptor
composition since these two types of neurons have similar decay kinetics and respond
similarly to the α1/2 subunit receptor agonist, zolpidem (Ade et al, 2008; personal
observations). Etomidate‟s effects on mIPSCs did not differ between MSN subtypes,
also suggesting that MSNs express similar synaptic receptors. Additionally, etomidate
failed to significantly prolong mIPSC decay kinetics suggesting that synaptic MSN
GABAA receptors contain both β1 and β3 subunits. Therefore, it is likely that both D1+
and D2+ MSN synaptic GABAA receptors are composed of α1β1γ2, α1β3γ2, α2β1γ2,
α2β3γ2 receptors.
Extrasynaptic or perisynaptic GABAA receptors that mediate tonic current have
been shown to differ between D1+ and D2+ MSNs. Pharmacological manipulation of the
α5 subunit revealed that this subunit was primarily expressed on D2+ MSNs (Ade et al,
2008), while pharmacology and genetic deletion of the δ subunit determined that this
subunit was not mediating young MSN tonic current (Janssen et al, 2009), although it
was expressed in MSNs (Ade et al, 2008). In addition, studies presented in this thesis
suggest that the α4 subunit is expressed in both MSN subtypes, with greater
pharmacological effects in D2+ MSNs (see Results, Section Ib). As the β2 subunit was
not found to be expressed in striatal MSNs (Flores-Hernandez et al, 2000), etomidate
sensitivity and subunit immunohistochemistry has shown that both D1+ and D2+ MSN
159
express β3 subunits (see Figure 12). Since these studies did not directly investigate the
presence of the β1 subunit, definitive statements about their expression in MSNs cannot
be made. Assuming that extrasynaptic and perisynaptic GABAA receptors regulate tonic
current, D2+ MSNs are likely to express α4β1γ2, α4β3γ2, α5β1γ2, and α5β3γ2 receptors,
while D1+ MSNs are likely to express α4β1γ2 and α4β3γ2 extrasynaptic receptors, as
well as receptors with an unknown α subunit; extrasynaptic α2 subunit expression is
possible. Whether these combinations of subunits form fully functioning GABAA
receptors has not been explored.
VIII. Developmental Regulation of MSN Tonic Current
Because this thesis research focuses on tonic current in young mice, it is
important to note the developmental changes in GABAA receptor composition (Laurie et
al, 1992) and their potential impact on striatal MSN tonic current. The developmental
regulation of tonic current is clearly demonstrated by the shifts observed in MSN tonic
current patterns (Janssen et al, 2009; Santhakumar et al, 2010). While the α5 subunit was
reported to mediate tonic current in young D2+ MSNs (Ade et al, 2008), this subunit
failed to alter either D1+ or D2+ MSN tonic current in adult mice (Santhakumar et al,
2010). On the other hand, the δ subunit was not found to mediate tonic current in young
mice (Janssen et al, 2009), whereas this subunit was essential to MSN tonic current in
adult animals (Santhakumar et al, 2010). mRNA expression studies have shown that
young striatal tissue expresses primarily α2, α5, β3, and γX GABAA receptor subunits,
while adult tissue abundantly expresses α2, α4, β3, and δ subunits (Laurie et al, 1992).
Importantly, striatal β subunit expression remains intact throughout development,
160
although it is more developmentally regulated in other brain regions (Laurie et al, 1992).
Based on the available data, young MSN tonic current is likely mediated through α5β3γ2
receptors, while tonic current in older MSNs is likely mediated through αXβ3δ receptors.
IX. Functional Implications of Striatal MSN GABAergic Tonic Current
My thesis work has shown that under certain conditions, both striatonigral and
striatopallidal MSNs express tonic GABA currents, regardless of age. These data suggest
that these tonic currents are essential to the maintenance and proper function of striatal
MSNs. In agreement with Ade et al. (2008), I found that blockade of D2+ MSN tonic
current shifts the current versus frequency plots to the right (see Figure 23), suggesting
that GABAergic tonic current facilitates cell excitability.
However, a recent study showed that adult MSN tonic current protects neurons
from excitotoxic cell death (Santhakumar et al, 2010), suggesting that tonic current
reduces neuronal excitability that can lead to cell death. Therefore, my results suggest
that GABAA receptor mediated tonic current enhances MSN excitability, while the study
by Santhakumar et al. (2010) implies that tonic current reduces excitability. These
studies differ not only in the age of animals tested, but also in their ways of observing and
interpreting neuronal excitability. My study focused on young mice, and used whole-cell
electrophysiology in current-clamp mode to determine changes in cell excitability. The
study from Dr. Mody‟s lab investigated tonic current from adult MSNs and determined
excitotoxicity with application of NMDA and measurements of MSN swelling
(Santhakumar et al, 2010). Due to these different experimental parameters, it is possible
that GABA-mediated tonic current exhibits a bimodal effect on neuronal excitability
161
based on the extracellular environment. For example, under basal conditions where the
striatal slice is relatively quiet and MSNs have a hyperpolarized membrane potential,
GABAergic tonic current may be depolarizing and promote neuronal excitation. Under a
barrage of glutamatergic input (mimicked by the application of NMDA), the MSN
membrane potential may sufficiently depolarize so that GABA-mediated tonic current is
inhibitory, to prevent MSNs from potential toxicity and cell death.
X. Inputs to NPY+ Interneurons
The results presented here and in Partridge et al. (2009) on striatal NPY+
interneurons indicate that these interneurons receive inhibitory input. Although several
analyses of sIPSC and mIPSC characteristics did not differ between striatal NPY+
interneurons and MSNs, data from striatally-evoked IPSCs strongly suggest that NPY+
interneurons receive far fewer inhibitory contacts than MSNs. Extensive experiments
investigating short term plasticity and presynaptic release probabilities (see Figures 29,
30) failed to identify a clear explanation for this difference. Most likely, input onto
NPY+ interneurons is sparser than the inhibitory input to MSNs. Or perhaps the
postsynaptic receptors on NPY+ interneurons desensitize more rapidly than those on
MSNs.
While the experiments presented here only suggest that these two populations of
striatal neurons receive different inhibitory input, this research does not investigate or
identify the possible pre-synaptic terminals on NPY+ interneurons. In fact, intrastriatal
stimulation in glutamatergic blockers will stimulate MSN axon collaterals, GABAergic
interneuron axons, cholinergic interneuron axons, and inhibitory axons that originate in
162
the GP. Axons arising from the GP originate from only about a quarter of all pallidal
neurons (Kita & Kitai, 1994), and selectively innervate striatal interneurons (Bevan et al,
1998). While most pallidostriatal terminals make contact with FS/PV+ interneurons,
about 3-32% of terminals make contact with LTS/NPY+ cells on the proximal dendritic
arborization (Bolam et al, 2000), although the extent of their inhibitory input has not been
determined.
Few contacts traveling over a great distance are likely to dampen the postsynaptic
response seen in the striatal interneuron, and may actually make the response negligible.
Although eIPSCs from NPY+ interneurons were smaller in amplitude and exhibited
faster decay kinetics than MSNs, it is likely that NPY+ cells also receive intrastriatal
inhibitory inputs to complement their nearly negligible pallidostriatal inputs. Although
no studies have identified additional pre-synaptic contacts onto LTS/NPY+ interneurons,
the possibility remains that, in addition to pallidal inputs, these neurons receive inhibitory
contacts from within the striatum.
The role that LTS/NPY+ interneurons play in striatal physiology remains unclear
as studies have failed to find synaptic connections between LTS/NPY+ interneurons and
striatal MSNs (Gittis et al, 2010). However, due to their spontaneous firing of action
potentials, these interneurons remain prime candidates for providing the striatal slice with
ambient GABA. If classical synaptic transmission does not occur with these pre-synaptic
neurons, these cells may provide the slice with ambient GABA through volume
transmission (for review, see Agnati et al, 2010). Although this type of communication
has not been shown in the striatum, volume transmission originating from NPYexpressing neurogliaform cells has been shown to provide enough GABA for tonic
163
activation of extrasynaptic receptors in the cortex (Olah et al, 2009). It remains to be
determined if these striatal LTS/NPY+ interneurons communicate with MSNs through
volume transmission; such studies would further establish the crucial role of NPY+
interneurons in the striatal network and pathological diseases.
XI. GABAergic Drugs in the Management and Treatment of Movement
Disorders
Although the causative physiology for many movement disorders has not been
established, it is likely that striatal MSN output may play a role in the processing of
motor control in many movement disorders. My thesis research suggests that MSN
excitability and output is dependent upon GABA-mediated tonic current, and therefore it
is likely that modulating the GABAergic network may ameliorate many symptoms that
are characteristic of movement disorders such as PD, Tourette‟s syndrome, Huntington‟s
disease, tardive dyskinesia, and restless leg syndrome.
While GABAergic drugs are not first-line therapy for any of these movement
disorders, there is sufficient clinical and basic science data to suggest that these agents
may play a role in future therapeutics for movement disorders. My thesis works implies
that MSN excitability and output is largely controlled by GABA-mediated tonic current
(Janssen et al, 2009), and therefore, GABAergic agents may play a pivotal role in future
therapeutics for PD. In the treatment of Tourette‟s syndrome, clinical trials have shown
that baclofen (a GABAB receptor agonist) is effective in controlling tics in children
(Singer et al, 2001), and basic science research has shown that there are altered levels of
PV+ interneurons in the basal ganglia (Kalanithi et al, 2005), suggesting that control of
164
GABA release in basal ganglia structures may alleviate motor tics. While various
treatments with GABAergic agents are being tested in Huntington‟s disease, tiagabine (a
GABA reuptake inhibitor) has shown promise to reverse several behavioral and
biochemical markers characteristic of the disease in experimental animal models (Dhir et
al, 2008). For treatment of tardive dyskinesia, one study has shown preliminary evidence
suggesting that benzodiazepines may have some effects in treatment of this movement
disorder (Bhoopathi et al, 2006). Although dopaminergic agents are currently the firstline therapy for treatment of restless leg syndrome, gabapentin (a GABA analogue) has
shown to be beneficial in some clinical trials (Merlino et al, 2009).
It is likely that
GABAergic drugs will be utilized in the management and treatment of many movement
disorders in the near future.
XII.
Implications to Parkinson’s Disease Research
The data presented here offers a possible mechanism by which striatal MSN
excitability becomes imbalanced during PD. Specifically, PD is characterized by
increased excitability and output of striatopallidal D2+ MSNs, while the striatonigral
pathway exhibits decreased activity (Raz et al, 2000; Galeffi et al, 2003; Starr et al, 2005;
Mallet et al, 2006). These imbalances result in the inability to move effectively. While
previous work has shown that GABAergic tonic conductance modulates MSN
excitability (Ade et al, 2008), this thesis work suggests three additionally important
concepts in regards to the generation and treatment of this disease. First, dopamine alters
both inhibitory tonic conductance and MSN excitability. My data show that application
of a D2R-like agonist decreases both the D2+ MSN tonic current and D2+ MSN
165
excitability. It is likely that the converse is also true: dopamine depletion increases D2+
MSN excitability (Day et al, 2006; Mallet et al, 2006; Shen et al, 2007; Day et al, 2008).
Secondly, dopamine modulation of tonic inhibition is mediated through its interactions
with the PKA phosphorylation cascade. Lastly, GABAA receptor β3 subunits are largely
responsible for tonic current in MSNs. These data suggest additional means of regulating
MSN output, and present a possible therapeutic avenue for alleviating PD symptoms that
arise due to imbalances in the striatal output pathways.
166
CONCLUSIONS
In the mouse, D1+ and D2+ MSNs constitute unique projection pathways to the
substantia nigra pars reticulata and globus pallidus, respectively.
GABA-mimetic etomidate effects are selective for the β3 subunit in recombinant
receptors expressed in HEK cells, although etomidate‟s ability to potentiate
GABA currents appears to depend on both α and β subunits.
D2+ MSNs express enhanced etomidate current compared to D1+ MSNs,
suggesting that these cell types differ in their expression of functional β3 subunits.
Intracellular PKA application increases D1+ MSN tonic current. Enhanced
etomidate responses suggest that D1+ MSN tonic current is mediated through a
phosphorylated β3 subunit.
Intracellular PKI application reduces D2+ MSN tonic currents, suggesting the
basal D2+ MSN tonic current is mediated via basally phosphorylated β3 subunits.
Dopamine release in the striatal slice preparation is low, and dopamine receptors
remain unstimulated.
D2-like agonists decrease D2+ MSN tonic current, presumably through
dephosphorylated β3 subunits, while D1-like agonists increase D1+ MSN tonic
current through phosphorylated β3 subunits.
Current-clamp experiments show that the D2-like agonist quinpirole reduces D2+
MSN excitability, suggesting that D2+ tonic current is excitatory.
Drd2-β3 subunit KO animals express significantly less tonic current than wildtype mice, suggesting that the β3 subunit is imperative to D2+ MSN tonic current.
167
NPY+ interneurons and MSNs express similar synaptic GABAA receptor
populations.
Intrastriatal stimulation suggests that MSNs receive more inhibitory input than
NPY+ interneurons due to prolonged evoked IPSC decay kinetics.
168
APPENDIX
Order Details: JOURNAL OF NEUROSCIENCE
Order detail ID: 42331428
ISSN: 0270-6474
Publication Year: 2010
Publisher: SOCIETY FOR NEUROSCIENCE
Rightsholder: SOCIETY FOR NEUROSCIENCE
Author/Editor: Planert et al
Permission Status: Granted
Permission type: Republish into a book, journal, newsletter…
Requested use: Dissertation
Republishing organization: GEORGETOWN UNIVERSITY
Organization status: Not for profit
Republication date: 07/02/2010
Circulation/Distribution: 1
Type of content: Figure, diagram, or table
Description of requested content: Figure 1, Panel C
Page range(s): 3501
Requested content's publication date: 03/03/2010
Order Details: JOURNAL OF NEUROSCIENCE
Order detail ID: 42331427
ISSN: 0270-6474
Publication Year: 2009
Publisher: SOCIETY FOR NEUROSCIENCE
Rightsholder: SOCIETY FOR NEUROSCIENCE
Author/Editor: Janssen et al
Permission Status: Granted
Permission type: Republish into a book, journal, newsletter…
Requested use: Dissertation
Republishing organization: GEORGETOWN UNIVERSITY
Organization status: Not for profit
Republication date: 07/02/2010
Circulation/Distribution: 1
Type of content: Selected pages
Description of requested content: Figures 1-8
Page range(s): 5117-5124
Number of pages: 8
Requested content's publication date: 04/22/2009
169
Order Details: JOURNAL OF NEUROPHYSIOLOGY
Order detail ID: 42331426
ISSN: 0022-3077
Publication Year: 2009
Publisher: AMERICAN PHYSIOLOGICAL SOCIETY [ETC.]
Rightsholder: AMERICAN PHYSIOLOGICAL SOCIETY
Author/Editor: Partridge et al
Permission Status: Granted
Permission type: Republish into a book, journal, newsletter…
Requested use: Dissertation
Republishing organization: GEORGETOWN UNIVERSITY
Organization status: Not for profit
Republication date: 07/02/2010
Circulation/Distribution: 1
Type of content: Selected pages
Description of requested content: Figures 3 and 6
Page range(s): 3041, 3043
Number of pages: 2
Requested content's publication date: 09/16/2009
License Number: 2427141041878
License date: May 13, 2010
License content publisher: Nature Publishing Group
License content publication: Nature Reviews Neuroscience
Licensed content Ttitle: Variations on an inhibitory theme: phasic and tonic activations of
GABAA receptors
Licensed content author: Mark Farrant, Zoltan Nusser
Year of Publication: 2005
Portion used: Figures/tables
Number of figures/tables: 1
Requestor Type: Student
Type of Use: Thesis/Dissertation
License Number: 2427141224801
License date: May 13, 2010
License content publisher: Nature Publishing Group
License content publication: Nature Neuroscience
Licensed content Ttitle: Indirect-pathway neurons lose their spines in Parkinson disease
Licensed content author: Charles R Gerfen
Year of Publication: 2006
Portion used: Figures/tables
Number of figures/tables: 1
Requestor Type: Student
Type of Use: Thesis/Dissertation
170
REFERENCES
Ade KK, Janssen MJ, Ortinski PI, Vicini S. (2008) Differential tonic GABA
conductances in striatal medium spiny neurons. J Neurosci. 28(5):1185-97.
Agnati LF, Guidolin D, Guescini M, Genedani S, Fuxe K. (2010) Understanding wiring
and volume transmission. Brain Res Rev. 64(1):137-159.
Aizman O, Brismar H, Uhlén P, Zettergren E, Levey AI, Forssberg H, Greengard P,
Aperia A. (2000) Anatomical and physiological evidence for D1 and D2 dopamine
receptor colocalization in neostriatal neurons. Nat Neurosci. 3(3):226-30.
Akaike A, Ohno Y, Sasa M, Takaori S. (1987) Excitatory and inhibitory effects of
dopamine on neuronal activity of the caudate nucleus neurons in vitro. Brain Res.
418(2):262-72.
Angelotti TP, Uhler MD, Macdonald RL. (1993) Enhancement of recombinant gammaaminobutyric acid type A receptor currents by chronic activation of cAMP-dependent
protein kinase. Mol Pharmacol. 44(6):1202-10.
Aosaki T, Kiuchi K, Kawaguchi Y. (1998) Dopamine D1-like receptor activation excites
rat striatal large aspiny neurons in vitro. J Neurosci. 18(14):5180-90.
Arias-Montaño JA, Floran B, Floran L, Aceves J, Young JM. (2007) Dopamine D(1)
receptor facilitation of depolarization-induced release of gamma-amino-butyric acid in rat
striatum is mediated by the cAMP/PKA pathway and involves P/Q-type calcium
channels. Synapse. 61(5):310-9.
Asaumi Y, Hasuo H, Akasu T. (2006) J Neurophysiol. 96(2):591-601. Dopamine
presynaptically depresses fast inhibitory synaptic transmission via D4 receptor-protein
kinase A pathway in the rat dorsolateral septal nucleus.
Augood SJ, Emson PC. (1994) Adenosine A2a receptor mRNA is expressed by
enkephalin cells but not by somatostatin cells in rat striatum: a co-expression study. Brain
Res Mol Brain Res. 22(1-4):204-10.
Azdad K, Chàvez M, Don Bischop P, Wetzelaer P, Marescau B, De Deyn PP, Gall D,
Schiffmann SN. (2009) Homeostatic plasticity of striatal neurons intrinsic excitability
following dopamine depletion. PLoS One. 4(9):6908.
Bannai H, Lévi S, Schweizer C, Inoue T, Launey T, Racine V, Sibarita JB, Mikoshiba K,
Triller A. (2009) Activity-dependent tuning of inhibitory neurotransmission based on
GABAAR diffusion dynamics. Neuron. 62(5):670-82.
Bargas J, Galarraga E, Aceves J. (1988) Electrotonic properties of neostriatal neurons are
modulated by extracellular potassium. Exp Brain Res. (2):390-8.
171
Barnard EA, Skolnick P, Olsen RW, Mohler H, Sieghart W, Biggio G, Braestrup C,
Bateson AN, Langer SZ. (1998) International Union of Pharmacology. XV. Subtypes of
gamma-aminobutyric acidA receptors: classification on the basis of subunit structure and
receptor function. Pharmacol Rev. 50(2):291-313.
Bedford FK, Kittler JT, Muller E, Thomas P, Uren JM, Merlo D, Wisden W, Triller A,
Smart TG, Moss SJ. (2001) GABA(A) receptor cell surface number and subunit stability
are regulated by the ubiquitin-like protein Plic-1. Nat Neurosci. 4(9):908-16.
Belelli D, Callachan H, Hill-Venning C, Peters JA, Lambert JJ. (1996) Interaction of
positive allosteric modulators with human and Drosophila recombinant GABA receptors
expressed in Xenopus laevis oocytes. Br J Pharmacol. 118(3):563-76.
Bennett BD, Bolam JP. (1993) Characterization of calretinin-immunoreactive structures
in the striatum of the rat. Brain Res. 609(1-2):137-48.
Bennett BD, Bolam JP. (1994) Synaptic input and output of parvalbuminimmunoreactive neurons in the neostriatum of the rat. Neuroscience. 62(3):707-19.
Bennett BD, Wilson CJ. (1998) Synaptic regulation of action potential timing in
neostriatal cholinergic interneurons. J Neurosci.18(20):8539-49.
Bevan MD, Booth PA, Eaton SA, Bolam JP. (1998) Selective innervation of neostriatal
interneurons by a subclass of neuron in the globus pallidus of the rat. J Neurosci.
18(22):9438-52.
Bhoopathi PS, Soares-Weiser K. (2006) Benzodiazepines for neuroleptic-induced tardive
dyskinesia. Cochrane Database Syst Rev. 19;3:CD000205.
Bianchi MT, Haas KF, Macdonald RL. (2001) Structural determinants of fast
desensitization and desensitization-deactivation coupling in GABAa receptors. J
Neurosci. 21(4):1127-36.
Bianchi MT, Haas KF, Macdonald RL. (2002) Alpha1 and alpha6 subunits specify
distinct desensitization, deactivation and neurosteroid modulation of GABA(A) receptors
containing the delta subunit. Neuropharmacology. 43(4):492-502.
Bibb JA, Snyder GL, Nishi A, Yan Z, Meijer L, Fienberg AA, Tsai LH, Kwon YT,
Girault JA, Czernik AJ, Huganir RL, Hemmings HC Jr, Nairn AC, Greengard P. (1999)
Phosphorylation of DARPP-32 by Cdk5 modulates dopamine signalling in neurons.
Nature. 1999 402(6762):669-71.
Bogdanov Y, Michels G, Armstrong-Gold C, Haydon PG, Lindstrom J, Pangalos M,
Moss SJ. (2006) Synaptic GABAA receptors are directly recruited from their
extrasynaptic counterparts. EMBO J. 25(18):4381-9.
172
Bolam JP, Hanley JJ, Booth PA, Bevan MD. (2000) Synaptic organisation of the basal
ganglia. J Anat. 196(4):527-42.
Bolam JP, Ingham CA, Izzo PN, Levey AI, Rye DB, Smith AD, Wainer BH. (1986)
Substance P-containing terminals in synaptic contact with cholinergic neurons in the
neostriatum and basal forebrain: a double immunocytochemical study in the rat. Brain
Res. 397(2):279-89.
Bolam JP, Somogyi P, Takagi H, Fodor I, Smith AD. (1983) Localization of substance Plike immunoreactivity in neurons and nerve terminals in the neostriatum of the rat: a
correlated light and electron microscopic study. J Neurocytol. 12(2):325-44.
Bolam JP, Wainer BH, Smith AD. (1984) Characterization of cholinergic neurons in the
rat neostriatum. A combination of choline acetyltransferase immunocytochemistry,
Golgi-impregnation and electron microscopy. Neuroscience. 12(3):711-8.
Bormann J, Hamill OP, Sakmann B. (1987) Mechanism of anion permeation through
channels gated by glycine and gamma-aminobutyric acid in mouse cultured spinal
neurones. J Physiol. 385:243-86.
Bormann J. (1988) Electrophysiology of GABAA and GABAB receptor subtypes. Trends
Neurosci. 11(3):112-6.
Bormann J. (2000) The 'ABC' of GABA receptors. Trends Pharmacol Sci. 21(1):16-9.
Bracci E, Centonze D, Bernardi G, Calabresi P. (2007) Dopamine excites fast-spiking
interneurons in the striatum. J Neurophysiol. 87(4):2190-4.
Brandon NJ, Delmas P, Kittler JT, McDonald BJ, Sieghart W, Brown DA, Smart TG,
Moss SJ. (2000) GABAA receptor phosphorylation and functional modulation in cortical
neurons by a protein kinase C-dependent pathway. J Biol Chem. 275(49):38856-62.
Brandon NJ, Jovanovic JN, Colledge M, Kittler JT, Brandon JM, Scott JD, Moss SJ.
(2003) A-kinase anchoring protein 79/150 facilitates the phosphorylation of GABA(A)
receptors by cAMP-dependent protein kinase via selective interaction with receptor beta
subunits. Mol Cell Neurosci. 22(1):87-97.
Brandon NJ, Jovanovic JN, Smart TG, Moss SJ. (2002) Receptor for activated C kinase-1
facilitates protein kinase C-dependent phosphorylation and functional modulation of
GABA(A) receptors with the activation of G-protein-coupled receptors. J Neurosci.
22(15):6353-61.
Brandon NJ, Uren JM, Kittler JT, Wang H, Olsen R, Parker PJ, Moss SJ. (1999) Subunitspecific association of protein kinase C and the receptor for activated C kinase with
GABA type A receptors. J Neurosci. 19(21):9228-34.
173
Brickley SG, Cull-Candy SG, Farrant M. (1996) Development of a tonic form of synaptic
inhibition in rat cerebellar granule cells resulting from persistent activation of GABAA
receptors. J Physiol. 497(Pt 3):753-9.
Brown LL, Smith DM, Goldbloom LM. (1998) Organizing principles of cortical
integration in the rat neostriatum: corticostriate map of the body surface is an ordered
lattice of curved laminae and radial points. J Comp Neurol. 392(4):468-88.
Brown N, Kerby J, Bonnert TP, Whiting PJ, Wafford KA. (2002) Pharmacological
characterization of a novel cell line expressing human alpha(4)beta(3)delta GABA(A)
receptors. Br J Pharmacol. 136(7):965-74.
Brünig I, Scotti E, Sidler C, Fritschy JM. (2002) Intact sorting, targeting, and clustering
of gamma-aminobutyric acid A receptor subtypes in hippocampal neurons in vitro. J
Comp Neurol. 443(1):43-55.
Brünig I, Sommer M, Hatt H, Bormann J. (1999) Dopamine receptor subtypes modulate
olfactory bulb gamma-aminobutyric acid type A receptors. Proc Natl Acad Sci U S A.
96(5):2456-60.
Brussaard AB, Wossink J, Lodder JC, Kits KS. (2000) Progesterone-metabolite prevents
protein kinase C-dependent modulation of gamma-aminobutyric acid type A receptors in
oxytocin neurons. Proc Natl Acad Sci U S A. 97(7):3625-30.
Buxbaum JD, Silverman JM, Smith CJ, Greenberg DA, Kilifarski M, Reichert J, Cook
EH Jr, Fang Y, Song CY, Vitale R. (2002) Association between a GABRB3
polymorphism and autism. Mol Psychiatry. 7(3):311-6.
Calabresi P, Centonze D, Gubellini P, Pisani A, Bernardi G. (2000) Acetylcholinemediated modulation of striatal function. Trends Neurosci. 23(3):120-6.
Calabresi P, Mercuri N, Stanzione P, Stefani A, Bernardi G. (1987) Intracellular studies
on the dopamine-induced firing inhibition of neostriatal neurons in vitro: evidence for D1
receptor involvement. Neuroscience. 20(3):757-71.
Canals M, Marcellino D, Fanelli F, Ciruela F, de Benedetti P, Goldberg SR, Neve K,
Fuxe K, Agnati LF, Woods AS, Ferré S, Lluis C, Bouvier M, Franco R. (2003)
Adenosine A2A-dopamine D2 receptor-receptor heteromerization: qualitative and
quantitative assessment by fluorescence and bioluminescence energy transfer. J Biol
Chem. 278(47):46741-9.
Caraiscos VB, Elliott EM, You-Ten KE, Cheng VY, Belelli D, Newell JG, Jackson MF,
Lambert JJ, Rosahl TW, Wafford KA, MacDonald JF, Orser BA. (2004) Tonic inhibition
in mouse hippocampal CA1 pyramidal neurons is mediated by alpha5 subunit-containing
gamma-aminobutyric acid type A receptors. Proc Natl Acad Sci U S A 101(10):3662-7.
174
Carvalho AL, Duarte CB, Carvalho AP. (2000) Regulation of AMPA receptors by
phosphorylation. Neurochem Res. 25(9-10):1245-55.
Centonze D, Bracci E, Pisani A, Gubellini P, Bernardi G, Calabresi P. (2002) Activation
of dopamine D1-like receptors excites LTS interneurons of the striatum. Eur J Neurosci.
15(12):2049-52.
Centonze D, Usiello A, Gubellini P, Pisani A, Borrelli E, Bernardi G, Calabresi P. (2002)
Dopamine D2 receptor-mediated inhibition of dopaminergic neurons in mice lacking
D2L receptors. Neuropsychopharmacology. 27(5):723-6.
Chahine M, Ziane R, Vijayaragavan K, Okamura Y. (2005) Regulation of Na v channels
in sensory neurons. Trends Pharmacol Sci. 26(10):496-502.
Chang HT, Kita H. (1992) Interneurons in the rat striatum: relationships between
parvalbumin neurons and cholinergic neurons. Brain Res. 574(1-2):307-11.
Chen BS, Roche KW. (2007) Regulation of NMDA receptors by phosphorylation.
Neuropharmacology. 53(3):362-8.
Chen G, Kittler JT, Moss SJ, Yan Z. (2006) Dopamine D3 receptors regulate GABAA
receptor function through a phospho-dependent endocytosis mechanism in nucleus
accumbens. J Neurosci. 26(9):2513-21.
Chesselet MF, Robbins E. (1989) Characterization of striatal neurons expressing high
levels of glutamic acid decarboxylase messenger RNA. Brain Res. 492(1-2):237-44.
Choi DS, Wei W, Deitchman JK, Kharazia VN, Lesscher HM, McMahon T, Wang D, Qi
ZH, Sieghart W, Zhang C, Shokat KM, Mody I, Messing RO. (2008) Protein kinase
Cdelta regulates ethanol intoxication and enhancement of GABA-stimulated tonic
current. J Neurosci. 28(46):11890-9.
Cicchetti F, Beach TG, Parent A. (1998) Chemical phenotype of calretinin interneurons
in the human striatum. Synapse. 30(3):284-97.
Ciruela F, Burgueño J, Casadó V, Canals M, Marcellino D, Goldberg SR, Bader M, Fuxe
K, Agnati LF, Lluis C, Franco R, Ferré S, Woods AS. (2004) Combining mass
spectrometry and pull-down techniques for the study of receptor heteromerization. Direct
epitope-epitope electrostatic interactions between adenosine A2A and dopamine D2
receptors. Anal Chem. 76(18):5354-63.
Cobb SR, Buhl EH, Halasy K, Paulsen O, Somogyi P. (1995) Synchronization of
neuronal activity in hippocampus by individual GABAergic interneurons. Nature.
378(6552):75-8.
175
Consolo S, Girotti P, Russi G, Di Chiara G. (1992) Endogenous dopamine facilitates
striatal in vivo acetylcholine release by acting on D1 receptors localized in the striatum. J
Neurochem. 59(4):1555-7.
Cooper AJ, Stanford IM. (2001) Dopamine D2 receptor mediated presynaptic inhibition
of striatopallidal GABA(A) IPSCs in vitro. Neuropharmacology. 41(1):62-71.
Cope DW, Hughes SW, Crunelli V. (2005) GABAA receptor-mediated tonic inhibition in
thalamic neurons. J Neurosci. 25(50):11553-63.
Cowan RL, Wilson CJ, Emson PC, Heizmann CW. (1990) Parvalbumin-containing
GABAergic interneurons in the rat neostriatum. J Comp Neurol. 302(2):197-205.
Craig AM, Blackstone CD, Huganir RL, Banker G. (1994) Selective clustering of
glutamate and gamma-aminobutyric acid receptors opposite terminals releasing the
corresponding neurotransmitters. Proc Natl Acad Sci U S A. 91(26):12373-7.
Cross TG, Scheel-Toellner D, Henriquez NV, Deacon E, Salmon M, Lord JM. (2000)
Serine/threonine protein kinases and apoptosis. Exp Cell Res. 256(1):34-41.
Cunha RA. (2001) Regulation of the ecto-nucleotidase pathway in rat hippocampal nerve
terminals. Neurochem Res. 26(8-9):979-91.
Czubayko U, Plenz D. (2002) Fast synaptic transmission between striatal spiny projection
neurons. Proc Natl Acad Sci U S A. 99(24):15764-9.
Damsma G, Tham CS, Robertson GS, Fibiger HC. (1990) Dopamine D1 receptor
stimulation increases striatal acetylcholine release in the rat. Eur J Pharmacol. 186(23):335-8.
Day M, Wang Z, Ding J, An X, Ingham CA, Shering AF, Wokosin D, Ilijic E, Sun Z,
Sampson AR, Mugnaini E, Deutch AY, Sesack SR, Arbuthnott GW, Surmeier DJ. (2006)
Selective elimination of glutamatergic synapses on striatopallidal neurons in Parkinson
disease models. Nat Neurosci. 9(2):251-9.
Day M, Wokosin D, Plotkin JL, Tian X, Surmeier DJ. (2008) Differential excitability and
modulation of striatal medium spiny neuron dendrites. J Neurosci. 28(45):11603-14.
DeBoer P, Westerink BH. (1994) GABAergic modulation of striatal cholinergic
interneurons: an in vivo microdialysis study. J Neurochem. 62(1):70-5.
Delgado A, Sierra A, Querejeta E, Valdiosera RF, Aceves J. (2000) Inhibitory control of
the GABAergic transmission in the rat neostriatum by D2 dopamine receptors.
Neuroscience. 95(4):1043-8.
176
Dhir A, Akula KK, Kulkarni SK. (2008) Tiagabine, a GABA uptake inhibitor, attenuates
3-nitropropionic acid-induced alterations in various behavioral and biochemical
parameters in rats. Prog Neuropsychopharmacol Biol Psychiatry. 32(3):835-43.
Drasbek KR, Jensen K. (2006) THIP, a hypnotic and antinociceptive drug, enhances an
extrasynaptic GABAA receptor-mediated conductance in mouse neocortex. Cereb
Cortex. 16(8):1134-41.
Ducić I, Caruncho HJ, Zhu WJ, Vicini S, Costa E. (1995) gamma-Aminobutyric acid
gating of Cl- channels in recombinant GABAA receptors. J Pharmacol Exp Ther.
272(1):438-45.
Essrich C, Lorez M, Benson JA, Fritschy JM, Lüscher B. (1998) Postsynaptic clustering
of major GABAA receptor subtypes requires the gamma 2 subunit and gephyrin. Nat
Neurosci. 1(7):563-71.
Farrant M, Nusser Z. (2005) Variations on an inhibitory theme: phasic and tonic
activation of GABA(A) receptors. Nat Rev Neurosci. 6(3):215-29.
Feigenspan A, Bormann J. (1994) Facilitation of GABAergic signaling in the retina by
receptors stimulating adenylate cyclase. Proc Natl Acad Sci U S A. 91(23):10893-7.
Ferguson C, Hardy SL, Werner DF, Hileman SM, Delorey TM, Homanics GE. (2007)
New insight into the role of the beta3 subunit of the GABAA-R in development,
behavior, body weight regulation, and anesthesia revealed by conditional gene knockout.
BMC Neurosci. 8:85.
Ferré S, Fredholm BB, Morelli M, Popoli P, Fuxe K. (1997) Adenosine-dopamine
receptor-receptor interactions as an integrative mechanism in the basal ganglia. Trends
Neurosci. 20(10):482-7.
Ferré S, Torvinen M, Antoniou K, Irenius E, Civelli O, Arenas E, Fredholm BB, Fuxe K.
(1998) Adenosine A1 receptor-mediated modulation of dopamine D1 receptors in stably
cotransfected fibroblast cells. J Biol Chem. 273(8):4718-24.
Ferré S, von Euler G, Johansson B, Fredholm BB, Fuxe K. (1991) Stimulation of highaffinity adenosine A2 receptors decreases the affinity of dopamine D2 receptors in rat
striatal membranes. Proc Natl Acad Sci U S A. 88(16):7238-41.
Feucht M., Fuchs K., Pichlbauer E., Hornik K., Scharfetter J., Goessler R., Fureder T.,
Cvetkovic N., Sieghart W., Kasper S., et al. (1999) Possible association between
childhood absence epilepsy and the gene encoding GABRB3. Biol. Psychiat. 46:997–
1002.
177
Ficker E, Taglialatela M, Wible BA, Henley CM, Brown AM. (1994) Spermine and
spermidine as gating molecules for inward rectifier K+ channels. Science. 1994
266(5187):1068-72.
Figueredo-Cardenas G, Morello M, Sancesario G, Bernardi G, Reiner A. (1996)
Colocalization of somatostatin, neuropeptide Y, neuronal nitric oxide synthase and
NADPH-diaphorase in striatal interneurons in rats. Brain Res. 735(2):317-24.
Filippova N, Sedelnikova A, Zong Y, Fortinberry H, Weiss DS. (2000) Regulation of
recombinant gamma-aminobutyric acid (GABA)(A) and GABA(C) receptors by protein
kinase C. Mol Pharmacol. 57(5):847-56.
Fink JS, Weaver DR, Rivkees SA, Peterfreund RA, Pollack AE, Adler EM, Reppert SM.
(1992) Molecular cloning of the rat A2 adenosine receptor: selective co-expression with
D2 dopamine receptors in rat striatum. Brain Res Mol Brain Res. 14(3):186-95.
Fino E, Glowinski J, Venance L. (2007) Effects of acute dopamine depletion on the
electrophysiological properties of striatal neurons. Neurosci Res. 58(3):305-16.
Fisher JL, Hinkle DJ, Macdonald RL. (2000) Loreclezole inhibition of recombinant
alpha1beta1gamma2L GABA(A) receptor single channel currents. Neuropharmacology.
39(2):235-45.
Fisher JL, Macdonald RL. (1997) Single channel properties of recombinant GABAA
receptors containing gamma 2 or delta subtypes expressed with alpha 1 and beta 3
subtypes in mouse L929 cells. J Physiol. 505 2):283-97.
Floran B, Gonzalez B, Florán L, Erlij D, Aceves J. (2005) Interactions between adenosine
A(2a) and dopamine D2 receptors in the control of [(3)H]GABA release in the globus
pallidus of the rat. Eur J Pharmacol. 520(1-3):43-50.
Flores-Hernandez J, Hernandez S, Snyder GL, Yan Z, Fienberg AA, Moss SJ, Greengard
P, Surmeier DJ. (2000) D(1) dopamine receptor activation reduces GABA(A) receptor
currents in neostriatal neurons through a PKA/DARPP-32/PP1 signaling cascade. J
Neurophysiol. 83(5):2996-3004.
Foster JD, Pananusorn B, Cervinski MA, Holden HE, Vaughan RA. (2003) Dopamine
transporters are dephosphorylated in striatal homogenates and in vitro by protein
phosphatase 1. Brain Res Mol Brain Res. 110(1):100-8.
Fu LY, van den Pol AN. (2007) GABA excitation in mouse hilar neuropeptide Y
neurons. J Physiol. 579(Pt 2):445-64.
Galarreta M, Hestrin S. (2001) Electrical synapses between GABA-releasing
interneurons. Nat Rev Neurosci. (6):425-33.
178
Galeffi F, Bianchi L, Bolam JP, Della Corte L. (2003) The effect of 6-hydroxydopamine
lesions on the release of amino acids in the direct and indirect pathways of the basal
ganglia: a dual microdialysis probe analysis. Eur J Neurosci. 18(4):856-68.
Gerfen CR, Baimbridge KG, Miller JJ. (1985) The neostriatal mosaic: compartmental
distribution of calcium-binding protein and parvalbumin in the basal ganglia of the rat
and monkey. Proc Natl Acad Sci U S A. 82(24):8780-4.
Gerfen CR, Engber TM, Mahan LC, Susel Z, Chase TN, Monsma FJ Jr, Sibley DR.
(1990) D1 and D2 dopamine receptor-regulated gene expression of striatonigral and
striatopallidal neurons. Science. 250(4986):1429-32.
Gerfen CR. (1992) The neostriatal mosaic: multiple levels of compartmental organization
in the basal ganglia. Annu Rev Neurosci. 15:285-320.
Gerfen CR. (2004) The basal ganglia. In: The rat nervous system, Ed 3 (Paxinos G, ed),
pp 455–508. New York: Academic.
Gertler TS, Chan CS, Surmeier DJ. (2008) Dichotomous anatomical properties of adult
striatal medium spiny neurons. J Neurosci. 28(43):10814-24.
Gibson JR, Beierlein M, Connors BW. (1999) Two networks of electrically coupled
inhibitory neurons in neocortex. Nature. 402(6757):75-9.
Ginés S, Hillion J, Torvinen M, Le Crom S, Casadó V, Canela EI, Rondin S, Lew JY,
Watson S, Zoli M, Agnati LF, Verniera P, Lluis C, Ferré S, Fuxe K, Franco R. (2000)
Dopamine D1 and adenosine A1 receptors form functionally interacting heteromeric
complexes. Proc Natl Acad Sci U S A. 97(15):8606-11.
Gittis AH, Nelson AB, Thwin MT, Palop JJ, Kreitzer AC. (2010) Distinct roles of
GABAergic interneurons in the regulation of striatal output pathways. J Neurosci.
30(6):2223-34.
Glykys J, Mody I. (2007) Activation of GABAA receptors: views from outside the
synaptic cleft. 56(5):763-70.
Glykys J, Peng Z, Chandra D, Homanics GE, Houser CR, Mody I. (2007) A new
naturally occurring GABA(A) receptor subunit partnership with high sensitivity to
ethanol. Nat Neurosci. 10(1):40-8.
Gong S, Doughty M, Harbaugh CR, Cummins A, Hatten ME, Heintz N, Gerfen CR.
Targeting Cre recombinase to specific neuron populations with bacterial artificial
chromosome constructs. (2007) J Neurosci. 27(37):9817-23.
179
Gong S, Zheng C, Doughty ML, Losos K, Didkovsky N, Schambra UB, Nowak NJ,
Joyner A, Leblanc G, Hatten ME, Heintz N. (2003) A gene expression atlas of the central
nervous system based on bacterial artificial chromosomes. Nature. 425(6961):917-25.
Graveland GA, DiFiglia M. (1985) The frequency and distribution of medium-sized
neurons with indented nuclei in the primate and rodent neostriatum. Brain Res. 327(12):307-11.
Graybiel AM, Ragsdale CW Jr. (1978) Histochemically distinct compartments in the
striatum of human, monkeys, and cat demonstrated by acetylthiocholinesterase staining.
Proc Natl Acad Sci U S A. 75(11):5723-6.
Greengard P, Allen PB, Nairn AC. (1999) Beyond the dopamine receptor: the DARPP32/protein phosphatase-1 cascade. Neuron. 23(3):435-47.
Gustafson N, Gireesh-Dharmaraj E, Czubayko U, Blackwell KT, Plenz D. (2006) A
comparative voltage and current-clamp analysis of feedback and feedforward synaptic
transmission in the striatal microcircuit in vitro. J Neurophysiol. 95(2):737-52.
Guzmán JN, Hernández A, Galarraga E, Tapia D, Laville A, Vergara R, Aceves J, Bargas
J. (2003) Dopaminergic modulation of axon collaterals interconnecting spiny neurons of
the rat striatum. J Neurosci. 23(26):8931-40.
Haas KF, Macdonald RL. (1999) GABAA receptor subunit gamma2 and delta subtypes
confer unique kinetic properties on recombinant GABAA receptor currents in mouse
fibroblasts. J Physiol. 514 (1):27-45.
Handforth A, DeLorey TM, Homanics GE, Olsen RW. (2005) Pharmacologic evidence
for abnormal thalamocortical functioning in GABAA receptor beta3 subunit-deficient
mice, a model of Angelman Syndrome. Epilepsia 46(12)1860-1870.
Harsing LG Jr, Zigmond MJ. (1997) Influence of dopamine on GABA release in
striatum: evidence for D1-D2 interactions and non-synaptic influences. Neuroscience.
77(2):419-29.
Hemmings HC Jr, Greengard P, Tung HY, Cohen P. (1984) DARPP-32, a dopamineregulated neuronal phosphoprotein, is a potent inhibitor of protein phosphatase-1. Nature.
310(5977):503-5.
Herd MB, Haythornthwaite AR, Rosahl TW, Wafford KA, Homanics GE, Lambert JJ,
Belelli D. (2008) The expression of GABAA beta subunit isoforms in synaptic and
extrasynaptic receptor populations of mouse dentate gyrus granule cells. J Physiol.
586(4):989-1004.
180
Hernández-Echeagaray E, Galarraga E, Bargas J. (1998) 3-Alpha-chloro-imperialine, a
potent blocker of cholinergic presynaptic modulation of glutamatergic afferents in the rat
neostriatum. Neuropharmacology. 37(12):1493-502.
Hernández-López S, Bargas J, Surmeier DJ, Reyes A, Galarraga E. (1997) D1 receptor
activation enhances evoked discharge in neostriatal medium spiny neurons by modulating
an L-type Ca2+ conductance. J Neurosci. 17(9):3334-42.
Hernández-López S, Tkatch T, Perez-Garci E, Galarraga E, Bargas J, Hamm H, Surmeier
DJ. (2000) D2 dopamine receptors in striatal medium spiny neurons reduce L-type Ca2+
currents and excitability via a novel PLC[beta]1-IP3-calcineurin-signaling cascade. J
Neurosci. 20(24):8987-95.
Herring D, Huang R, Singh M, Dillon GH, Leidenheimer NJ. (2005) PKC modulation of
GABAA receptor endocytosis and function is inhibited by mutation of a dileucine motif
within the receptor beta 2 subunit. Neuropharmacology 48(2):181-94.
Herring D, Huang R, Singh M, Robinson LC, Dillon GH, Leidenheimer NJ. (2003)
Constitutive GABAA receptor endocytosis is dynamin-mediated and dependent on a
dileucine AP2 adaptin-binding motif within the beta 2 subunit of the receptor. J Biol
Chem. 278(26):24046-52.
Hersch SM, Gutekunst CA, Rees HD, Heilman CJ, Levey AI. (2004) Distribution of m1m4 muscarinic receptor proteins in the rat striatum: light and electron microscopic
immunocytochemistry using subtype-specific antibodies. J Neurosci. 14(5):3351-63.
Heuschneider G, Schwartz RD. (1989) cAMP and forskolin decrease gammaaminobutyric acid-gated chloride flux in rat brain synaptoneurosomes. Proc Natl Acad
Sci U S A. 86(8):2938-42.
Hevers W, Lüddens H. (2002) Pharmacological heterogeneity of gamma-aminobutyric
acid receptors during development suggests distinct classes of rat cerebellar granule cells
in situ. Neuropharmacology. 42(1):34-47.
Hillion J, Canals M, Torvinen M, Casado V, Scott R, Terasmaa A, Hansson A, Watson S,
Olah ME, Mallol J, Canela EI, Zoli M, Agnati LF, Ibanez CF, Lluis C, Franco R, Ferre S,
Fuxe K. (2002) Coaggregation, cointernalization, and codesensitization of adenosine
A2A receptors and dopamine D2 receptors. J Biol Chem. 277(20):18091-7.
Hill-Venning C, Belelli D, Peters JA, Lambert JJ. (1997) Subunit-dependent interaction
of the general anaesthetic etomidate with the gamma-aminobutyric acid type A receptor.
Br J Pharmacol. 120(5):749-56.
Hinkle DJ, Macdonald RL. (2003) Beta subunit phosphorylation selectively increases fast
desensitization and prolongs deactivation of alpha1beta1gamma2L and
alpha1beta3gamma2L GABA(A) receptor currents. J Neurosci. 23(37):11698-710.
181
Hjorth J, Blackwell KT, Kotaleski JH. (2009) Gap junctions between striatal fast-spiking
interneurons regulate spiking activity and synchronization as a function of cortical
activity. J Neurosci. 29(16):5276-86.
Homanics GE, DeLorey TM, Firestone LL, Quinlan JJ, Handforth A, Harrison NL,
Krasowski MD, Rick CE, Korpi ER, Mäkelä R, Brilliant MH, Hagiwara N, Ferguson C,
Snyder K, Olsen RW. (1997) Mice devoid of gamma-aminobutyrate type A receptor
beta3 subunit have epilepsy, cleft palate, and hypersensitive behavior. Proc Natl Acad Sci
U S A. 94(8):4143-8.
Hooper KC, Banks DA, Stordahl LJ, White IM, Rebec GV. (1997) Quinpirole inhibits
striatal and excites pallidal neurons in freely moving rats. Neurosci Lett. 237(2-3):69-72.
Hourez R, Azdad K, Vanwalleghem G, Roussel C, Gall D, Schiffmann SN. (2005)
Activation of protein kinase C and inositol 1,4,5-triphosphate receptors antagonistically
modulate voltage-gated sodium channels in striatal neurons. Brain Res. 1059(2):189-96.
Huntsman MM, Porcello DM, Homanics GE, DeLorey TM, Huguenard JR. (1999)
Reciprocal inhibitory connections and network synchrony in the mammalian thalamus.
Science. 283(5401):541-3.
Jacob TC, Bogdanov YD, Magnus C, Saliba RS, Kittler JT, Haydon PG, Moss SJ. (2005)
Gephyrin regulates the cell surface dynamics of synaptic GABAA receptors. J Neurosci.
25(45):10469-78.
Jacob TC, Wan Q, Vithlani M, Saliba RS, Succol F, Pangalos MN, Moss SJ. (2009)
GABA(A) receptor membrane trafficking regulates spine maturity. Proc Natl Acad Sci U
S A. 106(30):12500-5.
Janssen MJ, Ade KK, Fu Z, Vicini S. (2009) Dopamine modulation of GABA tonic
conductance in striatal output neurons. J Neurosci. 29(16):5116-26.
Jarvis MF, Williams M. (1989) Direct autoradiographic localization of adenosine A2
receptors in the rat brain using the A2-selective agonist, [3H]CGS 21680. Eur J
Pharmacol. 168(2):243-6.
Jia F, Pignataro L, Schofield CM, Yue M, Harrison NL, Goldstein PA. (2005) An
extrasynaptic GABAA receptor mediates tonic inhibition in thalamic VB neurons. J
Neurophysiol. 94(6):4491-501.
Jia F, Yue M, Chandra D, Keramidas A, Goldstein PA, Homanics GE, Harrison NL.
(2008) Taurine is a potent activator of extrasynaptic GABA(A) receptors in the thalamus.
J Neurosci. 28(1):106-15.
Jiang ZG, North RA. (1991) Membrane properties and synaptic responses of rat striatal
neurones in vitro. J Physiol. 443:533-53.
182
Jones A, Korpi ER, McKernan RM, Pelz R, Nusser Z, Mäkelä R, Mellor JR, Pollard S,
Bahn S, Stephenson FA, Randall AD, Sieghart W, Somogyi P, Smith AJ, Wisden W.
(1997) Ligand-gated ion channel subunit partnerships: GABAA receptor alpha6 subunit
gene inactivation inhibits delta subunit expression. J Neurosci. 17(4):1350-62.
Jones MV, Westbrook GL. (1997) Shaping of IPSCs by endogenous calcineurin activity.
J Neurosci. 17(20):7626-33.
Jovanovic JN, Thomas P, Kittler JT, Smart TG, Moss SJ. (2004) Brain-derived
neurotrophic factor modulates fast synaptic inhibition by regulating GABA(A) receptor
phosphorylation, activity, and cell-surface stability. J Neurosci. 24(2):522-30.
Kaila K. (1994) Ionic basis of GABAA receptor channel function in the nervous system.
Prog Neurobiol. 42(4):489-537.
Kalanithi PS, Zheng W, Kataoka Y, DiFiglia M, Grantz H, Saper CB, Schwartz ML,
Leckman JF, Vaccarino FM. (2005) Altered parvalbumin-positive neuron distribution in
basal ganglia of individuals with Tourette syndrome. Proc Natl Acad Sci U S A.
102(37):13307-12.
Kano M, Konnerth A. (1992) Potentiation of GABA-mediated currents by cAMPdependent protein kinase. Neuroreport. 3(7):563-6.
Kapur J, Macdonald RL. (1996) Cyclic AMP-dependent protein kinase enhances
hippocampal dentate granule cell GABAA receptor currents. J Neurophysiol. 76(4):262634.
Kawaguchi Y, Wilson CJ, Augood SJ, Emson PC. (1995) Striatal interneurones:
chemical, physiological and morphological characterization. Trends Neurosci.
18(12):527-35.
Kawaguchi Y. (1993) Physiological, morphological, and histochemical characterization
of three classes of interneurons in rat neostriatum. J Neurosci. 13(11):4908-23.
Kelly PA, Thomas CL, Ritchie IM, Arbuthnott GW. (1994) Cerebrovascular
autoregulation in response to hypertension induced by NG-nitro-L-arginine methyl ester.
Neuroscience. 59(1):13-20.
Kita H, Kosaka T, Heizmann CW. (1990) Parvalbumin-immunoreactive neurons in the
rat neostriatum: a light and electron microscopic study. Brain Res. 536(1-2):1-15.
Kita H. (1996) Glutamatergic and GABAergic postsynaptic responses of striatal spiny
neurons to intrastriatal and cortical stimulation recorded in slice preparations.
Neuroscience. 70(4):925-40.
183
Kita H, Kitai ST. (1994) The morphology of globus pallidus projection neurons in the rat:
an intracellular staining study. Brain Res. 636(2):308-19.
Kittler JT, Chen G, Honing S, Bogdanov Y, McAinsh K, Arancibia-Carcamo IL,
Jovanovic JN, Pangalos MN, Haucke V, Yan Z, Moss SJ. (2005) Phospho-dependent
binding of the clathrin AP2 adaptor complex to GABAA receptors regulates the efficacy
of inhibitory synaptic transmission. Proc Natl Acad Sci U S A. 102(41):14871-6.
Kittler JT, Chen G, Kukhtina V, Vahedi-Faridi A, Gu Z, Tretter V, Smith KR, McAinsh
K, Arancibia-Carcamo IL, Saenger W, Haucke V, Yan Z, Moss SJ. (2008) Regulation of
synaptic inhibition by phospho-dependent binding of the AP2 complex to a YECL motif
in the GABAA receptor gamma2 subunit. Proc Natl Acad Sci U S A. 105(9):3616-21.
Kittler JT, Delmas P, Jovanovic JN, Brown DA, Smart TG, Moss SJ. (2000) Constitutive
endocytosis of GABAA receptors by an association with the adaptin AP2 complex
modulates inhibitory synaptic currents in hippocampal neurons. J Neurosci. 20(21):79727.
Kittler JT, Moss SJ. (2003) Modulation of GABAA receptor activity by phosphorylation
and receptor trafficking: implications for the efficacy of synaptic inhibition. Curr Opin
Neurobiol. 13(3):341-7.
Kittler JT, Thomas P, Tretter V, Bogdanov YD, Haucke V, Smart TG, Moss SJ. (2004)
Huntingtin-associated protein 1 regulates inhibitory synaptic transmission by modulating
gamma-aminobutyric acid type A receptor membrane trafficking. Proc Natl Acad Sci U S
A. 101(34):12736-41.
Kneussel M, Betz H. (2000) Receptors, gephyrin and gephyrin-associated proteins: novel
insights into the assembly of inhibitory postsynaptic membrane specializations. J Physiol.
525 Pt 1:1-9.
Kneussel M, Brandstätter JH, Laube B, Stahl S, Müller U, Betz H. (1999) Loss of
postsynaptic GABA(A) receptor clustering in gephyrin-deficient mice. J Neurosci.
19(21):9289-97.
Koós T, Tepper JM, Wilson CJ. (2004) Comparison of IPSCs evoked by spiny and fastspiking neurons in the neostriatum. J Neurosci. 24(36):7916-22.
Koós T, Tepper JM. (1999) Inhibitory control of neostriatal projection neurons by
GABAergic interneurons. Nat Neurosci. (5):467-72.
Koós T, Tepper JM. (2002) Dual cholinergic control of fast-spiking interneurons in the
neostriatum. J Neurosci. 22(2):529-35.
Kreitzer AC, Malenka RC. (2008) Striatal plasticity and basal ganglia circuit function.
Neuron. 60(4):543-54.
184
Kreitzer AC. (2009) Physiology and pharmacology of striatal neurons. Annu Rev
Neurosci. 32:127-47.
Kubota Y, Kawaguchi Y. (2000) Dependence of GABAergic synaptic areas on the
interneuron type and target size. J Neurosci. 20(1):375-86.
Kubota Y, Mikawa S, Kawaguchi Y. (1993) Neostriatal GABAergic interneurones
contain NOS, calretinin or parvalbumin. Neuroreport. 5(3):205-8.
Kuroiwa M, Bateup HS, Shuto T, Higashi H, Tanaka M, Nishi A. (2008) Regulation of
DARPP-32 phosphorylation by three distinct dopamine D1-like receptor signaling
pathways in the neostriatum. J Neurochem. 107(4):1014-26.
Lapper SR, Bolam JP. (1992) Input from the frontal cortex and the parafascicular nucleus
to cholinergic interneurons in the dorsal striatum of the rat. Neuroscience. 51(3):533-45.
Laurie DJ, Wisden W, Seeburg PH. (1992) The distribution of thirteen GABAA receptor
subunit mRNAs in the rat brain. III. Embryonic and postnatal development. J Neurosci.
12(11):4151-72.
Lee TH, Balu R, Davidson C, Ellinwood EH. (2001) Differential time-course profiles of
dopamine release and uptake changes induced by three dopamine uptake inhibitors.
Synapse. 41(4):301-10.
Lehmann J, Langer SZ. (1983) The striatal cholinergic interneuron: synaptic target of
dopaminergic terminals? Neuroscience. 10(4):1105-20.
Lenz S, Perney TM, Qin Y, Robbins E, Chesselet MF. (1994) GABA-ergic interneurons
of the striatum express the Shaw-like potassium channel Kv3.1. Synapse. 18(1):55-66.
Lindskog M, Svenningsson P, Fredholm BB, Greengard P, Fisone G. (1999) Activation
of dopamine D2 receptors decreases DARPP-32 phosphorylation in striatonigral and
striatopallidal projection neurons via different mechanisms. Neuroscience. 88(4):1005-8.
Liste I, Caruncho HJ, Guerra MJ, Labandeira-Garcia JL. (1997) GABA(A) receptor
subunit expression in intrastriatal striatal grafts comparison between normal developing
striatum and developing striatal grafts. Brain Res Dev Brain Res. 103(2):185-94.
Lovinger DM, Choi S. (1995) Activation of adenosine A1 receptors initiates short-term
synaptic depression in rat striatum. Neurosci Lett. 199(1):9-12.
Lüscher B, Keller CA. (2004) Regulation of GABAA receptor trafficking, channel
activity, and functional plasticity of inhibitory synapses. Pharmacol Ther. 102(3):195221.
185
Macdonald RL, Olsen RW. (1994) GABAA receptor channels. Annu Rev Neurosci.
17:569-602.
Machu TK, Firestone JA, Browning MD. (1993) Ca2+/calmodulin-dependent protein
kinase II and protein kinase C phosphorylate a synthetic peptide corresponding to a
sequence that is specific for the gamma 2L subunit of the GABAA receptor. J
Neurochem. 61(1):375-7.
Malenka RC, Kocsis JD. (1988) Presynaptic actions of carbachol and adenosine on
corticostriatal synaptic transmission studied in vitro. J Neurosci. 8(10):3750-6.
Mallet N, Ballion B, Le Moine C, Gonon F. (2006) Cortical inputs and GABA
interneurons imbalance projection neurons in the striatum of parkinsonian rats. J
Neurosci. 26(14):3875-84.
Mangan PS, Sun C, Carpenter M, Goodkin HP, Sieghart W, Kapur J. (2005) Cultured
Hippocampal Pyramidal Neurons Express Two Kinds of GABAA Receptors. Mol
Pharmacol. 67(3):775-88.
Manzoni O, Prezeau L, Marin P, Deshager S, Bockaert J, Fagni L. (1992) Nitric oxideinduced blockade of NMDA receptors. Neuron. 8(4):653-62.
Mao X; Fujiwara Y; Chapdelaine A; Yang H; Orkin SH. (2001) Activation of EGFP
expression by cre-mediated excision in a new ROSA26 reporter mouse strain. Blood.
97(1):324-6.
Marsh M, McMahon HT. (1999) The structural era of endocytosis. Science.
285(5425):215-20.
Martone ME, Armstrong DM, Young SJ, Groves PM. (1992) Ultrastructural examination
of enkephalin and substance P input to cholinergic neurons within the rat neostriatum.
Brain Res. 594(2):253-62.
Matamales M, Bertran-Gonzalez J, Salomon L, Degos B, Deniau JM, Valjent E, Hervé
D, Girault JA. (2009) Striatal medium-sized spiny neurons: identification by nuclear
staining and study of neuronal subpopulations in BAC transgenic mice. PLoS One.
4(3):e4770.
Maurice N, Mercer J, Chan CS, Hernandez-Lopez S, Held J, Tkatch T, Surmeier DJ.
(2004) D2 dopamine receptor-mediated modulation of voltage-dependent Na+ channels
reduces autonomous activity in striatal cholinergic interneurons. J Neurosci.
24(46):10289-301.
McDonald BJ, Amato A, Connolly CN, Benke D, Moss SJ, Smart TG. (1998) Adjacent
phosphorylation sites on GABAA receptor beta subunits determine regulation by cAMPdependent protein kinase. Nat Neurosci. 1(1):23-8.
186
McKernan RM, Whiting PJ. (1996) Which GABAA-receptor subtypes really occur in the
brain? Trends Neurosci. 19(4):139-43.
Mercuri NB, Calabresi P, Stefani A, Stratta F, Bernardi G. (1991) GABA depolarizes
neurons in the rat striatum: an in vivo study. Synapse. 8(1):38-40.
Meredith GE, Wouterlood FG. (1990) Hippocampal and midline thalamic fibers and
terminals in relation to the choline acetyltransferase-immunoreactive neurons in nucleus
accumbens of the rat: a light and electron microscopic study. J Comp Neurol. 296(2):20421.
Merlino G, Serafini A, Young JJ, Robiony F, Gigli GL, Valente M. (2009) Gabapentin
enacarbil, a gabapentin prodrug for the treatment of the neurological symptoms
associated with disorders such as restless legs syndrome. Curr Opin Investig Drugs.
10(1):91-102.
Mermelstein PG, Song WJ, Tkatch T, Yan Z, Surmeier DJ. (1998) Inwardly rectifying
potassium (IRK) currents are correlated with IRK subunit expression in rat nucleus
accumbens medium spiny neurons. J Neurosci. 18(17):6650-61.
Mihalek RM, Banerjee PK, Korpi ER, Quinlan JJ, Firestone LL, Mi ZP, Lagenaur C,
Tretter V, Sieghart W, Anagnostaras SG, Sage JR, Fanselow MS, Guidotti A, Spigelman
I, Li Z, DeLorey TM, Olsen RW, Homanics GE. Attenuated sensitivity to neuroactive
steroids in gamma-aminobutyrate type A receptor delta subunit knockout mice. (1999)
Proc Natl Acad Sci U S A. 96(22):12905-10.
Missale C, Nash SR, Robinson SW, Jaber M, Caron MG. (1998) Dopamine receptors:
from structure to function. Physiol Rev. 78(1):189-225.
Mody I. (2001) Distinguishing between GABA(A) receptors responsible for tonic and
phasic conductances. Neurochem Res. 26(8-9):907-13.
Momiyama T, Koga E. (2001) Dopamine D(2)-like receptors selectively block N-type
Ca(2+) channels to reduce GABA release onto rat striatal cholinergic interneurones. J
Physiol. 533(Pt 2):479-92.
Mori A, Shindou T, Ichimura M, Nonaka H, Kase H. (1996) The role of adenosine A2a
receptors in regulating GABAergic synaptic transmission in striatal medium spiny
neurons. J Neurosci. 16(2):605-11.
Mori A, Shindou T. (2003) Modulation of GABAergic transmission in the striatopallidal
system by adenosine A2A receptors: a potential mechanism for the antiparkinsonian
effects of A2A antagonists. Neurology. 61(11):S44-8.
Moss SJ, Gorrie GH, Amato A, Smart TG. (1995) Modulation of GABAA receptors by
tyrosine phosphorylation. Nature. 377(6547):344-8.
187
Moss SJ, Doherty CA, Huganir RL. (1992a) Identification of the cAMP-dependent
protein kinase and protein kinase C phosphorylation sites within the major intracellular
domains of the beta 1, gamma 2S, and gamma 2L subunits of the gamma-aminobutyric
acid type A receptor. J Biol Chem. 267(20):14470-6.
Moss SJ, Smart TG, Blackstone CD, Huganir RL. (1992b) Functional modulation of
GABAA receptors by cAMP-dependent protein phosphorylation. Science.
257(5070):661-5.
Moss SJ, Smart TG. (2001) Constructing inhibitory synapses. Nat Rev Neurosci.
2(4):240-50.
Moyer JT, Wolf JA, Finkel LH. (2007) Effects of dopaminergic modulation on the
integrative properties of the ventral striatal medium spiny neuron. J Neurophysiol.
98(6):3731-48.
Mozrzymas JW, Zarnowska ED, Pytel M, Mercik K. (2003) Modulation of GABA(A)
receptors by hydrogen ions reveals synaptic GABA transient and a crucial role of the
desensitization process. J Neurosci. 23(22):7981-92.
Mtchedlishvili Z, Kapur J. (2006) High-affinity, slowly desensitizing GABAA receptors
mediate tonic inhibition in hippocampal dentate granule cells. Mol Pharmacol. 69(2):56475.
Murase K, Ryu PD, Randic M (1989) Excitatory and inhibitory amino acids and peptideinduced responses in acutely isolated rat spinal dorsal horn neurons. Neurosci Lett
103:56–63.
Nicola SM, Malenka RC. (1998) Modulation of synaptic transmission by dopamine and
norepinephrine in ventral but not dorsal striatum. J Neurophysiol. 79(4):1768-76.
Nicola SM, Surmeier J, Malenka RC. (2000) Dopaminergic modulation of neuronal
excitability in the striatum and nucleus accumbens. Annu Rev Neurosci. 23:185-215.
Nisenbaum ES, Wilson CJ, Foehring RC, Surmeier DJ. (1996) Isolation and
characterization of a persistent potassium current in neostriatal neurons. J Neurophysiol.
76(2):1180-94.
Nisenbaum ES, Wilson CJ. (1995) Potassium currents responsible for inward and
outward rectification in rat neostriatal spiny projection neurons. J Neurosci. (6):4449-63.
Nisenbaum ES, Xu ZC, Wilson CJ. (1994) Contribution of a slowly inactivating
potassium current to the transition to firing of neostriatal spiny projection neurons. J
Neurophysiol. 71(3):1174-89.
188
Nishi A, Bibb JA, Snyder GL, Higashi H, Nairn AC, Greengard P. (2000) Amplification
of dopaminergic signaling by a positive feedback loop. Proc Natl Acad Sci U S A.
97(23):12840-5.
Nishi A, Snyder GL, Greengard P. (1997) Bidirectional regulation of DARPP-32
phosphorylation by dopamine. J Neurosci. 17(21):8147-55.
Nörenberg W, Wirkner K, Illes P. (1997) Effect of adenosine and some of its structural
analogues on the conductance of NMDA receptor channels in a subset of rat neostriatal
neurones. Br J Pharmacol. 122(1):71-80.
Nusser Z, Kay LM, Laurent G, Homanics GE, Mody I. (2001) Disruption of GABA(A)
receptors on GABAergic interneurons leads to increased oscillatory power in the
olfactory bulb network. J Neurophysiol. 86(6):2823-33.
Nusser Z, Mody I. (2002) Selective modulation of tonic and phasic inhibitions in dentate
gyrus granule cells. J Neurophysiol. 87(5):2624-8.
Nusser Z, Sieghart W, Mody I (1999) Differential regulation of synaptic GABAA
receptors by cAMP-dependent protein kinase in mouse cerebellar and olfactory bulb
neurons. J Physiol 521:421–435.
Nusser Z, Sieghart W, Somogyi P. (1998) Segregation of different GABAA receptors to
synaptic and extrasynaptic membranes of cerebellar granule cells. J Neurosci.
18(5):1693-703.
Nymann-Andersen J, Wang H, Chen L, Kittler JT, Moss SJ, Olsen RW. (2002) Subunit
specificity and interaction domain between GABA(A) receptor-associated protein
(GABARAP) and GABA(A) receptors. J Neurochem. 80(5):815-23.
Oláh S, Füle M, Komlósi G, Varga C, Báldi R, Barzó P, Tamás G. (2009) Regulation of
cortical microcircuits by unitary GABA-mediated volume transmission. Nature.
461(7268):1278-81.
Olson PA, Tkatch T, Hernandez-Lopez S, Ulrich S, Ilijic E, Mugnaini E, Zhang H,
Bezprozvanny I, Surmeier DJ. (2005) G-protein-coupled receptor modulation of striatal
CaV1.3 L-type Ca2+ channels is dependent on a Shank-binding domain. J Neurosci.
25(5):1050-62.
Onn SP, Fienberg AA, Grace AA. (2003) Dopamine modulation of membrane
excitability in striatal spiny neurons is altered in DARPP-32 knockout mice. J Pharmacol
Exp Ther. 306(3):870-9.
Ortinski PI, Lu C, Takagaki K, Fu Z, Vicini S. (2004) Expression of distinct alpha
subunits of GABAA receptor regulates inhibitory synaptic strength. J Neurophysiol.
92(3):1718-27.
189
Ouimet CC, Greengard P. (1990) Distribution of DARPP-32 in the basal ganglia: an
electron microscopic study. J Neurocytol. 19(1):39-52.
Ouimet CC, Miller PE, Hemmings HC Jr, Walaas SI, Greengard P. (1984) DARPP-32, a
dopamine- and adenosine 3':5'-monophosphate-regulated phosphoprotein enriched in
dopamine-innervated brain regions. III. Immunocytochemical localization. J Neurosci.
4(1):111-24.
Owens DF, Kriegstein AR. (2002) Is there more to GABA than synaptic inhibition? Nat
Rev Neurosci. 3(9):715-27.
Pacheco-Cano MT, Bargas J, Hernández-López S, Tapia D, Galarraga E. (1996)
Inhibitory action of dopamine involves a subthreshold Cs(+)-sensitive conductance in
neostriatal neurons. Exp Brain Res. 110(2):205-11.
Pakhotin P, Bracci E. (2007) Cholinergic interneurons control the excitatory input to the
striatum. J Neurosci. 27(2):391-400.
Partridge JG, Janssen MJ, Chou DY, Abe K, Zukowska Z, Vicini S. (2009) Excitatory
and inhibitory synapses in neuropeptide Y-expressing striatal interneurons. J
Neurophysiol. 102(5):3038-45.
Perez MF, White FJ, Hu XT. (2006) Dopamine D(2) receptor modulation of K(+)
channel activity regulates excitability of nucleus accumbens neurons at different
membrane potentials. J Neurophysiol. 96(5):2217-28.
Perez-Rosello T, Figueroa A, Salgado H, Vilchis C, Tecuapetla F, Guzman JN, Galarraga
E, Bargas J. (2005) Cholinergic control of firing pattern and neurotransmission in rat
neostriatal projection neurons: role of CaV2.1 and CaV2.2 Ca2+ channels. J
Neurophysiol. 93(5):2507-19.
Phelps PE, Houser CR, Vaughn JE. (1985) Immunocytochemical localization of choline
acetyltransferase within the rat neostriatum: a correlated light and electron microscopic
study of cholinergic neurons and synapses. J Comp Neurol. 238(3):286-307.
Pirker S, Schwarzer C, Wieselthaler A, Sieghart W, Sperk G. (2000) GABA(A)
receptors: immunocytochemical distribution of 13 subunits in the adult rat brain.
Neuroscience. 101(4):815-50.
Planert H, Szydlowski SN, Hjorth JJ, Grillner S, Silberberg G. (2010) Dynamics of
synaptic transmission between fast-spiking interneurons and striatal projection neurons of
the direct and indirect pathways. J Neurosci. 30(9):3499-507.
Plenz D. (2003) When inhibition goes incognito: feedback interaction between spiny
projection neurons in striatal function. Trends Neurosci. 26(8):436-43.
190
Plotkin JL, Wu N, Chesselet MF, Levine MS. (2005) Functional and molecular
development of striatal fast-spiking GABAergic interneurons and their cortical inputs.
Eur J Neurosci. 22(5):1097-108.
Poisbeau P, Cheney MC, Browning MD, Mody I. (1999) Modulation of synaptic
GABAA receptor function by PKA and PKC in adult hippocampal neurons. J Neurosci.
19(2):674-83.
Popoli P, Betto P, Reggio R, Ricciarello G. (1995) Adenosine A2A receptor stimulation
enhances striatal extracellular glutamate levels in rats. Eur J Pharmacol. 287:215–217.
Porter NM, Twyman RE, Uhler MD, Macdonald RL. (1990) Cyclic AMP-dependent
protein kinase decreases GABAA receptor current in mouse spinal neurons. Neuron.
5(6):789-96.
Prenosil GA, Schneider Gasser EM, Rudolph U, Keist R, Fritschy JM, Vogt KE. (2006)
Specific subtypes of GABAA receptors mediate phasic and tonic forms of inhibition in
hippocampal pyramidal neurons. J Neurophysiol. 96(2):846-57.
Radnikow G, Misgeld U. (1998) Dopamine D1 receptors facilitate GABAA synaptic
currents in the rat substantia nigra pars reticulata. J Neurosci. 18(6):2009-16.
Rajput PS, Kharmate G, Somvanshi RK, Kumar U. (2009) Colocalization of dopamine
receptor subtypes with dopamine and cAMP-regulated phosphoprotein (DARPP-32) in
rat brain. Neurosci Res. 65(1):53-63.
Ramadan E, Fu Z, Losi G, Homanics GE, Neale JH, Vicini S. (2003) GABA(A) receptor
beta3 subunit deletion decreases alpha2/3 subunits and IPSC duration. J Neurophysiol.
89(1):128-34.
Ramanathan S, Hanley JJ, Deniau JM, Bolam JP. (2002) Synaptic convergence of motor
and somatosensory cortical afferents onto GABAergic interneurons in the rat striatum. J
Neurosci. 22(18):8158-69.
Rashid AJ, So CH, Kong MM, Furtak T, El-Ghundi M, Cheng R, O'Dowd BF, George
SR. (2007) D1-D2 dopamine receptor heterooligomers with unique pharmacology are
coupled to rapid activation of Gq/11 in the striatum. Proc Natl Acad Sci U S A.
104(2):654-9.
Raz A, Feingold A, Zelanskaya V, Vaadia E, Bergman H. (1996) Neuronal
synchronization of tonically active neurons in the striatum of normal and parkinsonian
primates. J Neurophysiol. 76(3):2083-8.
Richtand NM, Kelsoe JR, Segal DS, Kuczenski R. (1995) Regional quantification of D1,
D2, and D3 dopamine receptor mRNA in rat brain using a ribonuclease protection assay.
Brain Res Mol Brain Res. 33(1):97-103.
191
Rivera A, Alberti I, Martín AB, Narváez JA, de la Calle A, Moratalla R. (2002)
Molecular phenotype of rat striatal neurons expressing the dopamine D5 receptor
subtype. Eur J Neurosci. 16(11):2049-58.
Robello M, Amico C, Cupello A. (1993) Regulation of GABAA receptor in cerebellar
granule cells in culture: differential involvement of kinase activities. Neuroscience.
53(1):131-8.
Rodríguez-Pallares J, Labandeira-García JL, Muñoz A, Caruncho HJ. (2000)
Morphology and neurochemistry of two striatal neuronal subtypes expressing the
GABA(A) receptor alpha3-subunit in the rat. Brain Res. 876(1-2):124-30.
Rosin DL, Hettinger BD, Lee A, Linden J. (2003) Anatomy of adenosine A2A receptors
in brain: morphological substrates for integration of striatal function. Neurology.
61(11):S12-8.
Salgado H, Tecuapetla F, Perez-Rosello T, Perez-Burgos A, Perez-Garci E, Galarraga E,
Bargas J. (2005) A reconfiguration of CaV2 Ca2+ channel current and its dopaminergic
D2 modulation in developing neostriatal neurons. J Neurophysiol. 94(6):3771-87.
Saliba RS, Pangalos M, Moss SJ. (2008) The ubiquitin-like protein Plic-1 enhances the
membrane insertion of GABAA receptors by increasing their stability within the
endoplasmic reticulum. J Biol Chem. 283(27):18538-44.
Sanna E, Murgia A, Casula A, Biggio G (1997) Differential subunit dependence of the
actions of the general anesthetics alphaxalone and etomidate at gamma-aminobutyric acid
type A receptors expressed in Xenopus laevis oocytes. Mol Pharmacol 51:484–490.
Santhakumar V, Jones RT, Mody I. (2010) Developmental regulation and
neuroprotective effects of striatal tonic GABA(A) currents. Neuroscience. 167(3):644-55
Saxena NC, Macdonald RL. (1994) Assembly of GABAA receptor subunits: role of the
delta subunit. J Neurosci. 14(11):7077-86.
Schiffmann SN, Fisone G, Moresco R, Cunha RA, Ferré S. (2007) Adenosine A2A
receptors and basal ganglia physiology. Prog Neurobiol. 83(5):277-92.
Schiffmann SN, Lledo PM, Vincent JD. (1995) Dopamine D1 receptor modulates the
voltage-gated sodium current in rat striatal neurones through a protein kinase A. J
Physiol. 483(Pt 1):95-107.
Schiffmann SN, Vanderhaeghen JJ. (1993) Adenosine A2 receptors regulate the gene
expression of striatopallidal and striatonigral neurons. Neurosci. 13(3):1080-7.
Schwarzer C, Berresheim U, Pirker S, Wieselthaler A, Fuchs K, Sieghart W, Sperk G.
(2001) Distribution of the major gamma-aminobutyric acid(A) receptor subunits in the
192
basal ganglia and associated limbic brain areas of the adult rat. J Comp Neurol.
433(4):526-49.
Semyanov A, Walker MC, Kullmann DM, Silver RA. (2004) Tonically active GABA A
receptors: modulating gain and maintaining the tone. Trends Neurosci. 27(5):262-9.
Shen W, Hamilton SE, Nathanson NM, Surmeier DJ (2005) Cholinergic suppression of
KCNQ channel currents enhances excitability of striatal medium spiny neurons. J
Neurosci 25:7449–7458.
Shen W, Hernandez-Lopez S, Tkatch T, Held JE, Surmeier DJ. (2004) Kv1.2-containing
K+ channels regulate subthreshold excitability of striatal medium spiny neurons. J
Neurophysiol. 91(3):1337-49.
Shen W, Tian X, Day M, Ulrich S, Tkatch T, Nathanson NM, Surmeier DJ. (2007)
Cholinergic modulation of Kir2 channels selectively elevates dendritic excitability in
striatopallidal neurons. Nat Neurosci. 10(11):1458-66.
Shuen JA, Chen M, Gloss B, Calakos N. (2008) Drd1a-tdTomato BAC transgenic mice
for simultaneous visualization of medium spiny neurons in the direct and indirect
pathways of the basal ganglia. J Neurosci.28(11):2681-5.
Sieghart W, Sperk G. (2002) Subunit composition, distribution and function of GABA(A)
receptor subtypes. Curr Top Med Chem. 2(8):795-816.
Sigel E, Baur R. (1988) Activation of protein kinase C differentially modulates neuronal
Na+, Ca2+, and gamma-aminobutyrate type A channels. Proc Natl Acad Sci U S A.
85(16):6192-6.
Singer HS, Wendlandt J, Krieger M, Giuliano J. (2001) Baclofen treatment in Tourette
syndrome: a double-blind, placebo-controlled, crossover trial. Neurology. 56(5):599-604.
Sivakumaran S, Mohajerani MH, Cherubini E. (2009) At immature mossy-fiber-CA3
synapses, correlated presynaptic and postsynaptic activity persistently enhances GABA
release and network excitability via BDNF and cAMP-dependent PKA. J Neurosci.
29(8):2637-47.
Slany A, Zezula J, Fuchs K, Sieghart W (1995) Allosteric modulation of
[3H]flunitrazepam binding to recombinant GABAA receptors. Eur J Pharmacol 291:99–
105.
Smith KR, McAinsh K, Chen G, Arancibia-Carcamo IL, Haucke V, Yan Z, Moss SJ,
Kittler JT. (2008) Regulation of inhibitory synaptic transmission by a conserved atypical
interaction of GABA(A) receptor beta- and gamma-subunits with the clathrin AP2
adaptor. Neuropharmacology. 55(5):844-50.
193
Smith Y, Bennett BD, Bolam JP, Parent A, Sadikot AF. (1994) Synaptic relationships
between dopaminergic afferents and cortical or thalamic input in the sensorimotor
territory of the striatum in monkey. J Comp Neurol 344:1–19.
Song WJ, Surmeier DJ. (1996) Voltage-dependent facilitation of calcium channels in rat
neostriatal neurons. J Neurophysiol. 76(4):2290-306.
Somogyi P, Fritschy JM, Benke D, Roberts JD, Sieghart W. (1996) The gamma 2 subunit
of the GABAA receptor is concentrated in synaptic junctions containing the alpha 1 and
beta 2/3 subunits in hippocampus, cerebellum and globus pallidus. Neuropharmacology.
35(9-10):1425-44.
Somogyi P, Priestley JV, Cuello AC, Smith AD, Takagi H. (1982) Synaptic connections
of enkephalin-immunoreactive nerve terminals in the neostriatum: a correlated light and
electron microscopic study. J Neurocytol. 11(5):779-807.
Starr PA, Rau GM, Davis V, Marks WJ Jr, Ostrem JL, Simmons D, Lindsey N, Turner
RS. (2005) Spontaneous pallidal neuronal activity in human dystonia: comparison with
Parkinson's disease and normal macaque. J Neurophysiol. 93(6):3165-76.
Stell BM, Brickley SG, Tang CY, Farrant M, Mody I. (2003) Neuroactive steroids reduce
neuronal excitability by selectively enhancing tonic inhibition mediated by delta subunitcontaining GABAA receptors. Proc Natl Acad Sci U S A. 100(24):14439-44.
Stenman J, Toresson H, Campbell K. (2003) Identification of two distinct progenitor
populations in the lateral ganglionic eminence: implications for striatal and olfactory bulb
neurogenesis. J Neurosci. 23(1):167-74.
Stoof JC, Drukarch B, de Boer P, Westerink BH. (1992) In vitro and in vivo
acetylcholine release from rat striatum as a functional paradigm of signal transduction via
a D-2 dopamine receptor. Neurochem Int. 20:201-205.
Stoof JC, Kebabian JW. (1981) Opposing roles for D-1 and D-2 dopamine receptors in
efflux of cyclic AMP from rat neostriatum. Nature. 294(5839):366-8.
Stoof JC, Kebabian JW. (1984) Two dopamine receptors: biochemistry, physiology and
pharmacology. Life Sci. 35(23):2281-96.
Sugita S, Uchimura N, Jiang ZG, North RA. (1991) Distinct muscarinic receptors inhibit
release of gamma-aminobutyric acid and excitatory amino acids in mammalian brain.
Proc Natl Acad Sci U S A. 88(6):2608-11.
Surmeier DJ, Bargas J, Hemmings HC Jr, Nairn AC, Greengard P. (1995) Modulation of
calcium currents by a D1 dopaminergic protein kinase/phosphatase cascade in rat
neostriatal neurons. Neuron. 14(2):385-97.
194
Surmeier DJ, Eberwine J, Wilson CJ, Cao Y, Stefani A, Kitai ST. (1992) Dopamine
receptor subtypes colocalize in rat striatonigral neurons. Proc Natl Acad Sci U S A.
89(21):10178-82.
Surmeier DJ, Song WJ, Yan Z. (1996) Coordinated expression of dopamine receptors in
neostriatal medium spiny neurons. J Neurosci. 16(20):6579-91.
Surmeier, D. J., Reiner, A., Levine, M. S. & Ariano, M. A. (1993) Are neostriatal
dopamine receptors co-localized? Trends Neurosci. 16:299–305.
Svenningsson P, Le Moine C, Kull B, Sunahara R, Bloch B, Fredholm BB. (1997)
Cellular expression of adenosine A2A receptor messenger RNA in the rat central nervous
system with special reference to dopamine innervated areas. Neuroscience. 80(4):117185.
Svenningsson P, Lindskog M, Rognoni F, Fredholm BB, Greengard P, Fisone G. (1998)
Activation of adenosine A2A and dopamine D1 receptors stimulates cyclic AMPdependent phosphorylation of DARPP-32 in distinct populations of striatal projection
neurons. Neuroscience. 84(1):223-8.
Takei K, Slepnev VI, Haucke V, De Camilli P. (1999) Functional partnership between
amphiphysin and dynamin in clathrin-mediated endocytosis. Nat Cell Biol. 1(1):33-9.
Tang X, Hernandez CC, Macdonald RL. (2010) Modulation of spontaneous and GABAevoked tonic alpha4beta3delta and alpha4beta3gamma2L GABAA receptor currents by
protein kinase A. J Neurophysiol. 103(2):1007-19.
Taverna S, Canciani B, Pennartz CM. (2007) Membrane properties and synaptic
connectivity of fast-spiking interneurons in rat ventral striatum. Brain Res. 1152:49-56.
Taverna S, Ilijic E, Surmeier DJ. (2008) Recurrent collateral connections of striatal
medium spiny neurons are disrupted in models of Parkinson's disease. J Neurosci.
28(21):5504-12.
Taverna S, van Dongen YC, Groenewegen HJ, Pennartz CM. (2004) Direct physiological
evidence for synaptic connectivity between medium-sized spiny neurons in rat nucleus
accumbens in situ. J Neurophysiol. 91(3):1111-21.
Tecuapetla F, Carrillo-Reid L, Bargas J, Galarraga E. (2007) Dopaminergic modulation
of short-term synaptic plasticity at striatal inhibitory synapses. Proc Natl Acad Sci U S A.
104(24):10258-63.
Tecuapetla F, Koós T, Tepper JM, Kabbani N, Yeckel MF. (2009) Differential
dopaminergic modulation of neostriatal synaptic connections of striatopallidal axon
collaterals. J Neurosci. 29(28):8977-90.
195
Tepper JM, Bolam JP. (2004) Functional diversity and specificity of neostriatal
interneurons. Curr Opin Neurobiol. 14(6):685-92.
Tepper JM, Koós T, Wilson CJ. (2004) GABAergic microcircuits in the neostriatum.
Trends Neurosci. 27(11):662-9.
Tepper JM, Wilson CJ, Koós T. (2008) Feedforward and feedback inhibition in
neostriatal GABAergic spiny neurons. Brain Res Rev. 58(2):272-81.
Terunuma M, Jang IS, Ha SH, Kittler JT, Kanematsu T, Jovanovic JN, Nakayama KI,
Akaike N, Ryu SH, Moss SJ, Hirata M. (2004) GABAA receptor phospho-dependent
modulation is regulated by phospholipase C-related inactive protein type 1, a novel
protein phosphatase 1 anchoring protein. J Neurosci. 24(32):7074-84.
Terunuma M, Xu J, Vithlani M, Sieghart W, Kittler J, Pangalos M, Haydon PG, Coulter
DA, Moss SJ. (2008) Deficits in phosphorylation of GABA(A) receptors by intimately
associated protein kinase C activity underlie compromised synaptic inhibition during
status epilepticus. Neurosci. 28(2):376-84.
Thomas P, Mortensen M, Hosie AM, Smart TG. (2005) Dynamic mobility of functional
GABAA receptors at inhibitory synapses. Nat Neurosci. 8(7):889-97.
Tossman U, Segovia J, Ungerstedt U. (1986) Extracellular levels of amino acids in
striatum and globus pallidus of 6-hydroxydopamine-lesioned rats measured with
microdialysis. Acta Physiol Scand. 127(4):547-51.
Tretter V, Ehya N, Fuchs K, Sieghart W. (1997) Stoichiometry and assembly of a
recombinant GABAA receptor subtype. J Neurosci. 17(8):2728-37.
Tunstall MJ, Oorschot DE, Kean A, Wickens JR. (2002) Inhibitory interactions between
spiny projection neurons in the rat striatum. J Neurophysiol. 88(3):1263-9.
Uchimura N, Higashi H, Nishi S. (1986) Hyperpolarizing and depolarizing actions of
dopamine via D-1 and D-2 receptors on nucleus accumbens neurons. Brain Res.
375(2):368-72.
Urak L, Feucht M, Fathi N, Hornik K, Fuchs K. (2006) A GABRB3 promoter haplotype
associated with childhood absence epilepsy impairs transcriptional activity. Hum Mol
Genet. 15(16):2533-41.
van Rijnsoever C, Sidler C, Fritschy JM. (2005) Internalized GABA-receptor subunits are
transferred to an intracellular pool associated with the postsynaptic density. Eur J
Neurosci. 21(2):327-38.
Venance L, Glowinski J, Giaume C. (2004) Electrical and chemical transmission between
striatal GABAergic output neurones in rat brain slices. J Physiol. 559(1):215-30.
196
Veruki ML, Yeh HH. (1994) Vasoactive intestinal polypeptide modulates GABAA
receptor function through activation of cyclic AMP. Vis Neurosci. 11(5):899-908.
Voorn P, Vanderschuren LJ, Groenewegen HJ, Robbins TW, Pennartz CM. (2004)
Putting a spin on the dorsal-ventral divide of the striatum. Trends Neurosci. 27(8):46874.
Vuillet J, Kerkerian L, Salin P, Nieoullon A. (1989) Ultrastructural features of NPYcontaining neurons in the rat striatum. Brain Res. 477(1-2):241-51.
Wafford KA, Bain CJ, Quirk K, McKernan RM, Wingrove PB, Whiting PJ, Kemp JA. A
novel allosteric modulatory site on the GABAA receptor beta subunit. (1994) Neuron.
12(4):775-82.
Walaas SI, Greengard P. (1984) DARPP-32, a dopamine- and adenosine 3':5'monophosphate-regulated phosphoprotein enriched in dopamine-innervated brain
regions. I. Regional and cellular distribution in the rat brain. J Neurosci. 4(1):84-98.
Walaas SI, Greengard P. (1991) Protein phosphorylation and neuronal function.
Pharmacol Rev. 43(3):299-349.
Waldvogel HJ, Kubota Y, Trevallyan SC, Kawaguchi Y, Fritschy JM, Mohler H, Faull
RL. (1997) The morphological and chemical characteristics of striatal neurons
immunoreactive for the alpha1-subunit of the GABA(A) receptor in the rat.
Neuroscience. 80(3):775-92.
Wall MJ, Usowicz MM. (1997) Development of action potential-dependent and
independent spontaneous GABAA receptor-mediated currents in granule cells of
postnatal rat cerebellum. Eur J Neurosci. 9(3):533-48.
Wei W, Zhang N, Peng Z, Houser CR, Mody I. (2003) Perisynaptic localization of delta
subunit-containing GABA(A) receptors and their activation by GABA spillover in the
mouse dentate gyrus. J Neurosci. 23(33):10650-61.
Wilson CJ, Chang HT, Kitai ST. (1990) Firing patterns and synaptic potentials of
identified giant aspiny interneurons in the rat neostriatum. J Neurosci. 10(2):508-19.
Wilson CJ, Groves PM. (1980) Fine structure and synaptic connections of the common
spiny neuron of the rat neostriatum: a study employing intracellular inject of horseradish
peroxidase. J Comp Neurol. 194(3):599-615.
Yan Z, Flores-Hernandez J, Surmeier DJ. (2001) Coordinated expression of muscarinic
receptor messenger RNAs in striatal medium spiny neurons. Neuroscience. 103(4):101724.
197
Yan Z, Surmeier DJ. (1997) D5 dopamine receptors enhance Zn2+-sensitive GABA(A)
currents in striatal cholinergic interneurons through a PKA/PP1 cascade. Neuron.
19(5):1115-26.
Yasumoto S, Tanaka E, Hattori G, Maeda H, Higashi H. (2002) Direct and indirect
actions of dopamine on the membrane potential in medium spiny neurons of the mouse
neostriatum. J Neurophysiol. 87(3):1234-43.
Yung KK, Smith AD, Levey AI, Bolam JP. (1996) Synaptic connections between spiny
neurons of the direct and indirect pathways in the neostriatum of the rat: evidence from
dopamine receptor and neuropeptide immunostaining. Eur J Neurosci. 8(5):861-9.
Zhang XF, Hu XT, White FJ. (1998) Whole-cell plasticity in cocaine withdrawal:
reduced sodium currents in nucleus accumbens neurons. J Neurosci. 18(1):488-98.
Zhou FM, Wilson CJ, Dani JA. (2002) Cholinergic interneuron characteristics and
nicotinic properties in the striatum. J Neurobiol. 53(4):590-605.
198