Survey
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
What Scientists Agree On • Scientists believe they can explain the diversity of species on Earth given the following three statements: – Earth is about 4.6 billion years old – Organisms have inhabited Earth for most of its history – All organisms living today have evolved from earlier, simpler organisms Fossils – What are they? • Fossils = preserved or mineralized remains or imprints of an organism – Remains included bone, tooth, petrified tree, or shells What Fossils Tell Us • Paleontologists – study fossilized remains • Paleontologists can date fossils using radiometric dating to put fossils in order from oldest to youngest -Carbon dating • Orderly patterns of evolution can be seen Fossils – Evidence? • Provide an actual record of Earth’s past life forms (evolutionary record) • Shows that species have changed over Earth’s history. Evidence of extinct species. 140 million years 800 million years Intermediate Fossils • Intermediate fossils provide links between older and newer species – commonly known as “Missing Links” • Many intermediates have been found: – Fish and Amphibians – Reptiles and Birds – Reptiles and Mammals Intermediate Fossils • In 1990, intermediate whale fossils were discovered • Evidence shows that whales evolved from 4legged land mammals Why We Don’t Have More Fossil Clues • Fossils are produced when organisms are buried in fine sediments deposited by water, wind, or volcanic eruption • What kinds of conditions are helpful for fossil formation? • Wet, shallow areas, marshlands, clay • (Need these “perfect” conditions for fossils to form) Why We Don’t Have More Fossil Clues • Organisms living in upland forests, mountains, grasslands, or deserts are not easily fossilized • Even those organisms buried in the right conditions have a slim chance of being fossilized before the body decays – Exoskeleton vs. soft body Anatomy Development • Comparison of different body structures between organisms show similarities in structure even though they may have different functions Homologous Structures • Remember the term homologous? • Similar structures between organisms developed from the same basic groups of bones • Similar structure, with same or different functions. Homologous Structures – Evidence? • Homologous structures show that organisms share a common ancestor • Show change occurring to already present structures (divergent evolution) Analogous Structures • Opposite of homologous structures: • Similar function, different structure • Examples: – Bat wing and butterfly wing – Both used for flying (function), different bone structure Analogous Structures – Evidence? • Same type of adaptations can be selected for in separate environments if selective pressures are similar NATURAL SELECTION WORKS!!! • Convergent Evolution Vestigial structures • Structures that were useful at one time, but no longer serve a function. • Examples: tail bone, appendix Evidence • Ancestor we descended from may have used it – left over from the course of evolution Biological Molecules Contain Evolutionary Record • If species have changed over time, we should see genetic changes associated with the change • Study proteins and nucleic acids for clues DNA Evidence • Nucleotide changes cause changes in amino acid sequences • GATAACCAAGAATTATTAGCGAGA • GATAACCAAGAACTATTAGCGAGA • Scientists can determine how closely organisms are related by examining the number of nucleotide changes (mutations) in their DNA Proteins • Proteins are made up of chains of amino acids – Amino acid sequence is genetically determined – This information is used to construct evolutionary histories • Species that have evolved more recently share similar amino acid sequences than species that branched apart many millions of years ago Relationship to Humans Protein Cytochrome-C Species Amino Acid Differences Gorilla 1 Rhesus Monkey 8 Mouse 27 Chicken 45 Frog 67 Lamprey 125 Recent Branch = similar amino acid sequence Old branch = different amino acid sequence Embryo Development • Many related species have embryos that resemble each other – fertilized eggs go through similar patterns of development • Develop tail, buds for limbs, and pharyngeal pouches (become gills in fish and amphibians) – Tail in humans disappears before birth = tail bone – Pharyngeal pouches develop into other structures Crash Course - Evidence for Evolution