Download MATERNAL CARDIOVASCULAR ADAPTATIONS IN RODENT MODELS OF PREGNANCY COMPLICATIONS

MATERNAL CARDIOVASCULAR ADAPTATIONS IN RODENT
MODELS OF PREGNANCY COMPLICATIONS
by
Kristiina Laine Aasa
A thesis submitted to the Department of Biomedical and Molecular Sciences
In conformity with the requirements for
the degree of Doctor of Philosophy
Queen’s University
Kingston, Ontario, Canada
(April, 2015)
Copyright © Kristiina Laine Aasa, 2015
Abstract
Pregnancy induces a myriad of time-dependent changes to the maternal cardiovascular
(CV) system and correct orchestration of these adaptations is vital for pregnancy success and
future health of both mother and offspring. Complications in human pregnancy such as
preeclampsia (PE) and gestational diabetes are associated with aberrant gestation-induced
adaptations of the maternal CV system and adverse pregnancy outcomes. This thesis explores
how several pre-existing conditions affect pregnancy. It is hypothesized that the response of the
rodent maternal CV system to the burden of pregnancy will be impaired when challenged with
preexisting metabolic distress, impaired angiogenesis or underlying, subclinical congenital heart
defects, and these stressors will compromise fetal health.
To study the effects of metabolic distress on pregnancy, the non-obese diabetic (NOD)
mouse was used as a model of human diabetes. Diabetic mice exhibited a blunted maternal
cardiac response to pregnancy with concomitant renal pathologies. Offspring were afflicted with
CV abnormalities and decreased body weight. The link between PE and reduced maternal serum
levels of placental growth factor (PGF) prompted the study of Pgf-/- mice. Knockout mice
exhibited altered gestation-induced hemodynamic and CV responses, suggestive of a
cardioprotective role of PGF during pregnancy. This altered maternal phenotype did not affect
fetal blood flow but resulted in decreased fetal weights. Although congenital heart defects are the
most common birth anomaly, their impact on postnatal adaptation to pregnancy is unknown. To
investigate this, dimethadione (DMO), the N-demethylated metabolite of the anticonvulsant
trimethadione, was administered to pregnant rats to produce offspring with ventricular septal
defects. These deficits resolved as animals matured, reflecting a similar clinical phenomenon.
Despite absence of persistent structural or functional abnormalities, treated rats exhibited altered
CV and hemodynamic responses to pregnancy, suggesting latent CV dysfunction. Offspring of
these previously treated dams presented with increased body and placental weight.
ii
Together, work performed in this thesis emphasizes the importance of maternal CV
adaptions not only for pregnancy success but health of the offspring. Results also underscore the
role of PGF in gestational CV adaptations and the impact of in utero chemical exposures on the
postnatal capacity to adapt to pregnancy.
iii
Co-Authorship
All work presented in this thesis was performed by Kristiina Laine Aasa (KLA) and the coauthors listed below.
Chapter 2
Analysis of Maternal and Fetal Cardiovascular Systems During Hyperglycemic Pregnancy in the
Non-Obese Diabetic Mouse.
Authors: Kristiina L Aasa, Kenneth K Kwong (KKK), Michael A Adams (MAA), B Anne Croy
(BAC).
All experiments and data analysis were performed by KLA with the exception of cardiac and
renal histology, performed by KKK. KLA, MAA and BAC were involved in experimental design.
Manuscript was prepared by KLA and edited by MAA and BAC.
Chapter 3
Placental Growth Factor Influences Maternal Cardiovascular Adaptation to Pregnancy in Mice.
Authors: Kristiina L Aasa, Bruno Zavan (BZ), Rayana L Luna (RLL), Philip G Wong (PGW),
Nicole M Ventura (NMV), M Yat Tse (MYT), Peter Carmeliet (PC), Michael A Adams (MAA),
Stephen C Pang (SCP), and B Anne Croy.
All experiments and data analysis were conducted by KLA with the following exceptions: BZ
performed blood pressure measurements as well as cardiac and renal histology, RLL performed
cardiac immunohistochemistry. NMV was involved in technical training. PGW was involved in
technical training and experimental advice. MYT and SCP were involved in design of PCR
experiments. PC supplied and designed Pgf-/- mice used for all experiments. KLA, SCP, MAA
iv
and BAC were involved in experimental design. Manuscript was prepared by KLA and edited by
MAA, SCP and BAC.
Chapter 4
In utero Dimethadione exposure causes postnatal disruption in cardiac structure and function in
the rat.
Authors: Kristiina L Aasa, Elizabeth Purssell (EP), Michael A Adams, Terence RS Ozolinš
(TRSO).
KLA performed echocardiography experiments, EP performed animal work and radiotelemetry
experiments. Data analysis was performed by KLA, EP, MAA and TRSO. Manuscript was
prepared by KLA and EP. Manuscript was edited by KLA, MAA and TRSO.
Chapter 5
In utero exposure to a cardiac teratogen causes subsequent postnatal cardiovascular alterations
during pregnancy.
Authors: Kristiina L Aasa, Rebecca D Maciver (RDM), Shyamlal Ramchandani (SR), Michael A
Adams, Terence RS Ozolinš (TRSO).
All experiments and data analysis were performed by KLA except for PCR, which was performed
by RDM. Experiments were designed by KLA, SR, MAA and TRSO. Manuscript was prepared
by KLA and edited by RDM, SR and TRSO.
v
Acknowledgements
I am thrilled to acknowledge the vast number of individuals who have contributed in so
many ways to my successful completion of this thesis. First and foremost I would like to
acknowledge the tremendous contributions made by my supervisors. I would like to thank Dr.
Terence Ozolinš, who took me on under less than ideal circumstances; without you I don’t think I
would have gotten to where I am today. Thank you for helping me through my most stressful of
days, when everything that could have gone wrong in an experiment, did in fact go wrong; I
appreciate your constant support. I want to thank Dr. Anne Croy for picking out my application
and calling me out of the blue, for this is where my journey began. I so admire your work ethic
and your dedication and enthusiasm for academia and science. You introduced me to the world of
pregnancy research, taught me about scientific writing and, of course, initiated my love for highfrequency ultrasound! Last but certainly not least Dr. Michael Adams; you have been an amazing
source of support throughout this whole experience. Your dynamic passion and enthusiasm for
both scientific inquiry and the success of your students is overwhelming but so admirable,
infectious and motivating, all at the same time. Your words of encouragement and continued
advice were so valuable and meant so much to me; you have been an awesome individual to have
in my corner!
There are several other faculty members that provided me with excellent guidance
throughout this endeavor. Dr. Stephan Pang, not only were you a member of my supervisory
committee, you were also an excellent source of support and guidance over the years; thank you
for your enthusiastic words of encouragement and thoughtful academic advice. Another amazing
pillar of support throughout this venture has been Dr. Charles Graham; your advice and
reassurance has been so pivotal to my perseverance. Thank you Drs. Yat Tse, Louise Winn and
Kim Dow for all of your excellent advice (of all types), you have all had a significant impact on
my success.
vi
I would be remiss if I didn’t acknowledge the assistance and support provided DBMS
staff: Marilyn McAuley, Diane Sommerfeld, Jackie Moore, Natalie Barns, Alana Korczynski and
Wendy Cumpson. I would also like to thanks the ACS staff for all of their help with special
thanks to Drs. Andrew Winterborn and Janine Handforth for all your tremendous advise, and of
course all of the time you spent helping me salvage my final experiment. Kim Laverty, you are
awesome! You have been such a massive help; I don’t know what I would have done without
you, thanks for always being so positive.
To my 8th floor support system, you have all been so important to me. Tiziana, you have
been there from our P2 days and never hesitated to drop what you were doing to provide me (or
anyone else) assistance with experiments, analysis, research ideas or just general life advice. You
are an inspirational scientist, person and of course, friend; I still owe you a million coffees!
Malia, Nicole, Carolina, Harman, Karalyn, Phil, Dave and Rebecca (even though you are a couple
floors down), thank you all for your support (both academically and personally), the coffee breaks
and grad club celebrations helped me survive.
Thank you to my family for dealing with me as I decided to postpone getting a real job
and took on another degree. Ema, isa and Toomas thank you for your continued understanding
and support as I took on this enormous challenge. To my Estos, thank you for keeping me
grounded, reminding me of what is important in life and providing me with such awesome and
memorable opportunities to take a break from science… this balance has been crucial.
Andrew, you have been with me from the beginning and every step of the way. Thank
you for supporting me and listening to me talk science day in and day out for the last 4 years.
Thank you for encouraging me to persevere through the most challenging days. You’re my best
friend and I’m so excited to begin the next chapter in our lives, you’re the best! Finally, to Mesi
(my other best friend), you make me forget all of my worries the instant I walk in the door to your
over-the-top, enthusiastic greeting, it is always the best part of my day!
vii
Table of Contents
Abstract........................................................................................................................................... ii
Co-Authorship ............................................................................................................................... iv
Acknowledgements ....................................................................................................................... vi
List of Figures.............................................................................................................................. xiii
List of Tables ................................................................................................................................ xv
List of Abbreviations .................................................................................................................. xvi
Chapter 1. General Introduction .................................................................................................. 1
1.1 Maternal Cardiovascular System in Normal Pregnancy ........................................................ 2
1.1.1 Heart and cardiovascular system..................................................................................... 2
1.1.2 Utero-placental vessels ................................................................................................... 5
1.1.3 Rodent pregnancy ........................................................................................................... 6
1.2 Pregnancy Complications ...................................................................................................... 7
1.2.1 Diabetes in pregnancy ..................................................................................................... 7
1.2.1.1 The non-obese diabetic mouse ................................................................................. 8
1.2.2 Intrauterine growth restriction ........................................................................................ 9
1.2.3 Preeclampsia ................................................................................................................. 10
1.3 Growth Factors and Pregnancy ............................................................................................ 10
1.3.1 Normal growth factor expression .................................................................................. 10
1.3.2 Altered growth factor expression .................................................................................. 15
1.4 Placental Growth Factor ...................................................................................................... 15
1.4.1 Placental growth factor and angiogenesis ..................................................................... 16
1.4.2 Placental growth factor as a cardioprotectant ............................................................... 16
1.5 Fetal Programming............................................................................................................... 17
1.5.1 Barker hypothesis.......................................................................................................... 17
1.5.2 Thrifty phenotype hypothesis........................................................................................ 18
1.6 Normal Cardiac Development ............................................................................................. 19
1.6.1 Heart development in rodents ....................................................................................... 22
1.6.2 Cardiogenic genes ......................................................................................................... 24
1.6.3 VEGF and hypoxia in cardiovascular development...................................................... 25
1.7 Congenital Heart Defects – Ventricular Septal Defects ....................................................... 26
1.7.1 Genes involved in congenital heart defects................................................................... 28
1.7.2 Cardiac teratogens ......................................................................................................... 29
viii
1.8 Dimethadione ....................................................................................................................... 31
1.8.1 Trimethadione in humans ............................................................................................. 31
1.8.2 As model in rodents ...................................................................................................... 33
1.9 Rationale, Hypotheses, Objectives....................................................................................... 34
Chapter 2. Analysis of Maternal and Fetal Cardiovascular Systems During Hyperglycemic
Pregnancy in the Non-Obese Diabetic Mouse ........................................................................... 39
2.1 Abstract ................................................................................................................................ 40
2.2 Introduction .......................................................................................................................... 41
2.3 Materials And Methods........................................................................................................ 44
2.3.1 Animal use .................................................................................................................... 44
2.3.2 Ultrasonography............................................................................................................ 44
2.3.3 Histological analyses .................................................................................................... 46
2.3.4 Statistical analyses ........................................................................................................ 46
2.4 Results .................................................................................................................................. 48
2.4.1 General features of NOD pregnancies .......................................................................... 48
2.4.2 Cardiac assessments in d-NOD and c-NOD before conception and at gd8 .................. 48
2.4.3 Maternal cardiac adaptations from gd10-16 ................................................................. 48
2.4.3.1 Ultrasound .............................................................................................................. 48
2.4.3.2 Histopathology ....................................................................................................... 52
2.4.4 Renal analyses............................................................................................................... 54
2.4.5 Fetal umbilical cord analyses ........................................................................................ 54
2.5 Discussion ............................................................................................................................ 59
2.6 Acknowledgements .............................................................................................................. 64
Chapter 3. Placental Growth Factor Influences Maternal Cardiovascular Adaptation to
Pregnancy in Mice........................................................................................................................ 65
3.1 Abstract ................................................................................................................................ 66
3.2 Introduction .......................................................................................................................... 67
3.3 Methods ............................................................................................................................... 69
3.3.1 Experimental animals.................................................................................................... 69
3.3.2 ELISA ........................................................................................................................... 69
3.3.3 Arterial pressure recordings .......................................................................................... 69
3.4 Ultrasonography................................................................................................................... 70
3.4.1 Postmortem organ wet-weights ..................................................................................... 71
3.4.2 Histological and morphometric analyses ...................................................................... 71
ix
3.4.3 Real-time quantitative PCR (RT-qPCR) ....................................................................... 72
3.4.4 Statistical analyses ........................................................................................................ 73
3.5 Results .................................................................................................................................. 74
3.5.1 Maternal plasma PGF concentrations fluctuate over gestation ..................................... 74
3.5.2 MAP over gestation ...................................................................................................... 74
3.5.3 Echocardiographic evaluation of cardiac function ........................................................ 77
3.5.4 Echocardiographic and post-mortem assessment of cardiac structure .......................... 77
3.5.5 LV gene and protein expression.................................................................................... 78
3.5.6 Renal analyses in virgin and pregnant Pgf-/- mice ......................................................... 78
3.5.7 Fetal outcomes in Pgf-/- pregnancy................................................................................ 80
3.6 Discussion ............................................................................................................................ 86
3.7 Acknowledgements .............................................................................................................. 91
Chapter 4. In utero Dimethadione Exposure Causes Postnatal Disruption in Cardiac
Structure and Function in the Rat ............................................................................................. 92
4.1 Abstract ................................................................................................................................ 93
4.2 Introduction .......................................................................................................................... 94
4.3 Materials And Methods........................................................................................................ 96
4.3.1 Animals ......................................................................................................................... 96
4.3.2 Radiotelemetry .............................................................................................................. 97
4.3.3 Echocardiography ......................................................................................................... 97
4.3.4 Data analysis ................................................................................................................. 98
4.4 Results ................................................................................................................................ 100
4.4.1 Body weight and viability ........................................................................................... 100
4.4.2 Activity levels ............................................................................................................. 100
4.4.3 Blood pressure parameters .......................................................................................... 102
4.4.4 Cardiac functional parameters .................................................................................... 106
4.4.5 Cardiac electrophysiology........................................................................................... 109
4.4.6 Cardiac structure ......................................................................................................... 113
4.5 Discussion .......................................................................................................................... 115
4.6 Acknowledgements ............................................................................................................ 121
Chapter 5. In utero Exposure to a Cardiac Teratogen Causes Reversible Deficits in
Postnatal Cardiovascular Function, but Altered Adaptation to the Burden of Pregnancy 122
5.1 Abstract .............................................................................................................................. 123
5.2 Introduction ........................................................................................................................ 124
x
5.3 Materials And Methods...................................................................................................... 127
5.3.1 Experimental animals.................................................................................................. 127
5.3.1.1 Dosing .................................................................................................................. 127
5.3.1.2 Animal care during and after pregnancy .............................................................. 127
5.3.2 Ultrasonography.......................................................................................................... 129
5.3.2.1 Early postnatal scans ............................................................................................ 129
5.3.2.2 Baseline non-pregnant scans ................................................................................ 130
5.3.2.3 F1 gestational scans ............................................................................................. 130
5.3.3 Radiotelemetry ............................................................................................................ 130
5.3.3.1 Radiotelemetry data acquisition and analysis ...................................................... 131
5.3.4 Mating ......................................................................................................................... 132
5.3.5 Tissue collection ......................................................................................................... 132
5.3.6 Histological and morphometric analyses .................................................................... 132
5.3.7 Real-time quantitative PCR (RT-qPCR) ..................................................................... 132
5.3.8 Statistical analyses ...................................................................................................... 133
5.4 Results ................................................................................................................................ 134
5.4.1 F1 treated offspring were smaller than age-matched controls. ................................... 134
5.4.2 Early postnatal changes in CV structure and function resolve by adulthood in F1
offspring. .............................................................................................................................. 134
5.4.3 Pregnancy revealed functional differences between treated and control dams. .......... 137
5.4.4 Radiotelemetric recordings revealed changes in the maternal hemodynamic response to
pregnancy between treated and control dams. ..................................................................... 137
5.4.5 Despite differences in CV function over pregnancy, treated hearts were not structurally
different from control hearts. ............................................................................................... 142
5.4.6 LV gene expression analysis revealed subtle differences in expression of genes related
to the hypertrophic response in treated hearts. ..................................................................... 142
5.4.7 Maternal CV changes in F1 treated dams were linked with differences in F2 generation
fetuses. ................................................................................................................................. 145
5.5 Discussion .......................................................................................................................... 147
5.6 Acknowledgements ............................................................................................................ 153
Chapter 6. General Discussion.................................................................................................. 154
6.1 Overall Summary ............................................................................................................... 155
6.2 Maternal cardiovascular adaptations in pregnancy and pregnancy success ....................... 159
6.3 Pregnancy-related cardiac gene expression ....................................................................... 160
xi
6.4 Mechanisms of cardiac maladaptations in complicated pregnancies ................................. 163
6.5 Potential effects of altered cardiovascular responses in pregnancy on offspring .............. 164
6.6 Conclusions ........................................................................................................................ 167
6.7 Future Directions ............................................................................................................... 168
6.7.1 Role of placental growth factor in normal and complicated pregnancies. .................. 168
6.7.2 Teratogenic exposure and associated long-term cardiac dysfunction. ........................ 170
6.7.3 Ventricular septal defects at birth and negative pregnancy outcomes. ....................... 171
Bibliography ............................................................................................................................... 173
Appendix A ................................................................................................................................. 196
Appendix B ................................................................................................................................. 200
Appendix C ................................................................................................................................. 206
Appendix D ................................................................................................................................. 208
xii
List of Figures
Figure 1.1. Normal human pregnancy induces changes to the maternal cardiovascular system. .... 3
Figure 1.2. The mammalian cardiac hypertrophic phenotype (both cellular and gross anatomic) is
stimulus-dependent. ......................................................................................................................... 4
Figure 1.3. Expression levels of circulating sFlt, PGF and sENG over normal human pregnancy
and preeclamptic (PE) pregnancy. ................................................................................................. 12
Figure 1.4. The VEGF family with binding receptors. .................................................................. 13
Figure 1.5. Major steps of cardiogenesis in human, rat and mouse. .............................................. 20
Figure 1.6. Differences between prenatal and postnatal circulations............................................. 23
Figure 1.7. Metabolism of trimethadione (TMD) into dimethadione (DMO). .............................. 32
Figure 2.1. Maternal cardiac analyses. ........................................................................................... 51
Figure 2.2. Left ventricular size and extent of dilation, calculated using ultrasonography and
histological analyses. ..................................................................................................................... 53
Figure 2.3. Renal physiology assessed via ultrasonography and histolopathology. ...................... 55
Figure 2.4. Fetal Scan. ................................................................................................................... 57
Figure 3.1. Circulating PGF concentrations in B6 mice using ELISA (n=3-5 pregnancies/timepoint). ............................................................................................................................................. 75
Figure 3.2. Gestation-induced hemodynamics and cardiac systolic function are altered in Pgf-/dams. .............................................................................................................................................. 76
Figure 3.3. PGF deficiency is accompanied by cardiac structural differences across pregnancy and
post-partum. ................................................................................................................................... 79
Figure 3.4. Upregulated gene expression in left ventricular (LV) tissue of Pgf-/- mice at
midgestation. .................................................................................................................................. 82
Figure 3.5. Renal hypertrophy and structural abnormalities are present in pregnancies lacking
PGF. ............................................................................................................................................... 83
Figure 3.6. Maternal CV consequences of PGF deficiency have negligible fetal impact. ............. 84
Figure 4.1. Activity levels of telemetered rats. ............................................................................ 101
Figure 4.2. Postnatal blood pressure recordings obtained using radiotelemetery in offspring that
were exposed in utero to vehicle or DMO. .................................................................................. 104
Figure 4.3. Changes in mean arterial pressure (MAP) in response to changing dietary salt loads
beginning at six months of age. ................................................................................................... 105
Figure 4.4. Cardiovascular function assessed by echocardiography at one year of age. ............. 108
xiii
Figure 4.5. Representative ECGs of one year old rats exposed in utero to DMO or vehicle (CTL).
..................................................................................................................................................... 111
Figure 4.6. Cardiac motion analysis at one year of age by echocardiography. ............................ 112
Figure 5.1. Schematic representation of study methodology. ...................................................... 128
Figure 5.2. Cardiovascular function in control and treated F1 offspring prior to and during
pregnancy, as assessed using echocardiography. ......................................................................... 139
Figure 5.3. Cardiovascular and hemodynamic parameters measured by radiotelemetry............. 140
Figure 5.4. Cardiac structure on gd 12 and 18 of pregnancy. ...................................................... 143
Figure 5.5. Left ventricular gene expression in hearts of treated versus control F1 dams during
pregnancy. .................................................................................................................................... 144
Figure 5.6. F2 generation fetal parameters. ................................................................................. 146
xiv
List of Tables
Table 2.1. Maternal Characteristics ............................................................................................... 49
Table 3.1.Fetal/Pup Weight in Gestation and Post-partum. ........................................................... 85
Table 4.1. Assessment of Cardiac Contractility by Echocardiography........................................ 107
Table 4.2. Quantitative Assessment of Electrocardiogram Tracing ............................................ 110
Table 4.3. Assessment of Heart Dimensions by Echocardiography. ........................................... 114
Table 5.1. F1 Postnatal Weight Gain ........................................................................................... 135
Table 5.2. Postnatal Cardiac Function and Structure in F1 Offspring by Echocardiography ...... 136
Table 5.3. Baseline (10 weeks of age) Cardiac Function and Structure by Echocardiography in
Virgin F1 Females ....................................................................................................................... 138
xv
List of Abbreviations
Ang2
Angiotensin 2
ANOVA
Analysis of variation
ANP
Atrial natriuretic peptide
AV
Atrioventricular
B6
C57BL/6J
BP
Blood pressure
bpm
Beats per minute
BW
Body weight
c-NOD
Normoglycemic/control NOD mouse
cDNA
Complimentary deoxyribonucleic acid
CHD
Congenital heart defect
CIHR
Canadian institutes of health research
CO
Cardiac output
CT
Threshold cycle
CTL
Control
CV
Cardiovascular
d
Days
d-NOD
Diabetic NOD mouse
DMO
Dimethadione
ECG
Electocardiogram
ECM
Extracellular matrix
EDTA
Ethylenediaminetetraacetic acid
EDV
End diastolic velocity
EF
Ejection fraction
ELISA
Enzyme-linked immunosorbent assay
FDA
Food and drug administration
FS
Fractional shortening
Gapdh
Glyceraldehyde 3-phosphate dehydrogenase
GATA
GATA zinc finger transcription factor
gd
Gestation day
Gusb
Glucuronidase, beta
xvi
h
Hour
H&E
Hematoxylin and Eosin
Hg
Mercury
HIF1 α
Hypoxia inducible factor 1 alpha
HR
Heart rate
IgG
Immunoglobulin G
IHC
Immunohistochemistry
IUGR
Intrauterine growth restriction
Jarid2
Jumonji ATP rich interactive domain 2
kg
Kilogram
LV
Left ventricle
LVAW
Left ventricular anterior wall
LVAW;d
Left ventricular anterior wall in diastole
LVAW;s
Left ventricular anterior wall in systole
LVPW
Left ventricular posterior wall
M-Mode
Motion mode
MAP
Mean arterial pressure
mg
Milligram
MHC
Myosin heavy chain
MHz
Megahertz
MI
Myocardial infarct
min
Minutes
miR
Micro-RNA
mm
Millimeter
MRI
Magnetic resonance imaging
Nkx2.5
NK2 homeobox 5
NO
Nitric oxide
NOD
Non-obese diabetic
NOS
Nitric oxide synthase
Nppa
Natriuretic pro-peptide A
Nppb
Natriuretic pro-peptide B
Npra
Natriuretic peptide receptor A
Nprb
Natriuretic peptide receptor B
Nprc
Natriuretic peptide receptor C
xvii
NRP
Neuropilin
PA
Pulmonary artery
PAH
Pulmonary arterial hypertension
PAS
Periodic acid Schiff
PE
Preeclampsia
PFA
Paraformaldehyde
PGF
Placental growth factor
PLAX
Parasternal long axis
PND
Postnatal day
PO2
Partial pressure of oxygen
PP
Postpartum
PSV
Peak systolic velocity
PW
Pulsed-wave
qPCR
Quantitative polymerase chain reaction
RA
Renal artery
RAS
Renin-angiotensin system
RI
Resistance Index
RNA
Ribonucleic acid
RT
Reverse transcription
RUPP
Reduced uterine perfusion pressure
RV
Renal vein
RV
Right ventricle
SA
Spiral arteries
SAP
Systolic arterial pressure
SARC
Senate advisory research committee
SAX
Short axis
SEM
Standard error of the mean
sENG
Soluble endoglin
Serca2a
Sarcoplasmic reticulum Ca2+ ATPase
sFlt
Soluble Fms-like tyrosine kinase
SV
Stroke volume
SVR
Systemic vascular resistance
T1DM
Type 1 diabetes mellitus
T2DM
Type 2 diabetes mellitus
xviii
TAC
Transverse aortic constriction
Tbx5
T-box transcription factor 5
TGF-β
Transforming growth factor beta
TMD
Trimethadione
UA
Umbilical artery
uNK
Uterine natural killer
VEGF
Vascular endothelial growth factor
VEGFR
Vascular endothelial growth factor receptor
VSD
Ventricular septal defect
yr
Year
xix
Chapter 1
General Introduction
1
1.1 Maternal Cardiovascular System in Normal Pregnancy
To adequately support fetal growth and development, the maternal cardiovascular (CV)
system in particular undergoes substantial adaptations during pregnancy. Pre-existing conditions
such as diabetes and CV disease increase the likelihood of an adverse pregnancy outcome, when
the maternal CV system is unable to appropriately adapt to the increasing demands of pregnancy
1-3
. Pregnancies complicated by an aberrant maternal CV response pose a serious risk for
increased morbidity and mortality for mother and offspring and are associated with long-term
consequences for both generations 4-6. This thesis investigates the maternal CV adaptations to
normal pregnancy in the rodent, including changes in CV function, structure, gene expression and
expression of important growth factors. This will be contrasted with maternal adaptations and
fetal consequences occurring in response to pregnancies complicated by preexisting maternal
diabetes, angiokine depletion and previous congenital heart defect (CHD).
1.1.1 Heart and cardiovascular system
Pregnancy is a physiological challenge for the maternal CV system and clinically has
been referred to as a CV “stress test” 7,8. Pregnancy-induced changes to the maternal CV system
in mammals include a 30-40% increase in blood volume 9, 30-60% increase in cardiac output
(CO), transient cardiac hypertrophy (Figure 1.1) 3,9,10 and uterine spiral arterial (SA) remodeling
11
. Cardiac hypertrophy occurring in normal pregnancy is physiological and reversible, similar to
exercise-induced hypertrophy. Hypertrophy in the heart can also be pathological and irreversible
under morbid stimuli; however, this can be differentiated from physiologic hypertrophy through
anatomical, histological, physiological and molecular analyses (Figure 1.2) 8,12. In normal human
pregnancy mean arterial pressure (MAP) reaches a nadir at 16-20 weeks due to increased fetal
and maternal vasculature and a decrease in systemic vascular resistance (SVR) 13,14. Maternal
pressure then increases to baseline values by term (40 weeks) 13,15. A continual decrease in SVR 16
2
Figure 1.1. Normal human pregnancy induces changes to the maternal cardiovascular
system.
During normal pregnancy blood volume (BV) increases 30-40%. Cardiac output (CO) increases
as much as 30-60% due to increased heart rate (HR) (15-30%) and increased stroke volume (SV)
(15-25%). Mean arterial pressure (MAP) decreases slightly, reaching a nadir (-5-10%) at midgestation. Maintenance of MAP is achieved by decreasing systemic vascular resistance (SVR) (30%). All parameters normalize postpartum (PP). This figure was adapted from Liu et al.3,
Poppas et al.16 and Moutquin et al.13.
3
Figure 1.2. The mammalian cardiac hypertrophic phenotype (both cellular and gross
anatomic) is stimulus-dependent.
Normal pregnancy, as well as consistent exercise, results in physiological cardiac hypertrophy,
which is characterized by proportional increases in left ventricular (LV) lumen diameter and LV
wall thickness. This type of hypertrophy is completely reversible under normal circumstances.
There are also two types of pathophysiological hypertrophy depending on instigating stimulus.
Concentric hypertrophy is the result of pressure overload to the heart and is characterized by a
more pronounced increase in LV wall thickness, compared to lumen diameter and exaggerated
increase in myocyte width versus length. Eccentric (or dilated) hypertrophy occurs in
circumstances of volume overload to the heart and results in dilation of the LV lumen without
proportional increases in LV wall thickness. In this latter case, increases in myocyte length far
exceed increases in myocyte width and the condition is associated with progress to severe cardiac
dysfunction. Both forms of pathological hypertrophy are irreversible, however, can regress to
some degree. In contrast, upon sustained stimulus, concentric hypertrophy can progress into
dilated hypertrophy. This type of pathological hypertrophy is also associated with activation of
fetal gene systems in the heart 8 RV – Right ventricle. Adapted from Chung et al 8 and Heineke et
al.12.
4
is responsible for maintenance of blood pressure (BP), despite increased blood volume, stroke
volume (SV) and heart rate (HR) 16. Changes in kidney function and increased sodium and water
retention contribute to the increased blood volume. The decrease in SVR associated with
pregnancy is largely attributed to decreased maternal vascular sensitivity to vasoconstrictors and
to the effects of the renin angiotensin system (RAS) in particular. Concurrently, pregnancy is also
associated with increased hormone-induced vasodilation and increased expression of nitric oxide
(NO), a potent vasodilator 17,18.
1.1.2 Utero-placental vessels
As the placenta invades the decidualized maternal endometrium many changes occur to
facilitate nourishment of the growing conceptus. One very important physiological event is the
modification of the torturous maternal SA, a process referred to as SA remodeling. During the 8th12th week of human pregnancy these vessels modify to acquire a more venous, highly dilated
phenotype 19,20. The altered venous phenotype accommodates higher blood flow to the placenta.
This arterial modification is the subject of extensive research mainly due to the link between
absence of this physiological transformation and development of pregnancy complications such
as preeclampsia (PE) and intrauterine growth restriction (IUGR) (reviewed in 21). Trophoblast
invasion and infiltration of uterine natural killer (uNK) cells are involved in the physiological
change in these vessels during normal gestation 22-24.
Additional hemodynamic changes occur in the uterine vessels during normal pregnancy.
Uterine and umbilical artery peak flow velocities (determined by ultrasound) increase with
progression of gestation in normal human pregnancy 25-27; with a concomitant decrease in
resistance index (RI) 25,27,28. RI is reflective of vascular resistance and vascular compliance 29 and
is a function of peak systolic velocity (PSV) and end diastolic velocity (EDV) (RI=(PSVEDV)/PSV). Uterine artery diameter also increases substantially by the 16th week of human
pregnancy to accommodate increased uteroplacental blood flow 30.
5
1.1.3 Rodent pregnancy
Research into mouse and rat gestation has identified many similarities to humans in the
maternal CV response to pregnancy. The BP profile in murine pregnancy has been well
characterized by Burke et al. showing 5 distinct phases of BP fluctuations throughout gestation.
The overall pattern is similar to that seen in human pregnancy 31. The highlight of this
characterized profile is a mid-gestational nadir in MAP seen at gestation day (gd)9, of the 1920gd murine pregnancy. Following this nadir, pressure increases towards baseline until term 31.
Similarities in gestational MAP were seen in untreated Wistar rats as well; MAP slowly
decreased until reaching a nadir at gd11 of the 21-22gd pregnancy, after which pressure increased
until gd14 and then decreased until term 32.
Cardiac structural and functional adaptations to pregnancy in rodents also bear
similarities to the human condition. A study by Kulandavelu et al. characterized normal mid and
late gestational cardiac adaptations in C57BL/6J (B6) mice. They found increased CO, SV,
plasma volume and left ventricular (LV) mass (from pre-pregnancy values) by gd9.5, peaking at
gd17.5. These cardiac changes were accompanied by a decrease in systolic arterial pressure
(SAP) and a postulated decrease in SVR over the gestational time-points measured (virgin, gd9,
gd17 and 3 weeks postpartum (PP)) 33. This study did not demonstrate increased HR during
pregnancy in normal B6 mice, however, a study in CD-1 mice has shown an increase in HR
during pregnancy, analogous to that seen in humans 33,34. Outbred CD-1 mice also show similar
pregnancy-induced changes in CO, SV and SAP 34. Comparable effects on HR, CO, SV and
plasma volume have been seen in outbred rat pregnancies 35.
Uterine vessels show analogous pregnancy-induced adaptations in rodents as in humans.
Uterine SA remodeling towards a more venous phenotype is well characterized in both rat and
mouse pregnancy 36-38. By high-frequency ultrasound uterine hemodynamics in rodent pregnancy
6
have also been observed. Similar to humans, uterine and umbilical artery peak flow velocity
increases with advancing gestation, while RI in these vessels decreases 39.
1.2 Pregnancy Complications
Major complications of pregnancy, such as PE, IUGR or gestational diabetes, increase
maternal and fetal risks for postpartum CV disease 2,6,40,41. Little is known regarding the etiology
of these disorders or the mechanisms that leave the legacy of long-term elevated CV risk in
mothers and their offspring 2. Many maternal factors have been associated with the development
of pregnancy complications, such as pre-existing CV disease, 42 diabetes 4,5, maternal
inflammation 32, maternal undernutrition 43 and an imbalance of angiogenic factors in maternal
blood 44.
1.2.1 Diabetes in pregnancy
Hyperglycemia in pregnancy is a common obstetrical condition, affecting approximately
17% of pregnancies globally 45 and, depending on diagnostic criteria, 3-15% of pregnancies in
Canada 46. Pre-existing diabetes mellitus (both type 1 (T1DM) and type 2 (T2DM)) has a negative
impact on both maternal and fetal health and represents a high-risk obstetrical case 5,47. In
addition, the CV and metabolic challenge of pregnancy can induce new-onset diabetes in a
condition known as gestational diabetes Gestational diabetes is defined as identification of
glucose intolerance during pregnancy, likely unmasked due to the metabolic stress pregnancy
places on the maternal system. Hormone-induced fluctuations in maternal β-cell number and
changes in insulin secretion and sensitivity contribute to this pregnancy-induced metabolic stress
48
. This new onset disease poses similar obstetrical risks to both mother and infant, and although
the condition subsides after parturition, mothers are at higher risk for developing T2DM later in
life 49,50. During diabetic pregnancy maternal risk for stillbirth, retinopathy, and incidences of
7
severe hypoglycemia, amongst other complications, increases. Proper obstetrical care for the
diabetic mother requires a multi-disciplinary team of health care providers, not only to ensure
adequate care for the mother, but also to optimize fetal health 1. Risk to the developing fetus
occurs through altered placental blood flow 51,52 as well as transport of excess glucose through the
placenta and excess fetal insulin production 53. This creates both acute and long-term effects to
the offspring through maladaptive growth and fetal programming, respectively 50,54. Offspring of
diabetic pregnancies also have a 6-fold increased risk for developing T2DM by 10-16 years of
age, contributing to a vicious cycle of increased prevalence of metabolic disorders 55,56. These
offspring are also at a greater risk for developing CV disease and obesity later in life. Independent
of maternal body weight (BW), offspring of diabetic pregnancies have increased SAP 57 and a
higher prevalence of obesity compared to offspring of normal pregnancies 58. Diabetic pregnancy
is also associated with a higher risk for fetal malformations, such as neural tube defects and
cardiac defects 59,60.
1.2.1.1 The non-obese diabetic mouse
The non-obese diabetic (NOD) mouse is a well-established, commercially available
inbred model for T1DM 60,61. NOD/ShiLtJ mice are phenotypically normal at birth, developing
autoimmune pancreatic insulitis by 4 weeks of age 62. As NOD mice age they spontaneously
develop insulin resistance through pancreatic islet cell destruction from 12 weeks of age onwards.
Not all mice become hyperglycemic; it is expected that 90-100% of females and 50-60% of males
will be hyperglycemic by 30 weeks. The remaining normoglycemic mice are available for use as
litter-mate controls, making the NOD strain an attractive model for experimental studies 63. Once
hyperglycemia onsets, the disease progresses rapidly and animals become very ill unless treated.
With regular insulin treatments, fluid injections and additional care, animal viability can be
maintained for weeks to months 64,65. Other animal models of diabetes use drug treatment to
initiate acute pancreatic cell destruction and diabetes progression. One well-established example
8
is the streptozotocin mouse or rat model of T1DM. This model uses antibiotic (streptozotocin)
treatment to cause pancreatic β-cell damage, long-term insulin deficiency and hyperglycemia 66,67.
A disadvantage of chemically induced models like this is the inability to ascertain if abnormalities
are a result of the treatment itself or diabetic sequelae. Similar to the human condition, diabetic
NOD (d-NOD) mice have altered placental vascular development, with limited SA remodeling
and a higher incidence of fetal abnormalities 68. Studies of d-NOD pregnancies also show similar
impairments in fetal growth to the human condition; some report macrosomic offspring 69, while
others report growth-restricted offspring 68.
1.2.2 Intrauterine growth restriction
The precise definition of IUGR remains controversial, however, diagnosis typically
involves a fetus not fully achieving its growth potential 70. Many clinics use a birth weight below
the 10th percentile (after normalization to gestational age and maternal factors) to define a neonate
as small for gestational age or IUGR 71. Others suggest that true IUGR must include some
compromise of fetal blood flow as well decreased weight and that it is the former that contributes
to fetal CV programming 72. Regardless of the definition of IUGR, the factors that lead to its
pathogenesis are varied.
In the case of IUGR, insufficient fetal blood flow due to some form of placental
impedance or dysfunction, has been implicated in its pathogenesis 72. The hypoxic environment
resulting from placental insufficiency has also been associated with the development of IUGR 73.
The physiological state of the in utero environment is hypoxic by nature, with fetal PO2 ranging
from 22-32mmHg at its highest (16-24 weeks gestation), compared to a PO2 of 80-100mmHg in
the adult 74,75. This level of hypoxia is necessary for normal fetal development 76, although tight
control of fetal PO2 is critical, as excessive hypoxia is also detrimental 73,75,77.
9
1.2.3 Preeclampsia
PE is a high-risk complication of human pregnancy characterized by new-onset
hypertension, occurring in approximately 5% of pregnancies 78. While the current treatment for
PE is delivery of the fetus and placenta (usually pre-term) 79 ongoing studies focus on
interventions that reduce clinical symptoms and prolong pregnancy 80 thereby improving maternal
and fetal health. Diagnosis of PE and the number of forms of PE that exist are also areas of
controversy and active research. While new onset hypertension has always been a hallmark of the
disorder, previous definitions also included the presence of proteinuria, but this has since been
removed as a diagnostic criterion 81 and replaced by more widespread endothelial cell
pathologies.
Little is known regarding the PE-associated mechanisms that result in elevated risk to the
CV systems of mothers and their offspring 2; however, it is known that many women who
experience PE have abnormal serum levels of angiogenic and anti-angiogenic growth factors
prior to clinical disease onset 82.
1.3 Growth Factors and Pregnancy
1.3.1 Normal growth factor expression
A myriad of systems are involved in the maternal responses to pregnancy, including but
not limited to, inflammatory mediators, hormones, vasoactive systems and growth factors 8,17,83.
Several angiogenic and anti-angiogenic growth factors are pivotal for physiological adaptations to
pregnancy and are the subjects of extensive research due to their link to pathophysiology in
pregnancy. In recent years vascular endothelial growth factor A (VEGF) and its soluble receptor
Fms-like tyrosine kinase receptor 1 (sFlt1), as well as placental growth factor (PGF) and soluble
endoglin (sENG) have all come to the forefront of pregnancy research 84-87. Of particular interest
10
are the dynamic expression patterns of these growth factors in the maternal circulation during
normal pregnancy and how these change in patients with pregnancy complications (Figure 1.3).
VEGF is an important endothelial cell specific angiogenic factor, part of the cysteine-knot
superfamily of growth factors. In humans this dimeric glycoprotein exists as 6 isoforms created
by alternative splicing. Major functions of VEGF include endothelial cell proliferation and
migration amongst other pro-angiogenic functions 88,89. The transcription factor hypoxia inducible
factor 1 alpha (HIF1α) contributes to the control of VEGF expression via hypoxia response
elements in the VEGF promoter, establishing a causal link between hypoxia and angiogenesis 90.
Expression of VEGF is critical for development in the mouse and rat, especially of the CV system
and its absence is embryo-lethal 91-94. Homozygous VEGF mutations in mice lead to fetal death
by gd8.5-9.5; loss of even a single VEGF allele results in fetal loss by gd11-12 94. However,
literature suggests that tight control of VEGF expression is critical and that moderate
overexpression (2-3 fold increase) during development also has a negative impact on the fetal CV
system (disruption of myocardium, outflow tract and septal defects, coronary abnormalities and
embryo-lethality by gd12.5-14) 73,95.
Maternal VEGF expression is high during normal pregnancy; levels are significantly
increased by 10-14 weeks gestation and peak at an approximate 5-fold increase (from prepregnancy levels) by weeks 34-36 in human pregnancy 96,97. This expression pattern reflects its
important roles not only for placental development, angiogenesis and vascular leakage, but also
dilation of uterine vessels and likely the systemic vasodilation and maternal CV response to
pregnancy 83,98. The main effects of VEGF are initiated by its binding to VEGFR2 (vascular
endothelial growth factor receptor 2), however, it is also capable of binding to VEGFR1 (also
known as Flt1) and its’ soluble decoy receptor, sFlt1 (Figure 1.4) 99. Binding of the remainder of
the VEGF system is depicted in Figure 1.4.
11
Figure 1.3. Expression levels of circulating sFlt, PGF and sENG over normal human
pregnancy and preeclamptic (PE) pregnancy.
Serum expression of PGF increases dramatically during normal pregnancy, reaching peak levels
at 29-32 weeks. PGF expression is substantially lower beginning early in gestation, in those that
later develop PE. Circulating sFlt levels remains relatively stable, increasing slightly towards
term in normal pregnancies. In contrast, sFlt levels are elevated compared to normotensive
pregnancies in the serum of patients who later develop PE, beginning at 33-36 weeks. sENG
levels in the maternal serum are also stable in normal pregnancy, increasing slightly towards
term. Pregnancies later complicated by PE are associated with increased sENG levels versus
normotensive controls, becoming significant by 25-28 weeks and remaining elevated until term.
Fold changes were determined based on expression levels at 8-12 weeks gestation. Figure adapted
from Levine et al.86 and Levine et al.87.
12
Figure 1.4. The VEGF family with binding receptors.
The VEGF isoforms (along with PGF) bind to both the VEGF receptors as well as neuropilin
(NRP) receptors. sFlt is the soluble splice variant of VEGFR-1 that acts as a decoy receptor,
decreasing bioavailability of its’ ligands (PGF, VEGFA and VEGFB). VEGFR-1 has several
ligands including PGF, VEGFA and VEGFB, and is the primary, high efficiency receptor for
PGF. VEGFR-2 is the primary, high efficiency receptor for VEGFA, however, it also binds
VEGF-C,D and E. VEGFR-3 is only bound by VEGFC and VEGFD. The NRP receptors can also
bind to members of the VEGF family. PGF as well as VEGF-A,B,C and D are able to bind to
NRP-1; NRP-2 binds to the same ligands with the exception of VEGFB (which it does not bind).
Figure adapted from Ruiz de Almodover et al.100 and Shibuya et al.88.
13
The soluble form of VEGFR1 is a truncated version and is anti-angiogenic because it acts
as an antagonist to both VEGF and PGF 99. Expression of this decoy receptor within the placenta
is thought to be involved in the tight regulation of VEGF expression, required for normal fetal
development 101. In both pregnant and non-pregnant states, excess sFlt1 is detrimental to the
maternal endothelium and leads to signs of endothelial dysfunction such as hypertension and
glomerular endotheliosis 102. In normal human pregnancy sFlt1 expression is higher than in the
non-pregnant state; levels remain stable until 33-36 weeks gestation, at which point expression
increases until term 87.
PGF is a member of the VEGF family with angiogenic properties targeted to endothelial
cells, and is involved in regulating vascular endothelial differentiation. PGF executes its
angiogenic properties primarily by binding with high affinity to VEGFR1 103. Binding of PGF to
VEGFR1 potentiates the effects of VEGF by increasing VEGF bioavailability for binding to
VEGFR2 104,105. The angiogenic effects of PGF are not as widespread as VEGF, typically
becoming relevant only when a pathology or stressor is present 104. Many have referred to PGF as
an “angiogenic switch” since its biological activities become relevant only upon stimulation by
pregnancy or a pathological state 106. There are fewer splice variants of PGF than VEGF, with
three isoforms present in humans 90. Only one isoform (PGF-2) has a heparin-binding domain,
making it the only membrane-associated isoform 107. Interestingly, this is the only isoform present
in rodents 107. Produced largely by trophoblast cells, PGF is expressed abundantly by the pregnant
uterus by maternal endometrial cells and uNK cells as well, amongst others. Importantly, this
growth factor is not exclusive to the pregnant uterus as pathological states initiate PGF production
in numerous other cell types 104,108. Expression levels within the uterus fluctuate throughout
pregnancy, peaking at mid gestation (gd16) in mice 104 or increasing in mid-gestation and peaking
at 26-30 weeks in humans 82 (Figure 1.3). Studies using immunodeficient mice suggest a role for
lymphocytes in regulating the expression levels of PGF during pregnancy 104.
14
ENG is an endothelial transmembrane glycoprotein and co-receptor for transforming
growth factor beta (TGF-β), 109 involved in nitric oxide (NO)- dependent vasodilation 110 as well
as angiogenesis 111. Proteolytic cleavage of membrane-bound ENG produces the antiangiogenic
factor sENG, which acts as an antagonist to TGF-β and contributes to endothelial dysfunction 112.
This placental-derived factor is found in the circulation of pregnant women 112. Normal
pregnancy results in increased sENG from weeks 33-36 until term 86,113 (Figure 1.3).
1.3.2 Altered growth factor expression
Decreased PGF and increased sFlt1 and sENG are characteristic of PE and used as
components in assessment/ diagnostic tools 78,102,113,114. Diagnosis of PE is a significant risk factor
for, and the most prevalent cause of, fetal IUGR 115. The mechanisms by which these molecular
markers are involved in uteroplacental insufficiency, PE or subsequent IUGR are largely
unknown, but changes in the balance of these angiogenic molecules may lead to poor placental
perfusion and/or placental hypoxic stress 78,107. This angiogenic imbalance may also be the direct
result of placental/fetal hypoxia, as VEGF is known to be a downstream product of HIF activation
116
. VEGF is also known to be vital for proper CV development, and is thought to directly
regulate endothelial cells during development 117.
1.4 Placental Growth Factor
There are several correlations between VEGF, and PGF specifically, with the heart and
CV system. Both VEGF and PGF have been found to play a role in hematopoiesis, with the latter
linked to the pathophysiology of hematopoietic disorders. This association is thought to reflect a
role for PGF in monocyte chemotaxis 90. Absence of PGF in knockout mice 118 has provided an
avenue for extensive research on its role in many different pathological and physiological
conditions.
15
1.4.1 Placental growth factor and angiogenesis
The angiogenic role of PGF is not limited to placental and pregnancy-related vasculature.
In fact, PGF and anti-PGF therapies have been studied in a variety of pathological conditions
including (but not limited to) cancer 119, sepsis 120 and myocardial infarct (MI) 106. The less
widespread effects of PGF (versus VEGF) and inability to directly activate endothelial cells have
made it a more attractive candidate for manipulating the angiogenic state in cases of pathology
121,122
. Levels of circulating PGF in non-pregnant, disease-free patients are also very low 123,
diminishing the potential side effects of anti-PGF therapies.
1.4.2 Placental growth factor as a cardioprotectant
The cardioprotective functions of PGF are well established in cardiac disease 124; this
includes but is not limited to improving recovery from MI and adaptive fibrosis formation107. In
healthy hearts, overexpression of PGF does not result in any cardiac phenotype, indicating that a
pathological trigger is needed to initiate the angiogenic effects of PGF. Further supporting this,
PGF knockout mice (Pgf-/-) have no reported cardiac phenotype 124. However, when Pgf-/- mice
are challenged with a cardiac stress test (such as pressure overload) they respond poorly, with
decreased myocyte length, dilatory growth, signs of heart failure and increased mortality
compared to PGF-competent controls 107,124,125. The PGF null hearts also show decreased capillary
density (a sign of decreased angiogenesis) 124. The adaptive response of the heart to hypertrophy
is primarily mediated by cardiomyocytes 12; PGF is thought to influence adaptive hypertrophy
through paracrine mechanisms, 125 by activation of VEGF and immune mediators 124. Examples of
paracrine contributions to adaptive hypertrophy include supporting extracellular matrix (ECM)
remodeling and fibroblast activation 124,126. When murine hearts are challenged with increased
pressure load, PGF overexpression leads to increased cardiac hypertrophy typified by an
increased myocyte width, increased capillary density and increased fibroblast activity. Excess
PGF also protects against heart failure in response to Angiotensin 2 (Ang2) infusion 124. Injection
16
of PGF after induction of MI increases angiogenesis in the infarcted region and improves cardiac
function with attenuation of maladaptive hypertrophy 127. Levels of PGF expression in the murine
heart are strongly correlated with prognosis of, and recovery after, MI 106 and negatively
correlated with infarct size 128. Indeed, several studies investigated the possibility of using PGF
infusion in the treatment of MI 127,129,130.
1.5 Fetal Programming
The rise in CV diseases of all types, as well as diabetes and obesity in the developed
world has strained health care delivery systems and reduced quality of life for individuals in
Canada and globally131-133. The in utero environment is critical for programming an individual
towards lifetime health or disease postnatally; this is especially the case for CV and metabolic
disorders 134. Above or below normal birth weight for gestational age has been strongly correlated
with adolescent and adult risk for obesity, diabetes and CV disease 50,135-137.
1.5.1 Barker hypothesis
The concept that the in utero environment has a strong impact on long-term health,
independent of genetic causes for disease, was developed and became widespread mainly through
the work of the late Prof. David Barker. This now fundamental concept is named the “Barker
hypothesis” because of the significant contributions made by his hundreds of publications
concerning the topic, however, it is also known as the “developmental origins of adult disease”
hypothesis 138. The link between the in utero environment and later disease was first made in the
field of coronary heart disease 139. This was followed closely by the discovery of an association
between labor complicated by maternal death, and offspring mortality from stroke in the
subsequent generation. This was another illustration of the impact of the in utero environment
and an adverse pregnancy on the CV health of offspring 140. It was originally thought that
17
hypertension was the sole link between fetal development and adult CV disease; in a large study
SAP at 10 years of age was found to be inversely correlated with birth weight 135. However
further associations were later discovered linking adult height 141, incidence of chronic bronchitis
142
, clotting 143, and metabolic state 144 amongst others (with or without concomitant
hypertension), to health of the in utero environment. Assessment of the in utero environment was
extended beyond the success of the pregnancy (without complications) to consider birth weight,
placental measurements, fetal size and head circumference 145,146. These landmark studies have
spawned thousands of primary studies and reviews further discussing the fetal and infant origins
of adult CV and metabolic diseases 136,138,147. Since the Barker hypothesis was first posited,
several other theories of the origins of other adult diseases have been developed.
1.5.2 Thrifty phenotype hypothesis
The thrifty phenotype hypothesis was developed as an extension of the Barker
hypothesis. It posits that a fetus developing in an adverse intrauterine environment will respond
by altering its physiological and metabolic processes in order to protect the developing brain and
vital organ systems. Changes in fetal organ system structure and function that accompany this
phenotype in utero are thought to persist long-term into the postnatal period 144. This can then
create a metabolic miss-match postnally in nutrient-abundant conditions when a “thrifty”
metabolism is not required, and in fact, may be disadvantageous. Under these circumstances
individuals are more likely to develop obesity, T1DM and the metabolic syndrome 50,148. Growth
restricted fetuses were originally the focus of this hypothesis, however, the altered glucose
metabolism as a consequence or diabetic pregnancy also results in this altered long-term
metabolic phenotype in offspring 55,144. This indicated that both smaller and larger than average
birth weight can be a risk for later metabolic and CV disease 50. Recently, support for the thrifty
phenotype hypothesis has grown and a wealth of literature exists supporting the causal link
between fetal growth and risk for metabolic and CV disease later in life149.
18
1.6 Normal Cardiac Development
In brief, normal human cardiac development, or cardiogenesis, begins in the middle of
the 3rd week of gestation. By gd35 in human pregnancy cardiogenesis is nearly complete with the
heart beginning to beat spontaneously at 4 weeks (gd21). At this point, although the primitive
heart is beating it is also still dynamically adapting and changing shape until gd50, at which point
all major elements of the four chambered heart are formed (Figure 1.5) 150.
More specifically, cardiogenesis begins immediately following gastrulation, when the
developing embryo can no longer meet its nutritional requirements through diffusion alone.
Cardiac progenitor cells in the splanchnic mesoderm migrate to form a crescent at the rostral end
of the trilaminar disk and are induced to form myoblasts, which will later form the heart proper.
Concurrently, blood islands (which will later form blood cells and blood vessels) form in the
mesoderm, surrounding the myoblasts. These both then migrate into a horseshoe-shaped,
endothelial-lined tube, anterior to the neural plate, called the cardiogenic field 151,152.
Rapid growth and development of the central nervous system leads to movement of the
cardiogenic area to under the foregut and below the neural plate, into what will become the thorax
152
. On gd19-20 in the human, the two lateral sides of the horseshoe merge due to lateral folding
of the embryo. This marks the formation of the primitive heart tube. The primitive heart tube has
bifurcating arterial (forms the aortic arch) and venous (forms the atria and sinus venosus) ends.
By gd21 the singular heart tube has rotated, descended into the pericardial cavity, detached from
the dorsal mesocardium, and begins to beat. From gd23-28 the heart tube undergoes bulging,
elongation and bending in the process of forming the cardiac loop. Bulging in the cranial and
caudal ends form the bulbus cordis (eventually forming the right ventricle (RV)) and the primitive
ventricle (eventually forming the LV), respectively. As the heart tube continues to bulge and
rotate a crease forms between the bulbus cordis and ventricle, this later becomes the
interventricular sulcus. At gd28 when the cardiac loop is complete the bulbus cordis is comprised
19
Figure 1.5. Major steps of cardiogenesis in human, rat and mouse.
Major steps of cardiogenesis include evidence of the cardiac crescent, formation of the singular,
primitive heart tube, looping of the heart tube, chamber formation and septation and ventricular
septum completion (with continued atrial septation). Embryonic time-points for these
developmental landmarks are listed for human, rat and mouse. For reference, term gestation in
humans is 40 weeks, term gestation in rat is 21-23 days and term gestation in mouse is 19-21days.
Figure adapted from Srivastava et al.150, Bruneau et al 153. and Xin et al. 154
20
of three distinct regions: a narrow, trabeculated proximal portion that will form the RV, the
middle conus cordis that will form the outflow tracts, and the distal truncus arteriosus that will
form the roots of the great vessels 151.
The major cardiac septa (atrioventricular (AV), atrial and ventricular) form from gd27-37
mainly through fusion of endocardial cushions, dividing the heart into chambers. Concurrently,
the mitral and tricuspid valves form from hollowing out of the ventricular walls 151. During the 5th
week of development the truncus arteriosus and conus cordis undergo septation and twisting
through fusion of swellings within their lumens. These swellings will develop into the semilunar
valves during the 7th week of development 152. This splitting and twisting is an important process
that ensures the LV outflow tract connects to the aorta and the RV outflow tract connects to the
pulmonary artery (PA), creating a division in the circulation leaving the heart. While the process
of atrial septation continues after birth, ventricular septation is complete by the beginning of the
8th week of human pregnancy 155.
By this point in development, the heart will continue to grow, however, all major
elements are formed (with several exceptions). The prenatal and postnatal hearts differ greatly in
their function. Postnatally, the heart functions primarily to pump deoxygenated blood to the lungs
for gas exchange and upon its return, pump oxygenated blood to the entire body. In contrast, the
developing fetus uses the maternal circulation to receive oxygenated blood, as fetal lungs are nonfunctioning. By consequence, several changes in cardiac anatomy and physiology must occur at
birth and shortly thereafter (Figure 1.6) 156. In utero, the atrial septum or “foramen ovale” is
incomplete to allow shunting of blood from the high-pressured right side of the heart into the left
side where it can travel through the aorta and eventually access the maternal circulation.
Immediately after full-term birth, when the lungs begin to function and the pulmonary circulation
opens, the pressure within the heart reverses and blood begins to shunt from the left atrium into
the right atrium. This reversal of blood flow and pressure causes the foramen ovale to close
21
functionally; anatomical closure, forming the fossa ovalis, is complete within several months of
birth, completing the atrial septation process 157. As another method for bypassing the fetal lungs,
a conduit called the ductus arteriosis is created, joining the pulmonary artery with the aortic arch
and allowing blood to pass from the former to the latter. After birth this conduit is no longer
needed and gradually closes, forming the postnatal ligamentum arteriosum; closure is complete
within several weeks of birth 156,158,159.
1.6.1 Heart development in rodents
Cardiogenesis in mice and rats occurs similarly to human heart development with
timelines shifted to reflect the significantly condensed length of gestation/ development. Some
inconsistencies are apparent in the literature with regard to timing of developmental events in
mouse and rat. Most of these discrepancies are the result of varying methods of staging embryos
as well as estimates of exact time of mating 160. For the purposes of this entire thesis, for both
mouse and rat, the morning of detection of a vaginal plug or evidence of sperm in the vaginal
smear is designated gd0.
In the mouse, first evidence of cardiac progenitor cells also occurs shortly after
gastrulation, on gd7 152. The most critical period for cardiac development in the mouse occurs
between gd8-10 161. First evidence of cardiac contraction and blood flow through the primitive
mouse heart occurs at gd 8-8.5, immediately following fusion of the left and right endocardial
heart tubes 161,162. A regular heartbeat is established at gd9 in the murine fetus. The singular heart
tube in the rat embryo on the other hand, is established by gd9, and begins looping on gd10;
cardiac looping is complete by gd13 160. Initial rightward looping of the murine primitive heart
tube occurs from gd8.5-10.5, at which time 3 distinct regions can be recognized: the bulbus
cordis, primitive LV and common atrium 163. Endocardial swellings/ cushions contribute to form
the septa as well as the valvular structures and are apparent by gd9.5 in the mouse 164,165; while
22
Figure 1.6. Differences between prenatal and postnatal circulations.
The human prenatal circulation features several elements that enable bypassing of the fetal
(immature) lungs and transport of blood to the placenta and maternal circulation for oxygenation.
The foramen ovale allows blood to shunt from right atrium to left atrium. After birth this aperture
closes, forming the fossa ovalis. Much of the blood entering the pulmonary artery is forced into a
conduit leading to the aortic arch; this conduit is termed the ductus arteriosus. After birth the
ductus arteriosis is no longer required and eventually closes off to become the ligamentum
arteriosum. The paired umbilical arteries (branching off the internal iliac arteries) carry blood into
the umbilical cord and into the placenta where it can be exchanged with oxygenated maternal
blood. Oxygenated blood then travels up the umbilical vein and joins the fetal inferior vena cava,
before entering the heart. Postnally, the umbilical vein is redundant and closes off to become the
ligamentum teres. Figure adapted from Tortora & Grabowski 158.
23
atrial septation, specifically, begins on gd10 in the mouse and gd12.5 in the rat 166. However,
evidence of a septum primum and endocardial cushions has also been documented as early as gd
11 in the rat 160. In utero atrial septation is complete by gd14 in the mouse 162 and by gd15 in the
rat 160. The AV septum forms by approximately gd11 in the mouse and gd14 in the rat 166.
Complete closure of the interventricular septum occurs at gd13 in the mouse 162 and gd16 in the
rat 160,166.
Postnatally, rat and mouse hearts undergo similar changes to the human postnatal heart.
Closure of the foramen ovale in rat weanlings occurs by 2-3 days after birth 167. The ductus
arteriosus closes within several hours of birth in both mice and rats 168,169.
1.6.2 Cardiogenic genes
Proper cardiac development requires the precise spatio-temporal regulation of a
constellation of transcription factors and gene products. Herein is a brief summation of those
relevant to the studies conducted in this thesis. Several gene systems, in particular, are known to
be pivotal to cardiac development, so much so that they are referred to as the “master regulators”
of cardiogenesis; their roles are also described here.
One such gene is the transcription factor NK2 homeobox 5 (Nkx2.5) 170, expression of
Nkx2.5 is used as one of the earliest molecular markers of cardiac-destined cells 171. It contributes
to differentiation of cardiomyocytes, works with other genes to ensure proper looping of the
primitive heart, and development of the ventricles as well as the cardiac conduction system 150,172.
Another master regulator, GATA4/5/6, are zinc finger transcription factors that are highly
expressed in the developing heart and 173, with Nkx2,5, contribute to early cardiomyocyte
differentiation, and are important for cardiogenesis 174. GATA4 and 6 continue to be expressed in
the adult heart 173. The GATA transcription factors 175 and TGF-β 150 have also been implicated in
proper asymmetrical looping of the developing heart.
As early as the primitive heart tube, differences in specific gene expression are able to
24
determine chamber and structure-specific cell fates 150. The T-Box (Tbx) genes play a major role
in this, as does expression of transcription factors dHAND and eHAND which are able to
differentiate cells destined for the RV and LV, respectively 176-178. The Tbx gene family is another
major genetic player in cardiogenesis not only for regionalization of the heart tube but also for
myocardial proliferation. Six out of the 17 members of the Tbx family are expressed during
cardiogenesis and directly activate gene targets that contribute to structures in the developing
heart 179. In particular, Tbx5 influences gene expression of natriuretic propeptide A (Nppa) 180,
connexin40 (Cx40) 181 and myosin heavy chain 6 (MHC6) 182.
These important transcription factors and gene families expressed during heart
development lead to activation of growth factors that are also pivotal to proper development of
the heart.
1.6.3 VEGF and hypoxia in cardiovascular development
Numerous growth factors are required for proper coordination of the developing CV
system, of which VEGF is a leading contributor. Originally thought to influence angiogenesis in
microvascular endothelial cells only, it is now well recognized that the functions of VEGF are
broad. It is able to exert neuroprotective influences, promote cell growth and differentiation in
smooth muscle cells, vascular endothelium and sympathetic neurons 100,183. VEGF also influences
the distribution and abundance of contractile proteins within smooth muscle and is able to
influence changes in vascular luminal diameter 184. The effects of VEGF (induced by hypoxia) on
contractile protein expression (such as MHC isoforms) are more influential on fetal versus adult
vasculature, emphasizing its specific importance in proper development of the CV system 185.
Hypoxia also contributes to fetal vascular remodeling through activation of other factors, and
VEGF enhances this remodeling not only through its increased abundance but the sustained
induction of VEGF receptors 186. Increased expression of both HIF-1 and VEGF has been seen
during critical phases of cardiogenesis, indicating their influential roles in this process 187.
25
However, much like the negative impacts of excessive VEGF during development, excessive
placental or fetal hypoxia has also been shown to have detrimental effects on the fetal CV system.
Reactive oxygen species that results from excessive hypoxic stress have been correlated
with altered vascular and endothelial dysfunction, both of which could be rescued with
antioxidant treatment 188. This emphasizes the importance of tight regulation of oxygen levels for
proper heart development. The presence of hypoxia is thought to be involved very early in
cardiogenesis as the initiating signal for angioblast invasion into the primitive heart 187. Hypoxia
and HIF expression have been found to be critical for remodeling of the ventricular outflow tracts
and formation of the coronary circulation. However, pathophysiological levels of hypoxia during
cardiac development can cause changes in cardiac function, structure and gene expression that are
thought to have long-term consequences 187.
Excessive VEGF or its receptors during development also has detrimental effects.
Increased circulating levels of sFlt are found in pregnant women who go on to develop PE, and
many believe this overexpression is pivotal in the pathogenesis of the disorder 102. Modest
overexpression (2-3 fold) of VEGF during mouse development leads to lethality in the embryos
by gd12-14 due to severe cardiac developmental abnormalities 95. Administration of VEGF at
gd10 and gd19 in the chick also leads to CV abnormalities that included LV dilation and a
decrease in LV mass vs. controls, and this could be reversed by administration of sFlt 73. Once
again, this emphasizes a link between cardiac development, fetal CV programming and
appropriate VEGF expression.
1.7 Congenital Heart Defects – Ventricular Septal Defects
Congenital heart defects (CHD) are the most prevalent anomaly at birth, affecting
approximately 1.9-7.5% of live births 153. By far, the most common CHD are ventricular septal
26
defects (VSDs), representing approximately 25-40% of all CHD 189,190. A VSD is defined by the
presence of a hole within the interventricular septum, allowing shunting of blood between the RV
and LV 191. The high degree of variance in estimates of VSD prevalence is likely the result of the
variability in size and location of the defect, age of diagnosis, differences in accuracy of
diagnostic equipment and the high rate of postnatal spontaneous resolution 189,191. VSDs are
classified as being muscular or membranous depending on the location of the defect within the
ventricular wall. These can be further subdivided based on the location within the muscular
septum (inlet, trabecular or infundibular) or involvement of both membranous and one section of
muscular septum 191. Clinically, muscular defects are 7 times more prevalent than membranous
defects when observed in isolation (in the absence of any other concomitant defect, septal or
otherwise) 190.
In the case of isolated VSD, presence of symptoms is predicated by the size of the defect
as well as age of the patient (and difference in resistance between the pulmonary and systemic
circulations) 191,192. Postnatal symptoms are most often the result of shunting of blood between
ventricles leading to cyanosis in extreme cases of right-to-left shunts 189 and overworking of the
pulmonary circulation in the case of left-to-right shunts 192. Small defects are often referred to as
restrictive defects, because their small size provides intrinsic resistance to interventricular blood
flow. In contrast, larger defects are often non-restrictive in nature and allow opportunity for blood
to shunt between ventricles according to differences in interventricular pressures 189. As pressure
differences change after birth (due to a decrease in pulmonary resistance and closure of the
foramen ovale and eventually ductus arteriosus) as does the degree of blood shunting through the
defect. In line with these and other changes in cardiac physiology from the prenatal to the
postnatal period, symptoms of a VSD often appear only after birth 189,191.
Despite the absence of symptoms prenatally (or postnatally in the case of small defects),
diagnosis of VSD is readily achieved in most cases. Fetal and postnatal echocardiography are the
27
principal methods of VSD diagnosis, however, in some cases, diagnosis is achieved using
magnetic resonance imaging (MRI) 189-191. These imaging modalities can also determine if the
VSD is isolated or occurring in conjunction with another CHD, such as in tetrology of Fallot (a
CHD defined by 4 simultaneous defects: VSD, pulmonary artery stenosis, overriding aorta and
RV hypertrophy) 190,191. Historically, after diagnosis, surgical repair for a VSD has been done
early in life by patch closure using sternotomy, resulting in good surgical outcome. More
recently, however, transcatheter or hybrid approaches have been taken for muscular VSD
closures. In asymptomatic patients with small defects a more conservative treatment approach is
taken in most centers, due to the high rates of spontaneous closure 190,191. When seen in isolation,
5% of diagnosed VSDs close prenatally while another 76% spontaneously resolve early postnally
(by 1 year of age) 190.
1.7.1 Genes involved in congenital heart defects
Proper development of the heart requires precise expression of a multitude of
transcription factors working together to orchestrate the various intricate morphological changes.
Deviated expression (be it upregulation or downregulation) or mutations in any of the genes
known to be involved in cardiogenesis (described in section 1.6.2) can result in a multitude of
defects. Several examples are described below.
GATA transcription factors, and GATA4/5 in particular, are highly expressed in early
cardiogenic cells and play a pivotal role in cardiogenesis 174,193. Knockdown of GATA4 in mice is
embryo-lethal by gd9, with embryos showing failure to form the primitive heart tube 194. GATA4
is involved in regulation of both Tbx5 and Nkx2.5. Therefore, its absence or disruption clinically
results in a wide range of cardiac malformations, including and most notably VSDs 195,196. A
preliminary study found a link between variations in the GATA5 promoter and the development
of VSD 197, however, further studies are needed to strengthen this association. Tbx5 mutations
have also been associated with development of VSD in certain populations, due to its important
28
role in cardiac septation 198. Mutations in Tbx5 are also known to lead to development of HoltOram syndrome, a rare genetic disorder characterized by upper limb malformations (specifically
of the hands) and cardiac malformations (specifically septal defects and arrhythmias) 199,200. In
mice, absence of Tbx5 results in failure of interventricular septal formation 181. Expression of
Nkx2.5 is known to be pivotal in determining cardiac cell lineage fate decisions and in
differentiation of cardiomyocytes 201. As such, lack of Nkx2.5 has been associated with a variety
of CHD and septal defects in particular, including atrial septal defects and tetralogy of Fallot, as
well as severe conduction system abnormalities both clinically and in animal models 202,203.
Non-genetic factors such as maternal illness, teratogenic exposure and epigenetic factors
are also implicated in the development of VSDs and other CHDs 189,204.
1.7.2 Cardiac teratogens
The heart is the first functioning organ to fully develop in the human and some
anatomical features continue to develop up to a year postnatally 151. As such there is a larger
window of vulnerability to teratogenic exposure 205. This is especially the case early in pregnancy
when heart development is nearly complete (4-5weeks) yet mothers are often not yet aware of the
pregnancy. The causes of CHD are often multifactorial; with advancing research many genetic
causes have been discovered, however, approximately 30% of cases are attributed to noninherited, modifiable factors 206. Maternal illness (of various types) is known to increase
incidence of CHD 207. Phenylketonuria (a genetic condition of defective amino acid metabolism)
is one such example, which is associated with an over 6 fold increased risk of cardiac
malformations, namely tetrology of Fallot, VSD and patent ductus arteriosis 208,209. Maternal
diabetes and inadequate glycemic control in pregnancy (as discussed in section 1.2.1) is strongly
linked with not only maternal risk but also increased risk for fetal malformation as well as later
CV disease 5,60. Specifically, there is increased risk for VSD, transposition of the great vessels and
outflow tract malformation, amongst many others 210. Maternal febrile illness, rubella, influenza
29
and epilepsy are all associated with a variety of CHDs in offspring 207. Nontherapeutic/recreational drug exposure during pregnancy is well-known to cause risks to the
developing fetus. Extensively studied, alcohol exposure during pregnancy increases the risk of
fetal alcohol spectrum disorder 211 and is linked to an increased incidence of VSD and
conotruncal defects 212. Marijuana use in pregnancy is also contra-indicated; there is an
association between maternal self-reported marijuana use in pregnancy and incidence of isolated
VSD 213. Maternal environmental factors such as organic solvent exposure have also been
associated with increased incidence of VSD and other CHD 212.
Therapeutic drug use during pregnancy is often necessary but presents a delicate and
potentially dangerous balance. Some pre-existing maternal conditions such as epilepsy, cancer,
and severe psychiatric disorders, amongst others, necessitate continued use of prescribed
medications during pregnancy in order to prevent catastrophic consequences on maternal health.
A balance must be struck that minimizes risks for severe complications or even death in the
mother while still reducing fetal teratogenic exposures. Exposure to prescribed medications
during pregnancy can carry risks for fetal malformations of all types, including CHD. Drugs
classified by the Food and Drug Administration (FDA) as category X are the most dangerous,
indicating that risks to the fetus outweigh benefits for the mother. Examples of FDA category X
drugs specifically known to cause CHD include thalidomide and vitamin A congeners. Slightly
less severe FDA category D drugs include valproic acid, lithium and diazepam 207. Many
anticonvulsants (like valproic acid) given to epileptic mothers are known to be teratogenic,
causing CHD as well as deformities in other organ systems 214. Another example is trimethadione
(TMD), a medication used to treat petit-mal epilepsy until its teratogenicity was discovered 215.
30
1.8 Dimethadione
The anticonvulsant TMD is rapidly N-demethylated by hepatic cytochrome P-450s to its
primary metabolite dimethadione (DMO) (Figure 1.7) 215-217. DMO is both the pharmacologically
active moiety and the proximate teratogen 214.
1.8.1 Trimethadione in humans
Discovery of the teratogenic potential of TMD was first discovered after 2 pregnant
women being treated with TMD had 9 consecutive pregnancies resulting in either fetal loss or
fetal malformations. Once removed from treatment, subsequent pregnancies came to term and
infants were born healthy 218. Many additional cases of fetal malformations with TMD treatment
have been described since the original report, and the TMD syndrome was characterized 215,219,220.
Features common in the TMD syndrome include, mild mental retardation, speech difficulties,
palatal abnormalities, teeth irregularities and ear abnormalities in surviving patients 215. Lethal
defects observed in fetuses that died before term include major cardiac defects (VSDs, tetrology
of Fallot, transposition of great vessels etc.), gastro-urinary defects and skeletal defects amongst
others 218,220. Of note, there is a 50% incidence of infant CHD after in utero exposure to TMD, the
majority of which included a VSD 221. A previous review of the literature found that TMD
treatment in pregnancy was associated with a 24% rate of fetal loss. Of live births, 83% had at
least one major congenital malformation, 42% of which resulted in postnatal death 221. Due to
these severe teratogenic effects, TMD has since been removed from the market as an
anticonvulsant in the developed world. Like many other anticonvulsants, TMD/DMO are thought
to exert their teratogenic effects by blocking ion channels (sodium, potassium and calcium
voltage-dependent channels) required for production and propagation of action potentials within
the heart 214,222. More specifically, it is likely that calcium channels as well as potassium channels
31
Figure 1.7. Metabolism of trimethadione (TMD) into dimethadione (DMO).
TMD is rapidly metabolized in the liver into DMO by cytochrome P450 enzymes (font size
represents relative contribution of isoforms) in the endoplasmic reticulum. DMO is the only
metabolite of TMD. Figure modified from Tanaka et al. 223
32
(delayed rectified potassium channels IK) within the heart are the most disrupted by DMO
exposure 224,225. This disruption can result in bradyarrhythmias and hypoxia reperfusion injury of
heart 214,224. These ion channels also have important roles during cardiac morphogenesis and
development of the cardiac conduction system 226. Other uses for the drug have since surfaced;
singular doses of TMD can be given to test liver function by looking at blood ratios of
TMD/DMO after dosage. These ratios have been shown to be reflective of extent of liver damage,
with decreased TMD metabolism in cases of liver cirrhosis 216.
1.8.2 As model in rodents
Animal models were initially used to investigate the teratogenic mechanisms of TMD and
its metabolite DMO 214. Experimentally, DMO produces very high rates of CHD, and in particular
VSDs (over 90% incidence in some cases) 227,228 in a dose and time-dependent manner. Thus, the
high incidences of TMD/DMO-induced CHD and VSD have been valuable for the study of
abnormal heart development. The translational utility of these rat models were recognized upon
discovery that spontaneous postnatal VSD closure rates closely resembled that of human VSDs
227
. These induced defects were also morphologically similar to naturally occurring VSDs in rats
227
. Even with high doses of TMD (300mg/kg/b.i.d. gd9 and10) resulting in high incidence (50%)
of VSD, spontaneous closure rates and postnatal viability remained high 228. Most studies use
doses of DMO or TMD in the range of 400 or 600mg/kg/day (200-300mg/kg twice daily)
administered orally on gd9-10 (occasionally extended to gd8.5-11) 227-229. Later studies
discovered that treatment with the proximal teratogen (DMO) yielded a higher incidence and
more severe forms of VSD compared to similar animal strain and dosing regimen with TMD 229.
The resultant VSDs are associated with decreased cardiac function in utero long after dosing was
completed, indicating that presence of a structural defect may also affect cardiac function even
after the drug has been cleared from the system 230. Long-term cardiac function or responses to
33
physiological stressors (such as pregnancy) have not been reported in rodent offspring exposed to
DMO or TMD as fetuses.
1.9 Rationale, Hypotheses, Objectives
Pregnancy places great hemodynamic and metabolic demands on the mother, often being
called a CV stress test for mothers. Pregnancy complications are not only an immediate risk for
both mother and offspring, but also result in long-term CV sequelae. The exact mechanisms
leading to both immediate and long-term maternal CV risks after pregnancy complications such
as diabetes, PE, or pre-existing CV disease are not fully elucidated. Similarly, the impact of an
altered maternal hemodynamic or CV response to pregnancy on pregnancy outcome (both
maternal and fetal) is not completely understood. To further elucidate the ramifications of an
altered CV response to pregnancy, the general hypothesis of this thesis is that the physiological
response of the rodent maternal CV system will be altered under the burden of preexisting
metabolic distress, impaired angiogenesis or underlying, subclinical CHD, and may negatively
impact fetal health. To address this hypothesis the maternal CV system and fetal health were
investigated in pregnant mice and rats using models of maternal diabetes, absence of PGF and
resolved (chemically-induced) VSD, and compared to normal pregnancy and the non-pregnant
(cycling) state. Work presented herein is divided into 4 research chapters.
Chapter 2: Analysis of Maternal and Fetal Cardiovascular Systems During Hyperglycemic
Pregnancy in the Non-Obese Diabetic Mouse.
Maternal pre-existing diabetes or new-onset gestational diabetes is associated with
potential for a severe threat to maternal and fetal health during pregnancy 5,47. Despite these wellknown risks, it is not fully understood how hyperglycemia affects the physiological responses of
34
the maternal CV system to the increased circulatory demands of pregnancy. We used the wellestablished, commercially available NOD mouse model of T1DM to investigate these adaptations
in d-NOD and normoglycemic/control NOD (c-NOD) dams.
Hypothesis: The archetypical structural and functional cardiac responses to the physiological
demands of mid-late pregnancy will be altered in diabetic mice compared to normoglycemic
controls.
Main Objectives:
1. To assess maternal cardiac function in hyperglycemic and age-matched normoglycemic
mice during mid-late gestation and in non-pregnant females.
2. To assess structural changes within the hearts of virgin, and mid-late gestational
normoglycemic and hyperglycemic dams.
3. To monitor subsequent effects of maternal hyperglycemia and CV impairments on fetal
health and viability up to gd18.
Chapter 3: Placental Growth Factor Influences Maternal Cardiovascular Adaptation to
Pregnancy in Mice.
Normal pregnancy is associated with dynamic expression of a variety of angiogenic and antiangiogenic growth factors 85. PGF rises in maternal serum during pregnancy 82. Maternal PGF
deficits are strongly correlated with development of PE, a condition associated with an aberrant
CV phenotype in mothers and offspring 231. Outside of pregnancy, PGF has been extensively
studied as a cardioprotectant and therapeutic option in pressure-overloaded or infarcted hearts
124,127
. However, it is unknown what role PGF has in the normal, gestation-induced adaptations of
the maternal CV system.
35
Hypothesis: High levels of plasma PGF present in maternal serum during pregnancy
contribute to the conventional adaptations of the maternal CV system necessary to support fetal
growth and pregnancy success. Hence, Pgf-/- dams will exhibit altered cardiac performance and
hemodynamic profiles in response to pregnancy, compared to Pgf-competent controls.
Main Objectives:
1. To determine the circulating levels of PGF in normal B6 pregnancy.
2. To investigate the pregnancy-induced BP profile in Pgf-/- and B6 mice.
3. To characterize the cardiac and renal structural and functional differences across
pregnancy in Pgf-/- dams versus age-matched B6 controls.
4. To determine if absence of PGF in pregnancy results in alterations in LV vasoactive gene
systems.
5. To determine if maternal PGF deficiency alone results in any fetal repercussions.
Chapter 4: In utero Dimethadione exposure causes postnatal disruption in cardiac structure
and function in the rat.
Isolated VSD is the most prevalent CHD with a multifactorial etiology including chemical
exposures 189,190. Although there is a high rate of spontaneous prenatal and postnatal resolution of
VSD 190 there is a dearth of information about the long-term postnatal CV risks associated with
this “favourable” outcome. To investigate the long-term consequences of VSD resolution, the
goal was to create an experimental model in which DMO would be administered to dams for the
purposes of generating offspring in which the sequelae of resolved CHD could be addressed.
Hypothesis: In utero chemical exposure to DMO capable of producing VSD in offspring would
induce pathophysiological changes in the heart that would persist into adulthood even if the
VSD resolved spontaneously.
36
Main Objectives:
1. To ascertain if DMO-induced VSDs persist into adulthood.
2. To characterize cardiac function in adult rats exposed to DMO in utero.
3. To characterize the hemodynamic response of adult offspring exposed to DMO in utero
to the challenge of high dietary salt load.
Chapter 5: In utero exposure to a cardiac teratogen causes reversible deficits in postnatal
cardiovascular function, but altered adaptation to the burden of pregnancy.
Chapters 2 and 3 emphasized that murine pregnancy places high CV demands on mothers.
Results of Chapter 4 indicated that in utero DMO exposure in rats led to functional CV
differences that persist into adulthood, without persistent structural defect. Of interest is if
pregnancy could be used to stress the CV system of DMO-exposed female offspring to unmask
additional deficits in cardiac function.
Hypothesis: Presence of a preexisting fetal CHD, although spontaneously resolved, alters an
adult’s CV response to the increased physiological demands of pregnancy.
Main Objectives:
1. To characterize the longitudinal changes in postnatal cardiac structure and function (over
several time-points from weanling to adulthood) in rats exposed to DMO in utero.
2. To monitor postnatal growth from birth to adulthood after in utero DMO exposure.
3. To characterize the hemodynamic profile of normal (control) Sprague-Dawley rats over
un-complicated pregnancy.
4. To determine if resolved VSD, induced by in utero exposure to DMO, alters the
hemodynamic response to pregnancy.
37
5. To ascertain if a prior in utero DMO exposure alters cardiac structure and function during
pregnancy later in life.
6. To determine if there are trans-generational (F2) effects of fetal DMO exposure.
38
Chapter 2
Analysis of Maternal and Fetal Cardiovascular Systems During
Hyperglycemic Pregnancy in the Non-Obese Diabetic Mouse
This chapter was slightly modified from the original publication: Aasa KL, Kwong KK, Adams
MA, Croy BA. Analysis of Maternal and Fetal Cardiovascular Systems During Hyperglycemic
Pregnancy in the Non-Obese Diabetic Mouse. Biology of Reproduction 2013, 88(6):151.
Modifications were made after publication to correct typographical errors, clarify concepts and to
make terminologies consistent throughout the thesis, yet maintain the integrity of the original
publication. Additional interpretation has been added to the General Discussion (Chapter 6).
39
2.1 Abstract
Pre-conception or gestationally-induced diabetes increases morbidities and elevates longterm cardiovascular disease risks in women and their children. Spontaneously hyperglycemic (d)NOD/ShiLtJ females, a type 1 diabetes model, develop bradycardia and hypotension after
midpregnancy compared with normoglycemic, age and gestation day (gd)-matched controls (cNOD). We hypothesized that onset of the placental circulation at gd9-10 and rapid fetal growth
from gd14 correlate with aberrant hemodynamic outcomes in d-NOD females. To develop further
gestational time course correlations between maternal cardiac and renal parameters, highfrequency ultrasonography was applied to virgin and gd8-16 d- and c-NODs. Cardiac output and
left ventricular (LV) mass increased in c- but not d-NODs. Ultrasound and postmortem
histopathology showed overall greater LV dilation in d- than c-NOD mice in mid-late gestation.
These changes suggest blunted remodeling and altered functional adaptation of d-NOD hearts.
Umbilical cord ultrasounds revealed lower fetal heart rates from gd12 and lower umbilical flow
velocities at gd14 and 16 in d- versus c-NOD pregnancies. From gd14-16, d-NOD fetal losses
exceeded those of c-NOD. Similar aberrant responses in human diabetic pregnancies may elevate
postpartum maternal and child cardiovascular risk, particularly if mothers lack adequate prenatal
care or have poor glycemic control over gestation.
40
2.2 Introduction
Pre-conception and gestational diabetes are common human pregnancy complications,
occurring in 2-9% of pregnancies 232. Both forms of diabetes increase maternal and fetal/neonatal
morbidities 233,234. Since cardiovascular (CV) disease is strongly associated with diabetes 235, and
pregnancy places enormous circulatory demands on women, it is not surprising that circulatory
issues occur during and following diabetic pregnancies. Normal pregnancy is regarded as a CV
“stress test” 7, in which reversible increases in blood volume (30-40%) 9, heart rate (HR) (2030%) 236, cardiac output (CO) (30-60%) and cardiac hypertrophy (5-10% increase in mass) 9,10
occur. Normally, these adaptive changes do not lead to increased blood pressure (BP); instead,
mean arterial pressure (MAP) declines or remains stable over gestation. This seemingly
paradoxical outcome is attributed to systemic vasodilatation and vascular remodeling 237. In
diabetic women, circulatory adaptations to pregnancy may be incomplete or not fully reversed
postpartum, causing persistent or subsequent changes that increase risk for CV diseases. Known
elevated postpartum risks are reported for heart failure, coronary heart disease and stroke
50,52,68,238,239
. Since diabetes itself exacerbates CV disease progression, 52,68 it is surprising that
limited information is available concerning the functional and structural cardiac changes that
occur in the pregnant diabetic female.
In contrast, the impact of maternal glycemic control on fetal and offspring health is well
studied. For example, even with good glycemic control, increased incidences of macrosomia 5,
intrauterine growth restriction (IUGR) 5 congenital heart defects (CHD), myocardial hypertrophy
5,240
and death are reported in fetuses of diabetic women 5,240. Outcomes are more severe when
glycemic control is suboptimal. Echocardiography is an effective clinical tool for assessing fetal
well-being, developmental anomalies or distress 47,241. Postnatally, growth and development of
41
offspring from diabetic gestations are accompanied by more CV events, obesity, diabetes,
hypertension and metabolic syndrome 50,57,233.
The spontaneously diabetic NOD/ShiLtJ (d-NOD) mouse is widely used to model
pathogenesis of CV disease in type 1 diabetes 61,64,234,242. Female NOD mice undergo spontaneous,
selective destruction of the pancreatic islet cells from 12-30 weeks of age (later in males).
Gradually, 90-100% of females turn hyperglycemic by 30 weeks of age. Prior to pancreatic islet
cell destruction, animals are normoglycemic. This enables studies using normoglycemic littermates as age-matched controls when glycemic index is closely monitored. Pregnant, d-NOD
females have been studied by continuously monitored radiotelemetry in a non-anaesthetized state,
which showed normal hemodynamic parameters until midpregnancy. The mice then became
proteinuric and hypotensive in comparison to gestation day (gd)-matched normoglycemic (c)NOD females, and had steadily declining mean arterial pressure (MAP) until parturition 64. In
addition to this unusual CV adaptation, fetal pathologies, resembling those in human diabetic
gestations were reported 64. Fetal neural tube and CHD are reported as the most frequent
pathologies in human pregnancies complicated by pre-gestational diabetes 60. Similarly, these
defects are observed at high frequency in diabetic mouse pregnancies 64. The timing of the
discordance in MAP between d- and c-NODs 64 coincides with developmental opening of the
mouse utero-placental circulation (gd 9-10 37). The hypothesis of the present study is that
functional and structural cardiac responses to the physiological demands of mid-late pregnancy
do not progress normally in d-NOD females. Demands such as the acute circulatory expansion
resulting from onset of the utero-placental circulation and subsequent circulatory demands
resulting from rapid, mid to late gestational fetal growth occur within this time-frame and provide
the rationale for studying mid to late gestation. To address this hypothesis, high-frequency
ultrasonography was employed to monitor maternal cardiac and renal function and structure
before conception and between gd8-16 in d-NOD and c-NOD mice. Postmortem assessments of
42
maternal hearts and kidneys were also conducted. Fetal assessments were made by ultrasound
examination of umbilical cord parameters between gd10-16. Progressive, atypical adaptation of
maternal and fetal circulations was documented in d-NOD pregnancies over mid to late gestation.
43
2.3 Materials And Methods
2.3.1 Animal use
NOD mice, 6-8 wk old, were obtained from The Jackson Laboratory (Bar Harbor, ME,
USA). Blood glucose was quantified weekly in tail vein samples using OneTouch Ultra2
monitors and test strips (LifeScan, Burnaby, ON, Canada). Glucose values ≤9.9mmol/l were
considered normoglycemic, 10.0-14.9mmol/l pre-diabetic and ≥15.0mmol/l hyperglycemic.
When a reading of ≥15.0mmol/l was obtained, daily blood glucose monitoring was employed to
confirm the finding. Three consecutive days of hyperglycemic readings were used to define a
mouse as diabetic. Once diabetic, females were immediately age-matched to a c-NOD female and
both were paired with normoglycemic NOD males for breeding. Mean age of d-NOD females
studied was 18.1±0.7 weeks with a range of 13-24 weeks; mean age of c-NOD females studied
was 17.4±0.7 weeks with a range of 12-21 weeks. Detection of a copulation plug was considered
gd0. Diabetic females received supplementary care, including moist chow, daily health checks
and twice weekly body weight measurement to ensure stability. Glucose levels were measured
prior to euthanasia to ensure a diabetic state had been maintained throughout pregnancy.
Subcutaneous fluids (Lactated Ringer’s Solution, 1ml) were administered daily at signs of
dehydration. Animal usage was conducted in accordance with the SSR’s specific guidelines and
standards and under protocols approved by the Queen’s University Animal Care Committee and
in accordance with the Canadian Council on Animal Care’s Guide to the Care and Use of
Experimental Animals.
2.3.2 Ultrasonography
Females were imaged by ultrasound before mating or at gd8, 10, 12, 14 or 16, using a
Vevo770 high-frequency, microultrasound system (VisualSonics, Toronto, ON, Canada). Three
44
d-NOD and three c-NOD pregnancies were used per gd (total of 30 pregnant and 6 virgin females
scanned). Females were anesthetized with inhaled isoflurane (Pharmaceutical Partners of Canada
Inc., Richmond Hill, ON, Canada), placed on the handling platform and had their limbs fixed to
electrode plates using adhesive tape (Transpore; 3M, Maplewood, MN, USA) to enable
monitoring of cardiac activity and respiration. Anaesthetic induction used 5% isoflurane in
oxygen until the animals were inactive and moved to the handling platform. Anaesthesia was then
maintained between 1.5-2% isoflurane in oxygen. HR was used as indicator of depth of
anesthesia and used to ensure the lightest effective anesthetic depth was maintained. Depilatory
cream (Nair; Church & Dwight Co. Inc, Princeton, NJ, USA) was used to remove fur over the
ventral thorax, abdomen, and pelvis. Warmed, ultrasound-conducting gel (Ecogel 100; ECOMED Pharmaceutical, Mississauga, ON, Canada) was placed between the area of interest and the
ultrasound scanning head. Cardiac scans were conducted on the adult females using a 707B,
30MHz transducer to collect a left ventricular (LV) short axis M-mode cine loop at a midpapillary level. Cardiac measurements were taken from this cine loop post-acquisition. Analyses
included: LV trace, LV inner and outer diameter, LV anterior and posterior wall thickness and
LV chamber size. Vevo770 software used these measures to calculate CO, stroke volume (SV),
ejection fraction (EF), fractional shortening (FS), LV diameter diastole and systole, LV volume
diastole and systole, and LV mass. After completion of the cardiac scan, left and right renal scans
were performed using the VisualSonics 704, 40MHz transducer. B-mode was used to visualize
each kidney and its respective renal artery (RA) and vein (RV). Pulsed-wave (PW) Doppler
signal was obtained for left and right RA. Post-acquisition measures were performed on peak
systolic and end diastolic blood flow velocities. These values were used to determine renal
Resistance Index (RI), calculated as [peak systolic flow velocity-end diastolic flow velocity/ peak
systolic flow velocity]. Then, for each pregnant female, a minimum of three fetuses were located
and PW Doppler signals from the fetal umbilical arteries (UA) were recorded, with angle of
45
insonation ≤ 60 degrees (angle correction was not performed). Non-viable fetuses were observed
during some scans but were not used for recordings or analyses. Post-acquisition measurements
for UA calculations included peak systolic blood flow velocities and fetal HR.
2.3.3 Histological analyses
Upon completion of the ultrasound examination, mice were euthanized by an overdose of
sodium pentobarbital (CEVA Sante Animale, Libourne, France) (50mg/kg) and exsanguinated via
cardiac puncture. Hearts and kidneys were dissected and immersion fixed in 4% neutral-buffered
paraformaldahyde (PFA; Sigma-Aldrich, Oakville, ON, Canada) followed by immersion in 70%
ethanol. Tissues were then paraffin-embedded by standard automated processing. Sections from
fixed tissue of the 36 mice were cut onto slides at 3μm (kidney) or 6μm (heart) and two nonconsecutive slides per animal were stained using i) Hematoxylin and Eosin (H&E) for general
histology (heart and kidney), ii) periodic acid Schiff’s (PAS) reagent for glyoproteins (kidney),
iii) Mason’s trichrome for collagen deposition (heart) and iv) von Kossa’s stain for mineral
deposition (heart) using published protocols 243,244. Heart sections were digitized; ventricular wall
width, interventricular septum length, ventricular lumen, and entire left ventricle areas from each
heart were traced manually using Zeiss AxioVision Software (Carl Zeiss Canada Ltd., Toronto,
ON, Canada). Morphometric analyses of kidneys included eight sequential cortical glomeruli that
were assessed under high power, oil immersion microscopy from each PAS-stained kidney
section. Glomeruli were scored semi-quantitatively as described by others 245, between 0-4
depending on severity of pathology present (0=normal; 4=very severe capillary loop occlusion
with hypercellularity).
2.3.4 Statistical analyses
Ultrasound data were analyzed using Prism Statistical Software (GraphPad, San Diego,
CA, USA). Data are presented as mean ± standard error of the mean (SEM), and were calculated
46
using n=3/group for all maternal data and n≥9/group for all fetal data (minimum 3 fetuses from
each of 3 dams/ group). Echocardiographic data were normalized to litter size (values were
divided by the number of live pups) to account for differences in litter size within groups. Twoway ANOVA and linear regression were performed for statistical comparisons. Regressions with
non-zero slopes were considered significant at p≤0.05 and used to define a change over time
within a group. Differences in changes over time between groups were defined by testing the
difference between slopes. Differences were considered significant at p≤0.05 and non-statistically
significant trends were defined at p≤0.15. Bonferroni’s post-test was used to investigate
differences between groups at specific gestation days.
47
2.4 Results
2.4.1 General features of NOD pregnancies
Diabetic NODs were age-matched to c-NODs for breeding. As shown in Table 2.1, preconception body weights (BW) and gd-matched weights at times of ultrasound scans did not
differ between groups. The number of viable pups differed between study pairs, but when
averaged were similar between groups (mean = 8.67 fetuses for d-NOD (range of 1-11) and mean
= 8.67 fetuses for c-NOD (range of 4-12)) (Table 2.1).
2.4.2 Cardiac assessments in d-NOD and c-NOD before conception and at gd8
Echocardiography of virgin and gd8 mice showed no differences between diabetic and
control females in any parameter measured (CO, SV, LV diastolic diameter, LV mass or FS).
Histopathology and morphometric measures at these time-points also showed no differences. This
indicated that heart structure and function were similar in all females prior to mating and in early
pregnancy, prior to opening of the placental circulation.
2.4.3 Maternal cardiac adaptations from gd10-16
2.4.3.1 Ultrasound
Cardiac output (a function of SV and HR) was normalized to account for variations in
litter sizes within groups and over time (Table 2.1). In rats, litter size is reported as positively
correlated with CO and negatively correlated with MAP and systemic vascular resistance (SVR)
246
. Illustrated in Figure 2.1 (A-B) are representative parasternal short axis B-Mode and M-Mode
views of the maternal heart upon which calculations were based. Papillary muscle was used to
mark location within the chamber and maintain consistency across scans. Once normalized, CO
was increased in c-NODs over gestational time-points measured (p=0.0246; Figure 2.1C). This
was attributed primarily to increases in SV (Figure 2.1D) since HR was stabilized to the same
48
Table 2.1. Maternal Characteristics
Body
weight (g)
Virgin
gd8
gd10
gd12
gd14
gd16
Control
26.9±1.4
26.8±0.6
27.7±0.7
28.7±1.8
29.8±1.5
33.4±2.0
Diabetic
23.5±0.2
24.5±1.4
27.1±2.5
30.4±1.2
29.2±1.4
31.1±0.9
p value
NS
NS
NS
NS
NS
NS
Initial
Control
6.4±0.6
5.5±0.3
5.9±0.3
4.9±0.4
5.5±0.5
Blood
Diabetic
26.3±4.2
19±1.9
24.9±2.1
21.3±1.2
21.8±1.5
p value
0.0001
< 0.0001
< 0.0001
< 0.0001
< 0.0001
Overall
NS
Glucose
(mmol/L)
Final Blood
Control
6.3±0.6
8.7±0.4
8±0.4
7.8±1.1
6±0.5
6.3±0.6
Glucose
Diabetic
28.6±0.9
30.2±1.3
30.0±1.9
27.7±2.8
31.4±1.0
31.0±2.3
(mmol/L)
p value
< 0.0001
< 0.0001
< 0.0001
< 0.0001
< 0.0001
< 0.0001
Control
10.7±0.9
11.3±0.3
7.7±1.3
8±1.2
5.7±0.9
Diabetic
11±0
8.3±1.8
8.7±1.9
8.7±0.9
6.7±2.9
p value
NS
NS
NS
NS
NS
Viable
Litter Size
Maternal
Heart Rate
(BPM)
Control
433.2±15.8
442.9±13.5
422.2±26.4
449.5±7.3
479.4±21.8
486.9±2.3
Diabetic
425.3±22.3
449.8±6.7
427.1±8.9
407.0±1.6
402.5±18.0
380.3±44.3
p value
NS
NS
NS
NS
NS
0.006
< 0.0001
< 0.0001
NS
0.005
Significant differences between groups overall and at each individual time-point were determined by two-way ANOVA with Bonferroni’s posttest. Virgin animals were euthanized upon confirmation of diabetic state, therefore, initial blood glucose was analogous to final blood glucose.
49
50
Figure 2.1. Maternal cardiac analyses.
(Previous Page) (A) An example of a B-Mode image of parasternal short axis view of the heart
from a gd16 d-NOD. M-Mode sample volume was placed over the middle of the chamber,
slightly off the papillary muscle. (B) M-Mode cine loop of parasternal short axis of the heart, also
from a gd16 d-NOD. Measurements were performed excluding papillary muscle, seen as caps
above the posterior wall in systole. (C) Cardiac output normalized by viable implant site number.
Increasing CO is seen over gestation in c-NOD (p=0.025), but not d-NOD mice. Effect of
gestation (analyzed via regression slopes) differed between groups (p=0.024). (D) Stroke volume
normalized for viable implant site number. Increasing SV is seen over gestation in c-NODs
(p=0.035). Again, no increase in SV is observed over gestation in d-NODs. Effect of gestation
was different between groups (p=0.030). (E) Fractional shortening. FS was increased in d-NOD
compared to c-NODs across the study (p=0.0265), however no significance was reached at any
specific gd. No effect of gestation is seen on FS in either d-NOD or c-NOD dams.
PM = Papillary muscle, LV = Left ventricle, AW = Anterior left ventricular wall, PW= Posterior
left ventricular wall. Solid line and closed circles = c-NODs, dashed lines and open circles = dNODs. Significantly different slopes upon regression analysis indicated differing effects of
gestation between groups, slopes by linear regression considered significantly non-zero at p<0.05.
51
range on each gd. In contrast to c-NODs, neither CO nor SV increased in d-NODs over gestation
(Figure 2.1C-D). Changes in CO and SV over gestation differed between groups as shown by the
finding of significantly different slopes in regression analysis (p=0.024 and p=0.030,
respectively).
Fractional shortening measures the proportion of LV diastolic diameter that is lost in
systole and is a surrogate measure for LV systolic function 247. In normal, non-pregnant humans
the expected range in FS is from 27 to 45% 248. Overall, FS was higher in d-NOD compared to cNOD over the intervals measured (determined by two-way ANOVA), however no differences
were observed at any particular gd (by Bonferroni post-test) and no effect of gestation was seen in
either group (determined by linear regression) (Figure 2.1E). When normalized to HR (by
dividing FS by HR), the same outcome of increased FS in d-NOD compared to c-NODs was
observed (p=0.0057, Appendix A. 1). Left ventricular diastolic diameter, measured by ultrasound,
did not increase in d-NOD (p=0.4158) mice across mid to late gestation but increased in c-NOD
mice (statistically non-zero slope, p=0.0135). The effect of gestation on LV diastolic diameter
differed between d- and c-NOD, demonstrated by a difference in slopes by linear regression
(p=0.017) (Figure 2.2A). Over the study interval, d-NOD hearts showed no measurable increase
in LV mass, adjusted to litter size and calculated from ultrasound measurements. In contrast, LV
mass of c-NODs increased over mid to late gestation (Figure 2.2B), reflecting the LV
hypertrophy expected in normal pregnancy.
2.4.3.2 Histopathology
Histopathology of d-NOD LV showed no visible lesions at the gestational time-points
studied (Figure 2.2C). Morphometric analyses revealed differences in LV dilation between the
diabetic and control mice. The d-NOD hearts had a greater LV lumen to total LV area ratio than
gd10-16 c-NOD heart; analysis at specific gds revealed differences between groups at gd14
52
Figure 2.2. Left ventricular size and extent of dilation, calculated using ultrasonography
and histological analyses.
(A) Left ventricle diastolic diameter (mm) measured by ultrasound increased throughout gestation
in c-NOD (p=0.014) but not d-NOD mice (p=0.42). Regression analysis showed a difference in
slopes between the groups (p=0.017). (B) Ultrasound measurements in c-NODs showed
increasing LV mass over gestation (p=0.050). No increase or trend was seen in d-NODs.
Regression analysis showed a trend towards a difference in slopes (p=0.15). Values normalized to
number of viable implantation sites. (C) Histological cross-sections of ventricles at the level of
the papillary muscles stained with H&E, scale bar reports 500m and refers to all panels. (D)
Ratio of LV lumen area: total ventricular area was used as a measure of ventricular dilation.
Overall the ratio was increased in d-NOD compared to c-NODs (p=0.028). Differences at specific
gestation days reached significance at gd14. Ratios were measured using histological
morphometry.
Solid line, closed circles and solid bars = c-NODs, dashed lines, open circles and white bars = dNODs. * = Difference between groups. Significance between groups were determined by twoway ANOVA with p<0.05. Increases over gestation within groups were determined by linear
regression with a non-zero slope (p<0.05), non-statistically significant trends over gestation
defined at p<0.15.
53
(Figure 2.2D). Virgin and gd8 hearts were also studied and no differences were found between
groups at either time-point, indicating that changes occur after opening of the utero-placental
circulation.
2.4.4 Renal analyses
Kidneys play a major role in blood pressure regulation and undergo substantial alteration
during normal pregnancy, including increases in size, volume, glomerular filtration rate and
effective renal plasma flow rate 249. Renal RI, as calculated by ultrasonography, is an indicator for
downstream vascular impedance and correlates inversely with changes in renal blood flow
expected during normal pregnancy 249. Figure 2.3(A-B) illustrate B mode and PW-Doppler renal
scans typical of those used for calculations. Renal artery RI did not differ between virgin d-NOD
and c-NOD mice or at any gestation time-point studied (Figure 2.3C). No structural anomalies
were observed in any kidneys via B-Mode imaging (Figure 2.3A).
Glomerular changes are the earliest and most frequently observed renal histopathology.
Blinded, semi-qualitative analysis was performed to assess mesangial matrix expansion and
hypercellularity. No quantitative differences in glomerular histology were detected between dNOD and c-NOD kidneys at any time-point studied (Figure 2.3D-E).
2.4.5 Fetal umbilical cord analyses
Umbilical flow rates were not detectable in NOD fetuses prior to gd10. From gd10
onwards, fetus, placenta and umbilical cord were easily visualized with B-Mode ultrasonography.
Figure 2.4A shows a typical B-Mode image of the umbilical cord and placenta of a gd10 c-NOD
fetus while Figure 2.4B shows a typical gd10 PW Doppler scan of the same fetus. Pulsatility of
the UA is used to differentiate between UA and vein in PW Doppler; pulsatility increased from
gd10 (Figure 2.4B) to gd16 (Figure 2.4C). Overall analyses between gd10-16 showed that fetuses
of d-NOD dams had lower umbilical peak and mean flow velocities than fetuses of
54
Figure 2.3. Renal physiology assessed via ultrasonography and histolopathology.
(A) Example of a B-Mode image of the left kidney of a gd12 d-NOD. (B) PW Doppler of a gd10
d-NOD renal artery, measurements taken on peak systolic velocity and end diastolic velocity. (C)
Renal artery RI did not differ between c-NOD and d-NODs prior to mating (data not shown) or at
any gestational time-point. (D) Renal glomeruli in histological sections stained with PAS, scale
bar reports 20 m. No qualitative differences were observed between d-NOD and c-NODs from
gd8 to gd16. (E) Semi-quantitative renal histopathological analysis showing no differences in
renal pathology score between d-NOD and c-NODs at any gestational time-points studied.
Solid bars = c-NOD, white bars = d-NOD. Difference between groups was determined by twoway ANOVA. Effect of gestation within groups was determined by linear regression.
55
56
Figure 2.4. Fetal Scan.
(Previous Page) (A) Representative B-Mode image of a gd10 c-NOD fetus. (B) Representative
PW Doppler image of umbilical artery in a gd10 c-NOD fetus. (C) Representative PW Doppler
image of the umbilical artery in a gd16 c-NOD fetus. (D) Umbilical artery peak flow velocities, cNODs showed an increase with increasing gestation (p=0.0012). Within time-points, c-NOD flow
velocities are increased compared to d-NODs (p<0.0001), peak differences at gd14 and gd16
(p<0.001, p<0.05, respectively). A significant interaction was present between variables
(p=0.047). (E) Umbilical artery mean flow velocities. c-NOD but not d-NOD peak flow velocities
increased over gestational time-points measures (p<0.0001). Diabetic state had an overall effect
on mean umbilical artery flow velocity (p<0.0001) and differences between groups peaked at
gd14 and gd16 (p<0.001, p<0.01, respectively). An interaction effect was seen between variables
(p=0.03). (F) Fetal heart rates. Similar to umbilical flow velocity, c-NOD fetal heart rates
increased throughout gestation (p<0.0001) and are, overall, higher than fetuses of d-NOD dams
(p<0.001). (G) Fetal loss as measured by percentage of resorptions to viable pups. Overall, fetal
loss was elevated in d-NOD compared to c-NODs (p=0.036). Early gestation days for this study
were defined as gd10 and 12, later gestation days were defined as gd14 and 16. Differences
between groups did not differ at early gestation days but reached significance at later gestation
days (p<0.05).
Minimum n=9 per group for all ultrasound data (minimum of three fetuses per dam, 3 dams per
group at each gd). Significance between groups at each gestation day determined by two-way
ANOVA with Bonferroni’s post-test, with p<0.05. Effect of gestation within each group
determined by linear regression, increases and decreases over time defined by non-zero slope
with p<0.05. Umb = Umbilical cord, Pl = Placenta. Single asterisks = p<0.05, double asterisks =
p<0.001, triple asterisks = p<0.0001 between glycemic groups; hash tag = significance from
gd10; dollar sign = significance from gd12.
57
c-NOD dams (p<0.0001; Figure 2.4D-E). Umbilical artery RI was also lower in fetuses of
diabetic dams compared to controls (p=0.013, Appendix A. 2). Differences at specific gd reached
significance at gd14 and 16 (p<0.001, p<0.05 respectively). In fetuses of c-NOD dams, UA peak
flow velocities increased over mid to late gestation (p=0.0012). This was blunted in fetuses of dNOD dams, with a non-statistically significant trend towards an increase in umbilical flow
velocities over mid to late gestation (p=0.0558). Heart rates in fetuses of both c-NOD and d-NOD
pregnancies increased between gd10 and 16 (p<0.0001, p=0.0051 respectively) but patterns and
extent of increases differed between the groups. Fetuses of d-NOD pregnancies had lower HR
overall than fetuses of c-NOD pregnancies (p=0.0002). Differences between groups peaked at
gd12 and 14 (p<0.05, p<0.01 respectively; Figure 2.4F). The onset of lower HR in fetuses of dNOD females at gd12 and lower umbilical flow velocities at gd14 suggest that diabetic
pregnancies become compromised subsequent to gd10. This was further exemplified by postmortem enumeration of failed implantation sites with increased fetal loss seen in later gestation
days (gd14 and 16) in d-NOD compared to c-NODs (Figure 2.4G).
58
2.5 Discussion
Ultrasound study of d- and c-NOD mice revealed times of onset and progression of
functional differences in adaptations of maternal and fetal CV systems that appear to be attributed
to hyperglycemia. In pregnant females, diabetes promoted an excessively dilated LV and blunted
rise in CO and SV after gd12. Fetal impairments were clearly present from gd12 as lower HR and
at gd14 as lower UA flow velocity. These findings suggest either fetal alterations are occurring
before the atypical changes in maternal CV adaptation, or, there are maternal changes at gd10-12
that are not detectable by our study techniques. Completion of fetal and placental development
(gd12) and initiation of rapid fetal growth (gd14) 39 are the developmental events coinciding with
the timing of the atypical responses observed here.
Diabetes alone is known to increase risk for the development of heart failure due to a
decrease in myocardial contractile function (diabetic cardiomyopathy). In diabetic mouse models,
decreased systolic function has been noted at one year after onset of hyperglycemia 235. Since the
females in this study were mated at onset of diabetes, and their cardiac ultrasound profiles at
mating did not differ from c-NOD females, cardiomyopathy was unlikely to have been present at
conception. Maternal age differences in time-dependent progression of the diabetic state are
present in this study, however, mean ages vary by less than 5%. Previous work by Burke et al
2011 (reported in their supplementary materials) showed that non-pregnant, d-NOD females were
hemodynamically stable (measured by continuous radiotelemetry) over the first 13 days
following hyperglycemic conversion. Differences in HR were only observed in pregnant animals
of similar age after midgestation 64. Another study on non-pregnant, female NOD mice (from a
different supplier) reported onset of bradycardia at day 28, their first measurement after diabetic
onset 250. Thus the cardiac changes seen in the current study by day 16 after diabetic onset are
more likely to be pregnancy-induced rather than solely diabetes-induced, although the latter
cannot be completely discounted. Indeed, the pattern observed here of onset of functional cardiac
59
anomaly after midgestation is consistent with previous work, in which the hemodynamic profiles
(measured by radiotelemetry) of d- and c-NOD mice, were concordant until gd10. Subsequently
MAP and HR began to diverge, with lower MAP and HR in d-NODs compared to controls 64.
Both studies, using very different technical approaches, identify midgestation as a critical period
for development of cardiac pathologies during diabetic pregnancy.
Opening of the placental circulation was postulated to pose an acute demand on the
maternal CV system that could not be met in hyperglycemic pregnancy. In the present study, CO,
used as a measure of cardiac function, followed the expected pattern of gestational increase in cNODs. This suggests that c-NOD hearts are better equipped to meet increased placental and fetal
demands. Cardiac output in d-NODs did not increase over this interval, indicating a failure to
adapt in a physiological manner. Stroke volume followed the same pattern, with very little
difference in p values, and a reduction from gd10 to gd16 of approximately 29% (compared to a
37% reduction in CO). This indicates that the bradycardia observed in d-NODs is only minimally
responsible for the resulting effects on CO and that SV is the major contributor. This effect on SV
resembles the blunted increases in CO and LV diastolic diameter reported in diabetic pregnant
women 251 and in CO and SV reported in a postpartum study of women with previous gestational
diabetes 252. In the latter study, the gestationally diabetic women at 1-4 years postpartum had
markers of endothelial dysfunction (altered flow-mediated dilatation), and subclinical
inflammation (elevated Interleukin 6, c-reactive protein), both predictive of increased future CV
disease risk 252. The increased FS in d-NOD compared to c-NOD is an interesting finding when
combined with the observed bradycardia. This phenomenon is not documented in the literature
and may be a type of compensation for the decreased HR and failure to acquire normal increases
in CO; increased FS may result from decreased HR in d-NOD mice. A slower HR would allow
more time for ventricular filling, resulting in increased ventricular stretch, greater diastolic
volume and increased LV contractile strength, according to the Frank-Starling law of the heart 253.
60
Postmortem findings reported here support the conclusion drawn from maternal
echocardiography, that the cardiac responses to pregnancy differed between d-NOD and c-NOD
females. Development of transient cardiac hypertrophy is expected in normal pregnancy 9 and
was observed in c-NOD as increasing LV mass over late gestation. This adaptation, which
typically reverses postpartum 10, did not occur in d-NOD hearts. Additionally, d-NOD but not cNOD hearts showed increasing lumen area to total ventricular area ratios, suggesting progressive
dilation over mid to late gestation. The increased ratio results mainly from increased d-NOD
lumen areas (Appendix A. 3). Differences in LV diastolic diameter (obtained by M-mode
ultrasound), however, are not observed between d- and c-NOD. Methodological differences are
believed to account for this apparent discrepancy since the maximally relaxed, intact heart was
measured in vivo along a single plane in one-dimension using ultrasound, while fixed hearts, in
which some shrinkage would be expected from fixation and processing, were assessed in cut
sections by repeated measures in two dimensions.
Myocyte death is an expected step in the pathogenesis of dilated cardiomyopathy 254. In
streptozotocin-induced diabetes, myocyte apoptosis increased in male rat hearts with highest
levels reported at day 3 after drug treatment and declining numbers of apoptotic cells to day 28 of
study 255. Of interest, myocyte apoptosis was inversely related to blood glucose levels that
increased over the 3-28 day post-treatment interval suggesting that streptozotocin itself
contributes to myocyte death. This confounds interpretation of the effects of hyperglycemia on
myocyte viability in this model. Since blood glucose values in the treated rats and in gd10 d-NOD
mice were similar, the apparent lack of histopathology in the mouse hearts in the current study
suggests that the more gradual onset of diabetes in NOD mice may be a less pathologic process
for myocytes 256. Further study will be required confirm this and to define the potential role of
cardiac apoptosis in the LV dilation observed in d-NODs over late gestation.
61
Circulatory control involves integrated responses between the CV and renal systems.
Neither ultrasound study of the living kidney nor post-mortem histopathology revealed
gestational differences between d-NOD and c-NOD kidneys. These findings reinforce our
conclusion that the heart is a key player in the pathogenesis and development of anomalous CV
responses during diabetic pregnancy. Blood vessels and hormones also play important roles in
cardiac adaptations to pregnancy but were not addressed in our study 257. Insulin from slow
release implants was not used in this study and due to this lack of disease control, greater
handling was required of the experimental animals compared with their controls. This included
more frequent weighing, and subcutaneous fluids at a frequency of up to once per day. Handling
stress may also have contributed in a minor way to the observed differences. The need for
anaesthetic during ultrasound scanning, and individual variations in responses to inhaled
anaesthetic are limitations of rodent ultrasonography and should be considered when interpreting
results.
The impact of diabetes on fetal health was detected by UA velocimetry as lower d-NOD
fetal HR and umbilical flow velocity compared to c-NOD. Both peak and mean UA flow
velocities were assessed to assure that mean flow had not been elevated in d-NOD to compensate
for their lower peak umbilical flow velocity. The increased incidence of fetal cardiac defects in
diabetic pregnancy 60,233 may contribute to the differences in fetal HR observed between d-NOD
and c-NOD mice. Umbilical artery velocities are thought to reflect fetoplacental blood flow and
to be correlated with total placental volume blood flow, which is decreased in cases of growthrestricted fetuses 26. Clinically, UA velocimetry is also useful as a predictive measure of fetal
outcome in small for gestation age infants 258. Recently others reported no difference in fetal HR
or fetal aortic flow velocity between normoglycemic and hyperglycemic dams (mated after
induction of diabetes using streptozotocin) 259. Thus the method by which hyperglycemia
develops, and its speed of onset, may also influence the fetal environment and result in differing
62
fetal CV phenotypes between animal models. The NOD mouse model shows vascular lesions,
IUGR, neural tube and CHD similar to fetuses and offspring of human diabetics 47,52,60,61,64.
Previous study of term pregnancies in d-NOD indicated neonates were smaller than offspring of
c-NOD females 64. In the present study, increased fetal death was observed in gd14-16 d-NOD
compared to c-NOD litters. Thus, ultrasound study of mouse fetuses has predictive values similar
to clinical ultrasound, and the d-NOD mouse appears to be a strong animal model for advancing
current knowledge on the effects of hyperglycemia on the maternal CV system during human
pregnancy.
Prenatal care and glycemic control of pregnant diabetic women have been improving in
urban regions of developed countries. However, in areas with limited health care access and in
studies of unselected populations, increased fetal and maternal morbidities and mortality are still
found in diabetic compared to normoglycemic pregnancies. Even in more advanced health care
centers, increased prenatal care for diabetic women compared to routine care resulted in
decreased perinatal morbidity and increased maternal quality of life 232. A study of patients from
Britain found that only 7% of type 1 diabetic women had optimal glycemic control at their first
antenatal visit (approximately 9th wk of gestation) 260. A peak period of sensitivity to lack of
glycemic control has been identified as 8-16 wk of human gestation 261. These data align with the
results reported here and suggest that opening of the uteroplacental circulation (gd9-10 in mice
and approximately 12 weeks gestation in humans), followed by the onset of rapid fetal growth,
are the physiological drivers promoting life-long CV consequences following a diabetic
pregnancy. Results of this study help to stress the importance of optimal glycemic control in
diabetic pregnancy as being key to the ever-increasing co-prevalence of diabetes and CV disease
in postpartum diabetic women.
63
2.6 Acknowledgements
The authors thank Dr. Graeme Smith, Ms. Tiziana Cotechini and Ms. Wilma Hopman
for invaluable advice and assistance with data analysis. We also thank Dr. Jianhong Zhang, Mr.
Richard Di Lena, Ms. Jalna Meens, Mr. Alexander Hofmann and Mr. Andrew Kriger for
technical support.
64
Chapter 3
Placental Growth Factor Influences Maternal Cardiovascular
Adaptation to Pregnancy in Mice
This chapter was modified from the original publication: Aasa KL, Zavan B, Luna RL, Wong PG,
Ventura NM, Tse MY, Carmeliet P, Adams MA, Pang SC, Croy BA. Placental Growth Factor
Influences Maternal Cardiovascular Adaptation to Pregnancy in Mice. Biology of Reproduction
2015, 92(2):44.
Modifications were made after publication to correct typographical errors, clarify concepts and to
make terminologies consistent throughout the thesis, yet maintain the integrity of the original
publication. Additional interpretation has been added to the General Discussion (Chapter 6).
65
3.1 Abstract
In healthy human pregnancies, placental growth factor (PGF) concentrations rise in maternal
plasma during early gestation, peak over weeks 26-30, and then decline. Since PGF in non-gravid
subjects participates in protection against and recovery from cardiac pathologies, we asked if PGF
contributes to pregnancy-induced maternal cardiovascular adaptations. Cardiovascular function
and structure were evaluated in virgin, pregnant and postpartum C56BL/6-Pgf-/- (Pgf-/-) and
C57BL/6-Pgf+/+ (B6) mice using plethysmography, ultrasound, qPCR and cardiac and renal
histology. Pgf-/- females had higher systolic blood pressure in early and late pregnancy but an
extended, abnormal mid-pregnancy interval of depressed systolic pressure. Pgf-/- cardiac output
was lower than gestation day (gd)-matched B6 after mid-pregnancy. While Pgf-/- left ventricular
mass was greater than B6, only B6 showed the expected gestational gain in left ventricular mass.
Expression of vasoactive genes in the left ventricle differed at gd8 with elevated Nos expression
in Pgf-/- but not at gd14. By gd16, Pgf-/- kidneys were hypertrophic and had glomerular pathology.
This study documents for the first time that PGF is associated with the systemic maternal
cardiovascular adaptations to pregnancy.
66
3.2 Introduction
Placental growth factor (PGF) is a member of the vascular endothelial growth factor
(VEGF) family 103 with important cardioprotective roles 106,121,262. PGF has prominent, specific
roles in cardiac stress and disease that have made it an attractive therapeutic candidate 106,121.
Research into infarcted and pressure-loaded hearts identified the importance of PGF in adaptive
hypertrophy and in promotion of angiogenesis; PGF deficits in the diseased heart are strongly
correlated with diminished prognosis for repair and survival 106,121,262.
Pregnancy is physiologically challenging to the maternal cardiovascular (CV) system 7.
Typical pregnancy induces gains in blood volume 9 and cardiac output (CO), transient cardiac
hypertrophy 9,10 and vessel restructuring across the decidualized endometrium. Decidual vascular
restructuring includes early neoangiogenesis and later spiral arterial (SA) remodeling 11,
processes influenced by PGF 104,263. Plasma PGF concentrations fluctuate in women over
pregnancy, increasing from 1st trimester, peaking at 26-30 weeks, declining towards term and
returning to baseline postpartum 82,103. We postulated that gestational elevations in PGF
participate in the normal functional adaptions of the maternal heart to pregnancy.
PGF executes its angiogenic properties primarily through binding with high affinity to
VEGFR1 (also known as FLT1) 103. VEGFA also binds to this receptor but with lower affinity
and can be displaced by PGF. Displacement of VEGFA increases its bioavailability and ability to
drive the major pathway for angiogenesis though binding to VEGFR2 104,105. Humans have four
PGF isoforms 105,107, whereas, mice express a single Pgf2 gene homologue 122. Pgf-/- mice have
been available for a number of years. Since Pgf-/- x Pgf-/- matings produce viable, phenotypically
normal litters, containing normal numbers of pups 104,121, PGF has generally been considered
redundant during development 122. To address whether PGF has a role in maternal gestational
67
cardiac adaptations, we quantified PGF in the plasma of normal mice over pregnancy. Since the
time course for the pattern of detection resembled that of human pregnancy, we proceeded to
compare the CV systems of C57BL/6-Pgf-/- (Pgf-/-) females mated by Pgf-/- males to C57BL/6Pgf+/+ (B6) females mated by B6 males over pregnancy using plethysmography and ultrasound.
These studies, supported by gross and histological analyses of the maternal heart and kidney and
by analysis of expression of targeted genes in the left ventricles (LV) of late gestational females,
implicate the dynamic, gestational elevation of PGF in maternal plasma in the maternal CV
adaptations to pregnancy.
68
3.3 Methods
3.3.1 Experimental animals
B6-Pgf-/- mice were bred at Queen’s University from foundation stocks provided by P.
Carmeliet 118. Female and male B6 mice were purchased from Charles River Laboratories
(Wilmington, MA) and used as controls. A total of 78 females (n=39/ genotype) were used in this
study. Animal usage was conducted in accordance with the SSR’s specific guidelines and
standards and under protocols approved by the Queen’s University Animal Care Committee that
were in accordance with the Canadian Council on Animal Care’s Guide to the Care and Use of
Experimental Animals.
At 11-16 wk of age, females were paired with a male; detection of a copulation plug the
following morning was considered gestation day (gd)0. For dams studied postpartum (PP)
weanlings were removed on postnatal day 4.
3.3.2 ELISA
PGF-2 concentrations were measured by Quantikine ELISA (R&D Systems; Cedarlane,
Burlington ON) in undiluted, citrated plasma samples collected by cardiac puncture in
anaesthetized virgin, gd-matched and 30 days PP Pgf-/- and B6, using n=3-5
females/genotype/time-point. Plasma samples were assessed as individual animals run in
duplicate with means of the duplicates used for analyses. The assay was performed according to
manufacturer’s instructions.
3.3.3 Arterial pressure recordings
Due to cerebral vascular complications that included an incomplete circle of Willis 23,
assessment of arterial pressure could not be conducted by radiotelemetry 31. From a large study of
Pgf-/- males and females on B6 and 129/SvJ strain backgrounds, only two 129/SvJ females were
69
successfully recorded. These females mated and their gestational recordings are included as
Appendix B. 1 to support data on the impact of PGF deficiency collected by plethysmography.
Baseline tail cuff recordings of systolic pressure were obtained (Coda High Throughput 4
chamber, Kent Scientific Corp) from Pgf-/- (n=3) and B6 (n=4) females pre-trained to the
instrument for 14 days (d). Baseline pressure for each animal was averaged from 5-10d of
recordings after pre-training but prior to pregnancy. These females were subsequently mated and
blood pressures (BP) were serially recorded on each day of pregnancy. Recordings included 25
cycles and machine acceptable measurements were subjected to outlier analyses and the
remaining values were averaged for each animal for each day and normalized to baseline values
for statistical analysis.
3.4 Ultrasonography
The Vevo770 high-frequency ultrasound system (VisualSonics, Toronto, Canada) was
used to evaluate maternal CV function in anaesthetized virgin and pregnant (gds 8,10,12,14,16
and 18) Pgf-/- and B6 females (n=3-5dams/genotype studied at each time-point). Each female was
studied on only one gd (i.e. not followed serially) to permit postmortem collection of tissues that
could be directly related to the sonographic findings. Animals were anaesthetized using 5%
inhaled isoflurane in oxygen and maintained at 1.5-2% during sonography. The Vevo707B
30MHz transducer was used for M-Mode cardiac scanning to obtain structural and physiological
data. Parasternal long axis views of the heart were used with sample volume placed perpendicular
to the aorta and through the left ventricle (LV) at a mid-papillary section to ensure consistency in
measurement position between animals (Appendix B. 2). The Vevo704 40MHz transducer was
used to perform renal, uterine and umbilical arterial scans. Pulsed-Wave (PW) Doppler
measurements were obtained using an angle of insonation of less than 60° from uterine and renal
70
arteries (RA). Renal artery Resistance Index (RI) was calculated as RI = peak systolic velocity –
end diastolic velocity / peak systolic velocity. Between gd10-18, as permitted by litter size and
fetal development, 3-5 fetuses from each dam were located and fetal heart rates (HR), umbilical
artery (UA) peak velocities and UA RI were measured.
3.4.1 Postmortem organ wet-weights
Following ultrasonographic study, animals were euthanized by sodium pentobarbitol
overdose (CEVA Sante Animale) (50mg/kg), exsanguinated by cardiac puncture and dissected.
Hearts were removed and weighed intact. The heart chambers were then dissected, weighed
individually and snap frozen in liquid nitrogen for gene expression studies. Right hind limbs were
dissected, digested overnight in 0.2M NaOH at 60ºC and tibia length measured using digital
calipers. Tibia lengths were constant during pregnancy and did not differ between genotypes
(p=0.17) and, therefore, were used for normalization of heart weight to body size of each mouse.
Both kidneys were freed of adhering adipose tissue and weighed. Fetal weights were obtained
after removal from the amniotic sac, placenta and umbilical cord. Live pup weights were obtained
on postnatal day 4, prior to euthanasia.
3.4.2 Histological and morphometric analyses
A separate cohort of virgin and gd16 Pgf-/- and B6 mice (n=3/genotype/ time-point) was
used exclusively for histological studies. These mice were euthanized and perfusion-fixed
(transcardiac) with potassium-based perfusion buffer (140mM NaCl, 10mM KCl, 5mM EDTA)
264
for 5min (1mL/min.) followed by 4% neutral buffered paraformaldehyde (PFA) for 5min
(1mL/min) using a constant flow pump. Hearts and right kidneys were then removed, further
fixed by overnight immersion in PFA, then processed for paraffin-embedding. Parasternal short
axis cardiac (6 µm) and coronal renal sections (2 µm) were cut and stained with Hematoxylin and
71
Eosin (H&E). Sections were digitized and analyzed using standard light microscopy and Zeiss
AxioVision Software. For each heart, maximum LV chamber area and exterior wall thickness
were measured. For each kidney, 10 randomly selected renal corpuscles were identified and
photographed. Surface areas of each corpuscle and glomerulus were measured. Subtraction of the
latter was used to estimate Bowman’s space. Glomerular cellularity was estimated by counting
endothelial cell numbers.
Immunohistochemistry (IHC) for NOS2 and NOS3 was performed on a second cohort of
perfusion-fixed B6 and Pgf-/- hearts at virgin, gd8 and gd14. Paraffin-embedded hearts were cut at
6μm and a diaminobenzidine chromogen protocol was used. Slides were incubated with 3%
bovine serum albumin buffer and antigen retrieval was performed using citrated buffer under
humid conditions for 30min. Primary antibodies were purchased from ABCam (Rabbit polyclonal
antibody against iNOS; 1:200 dilution) and Santa Cruz Biotechnologies (Rabbit polyclonal
antibody against eNOS; 1:100 dilution). Secondary antibody used for both was purchased from
Vector Laboratories (Biotinylated goat anti-Rabbit IgG; 1:200 dilution). Sections were
counterstained with Hematoxylin. Negative control consisted of an isotype control in place of
primary antibodies; no staining resulted. Image analysis was performed by pixel quantification
using image analysis software (GIMP 2.8.10).
3.4.3 Real-time quantitative PCR (RT-qPCR)
Total RNA was extracted from snap frozen LV samples from virgin, gd8 and gd14
females (previously used for ultrasound studies) using the high-pure tissue RNA isolation kit
(Roche Scientific Co) and an established, modified protocol 265. RT of total RNA was then
performed using a high-capacity cDNA reverse transcription kit (Applied Biosystems) and
manufacturer’s instructions. Relative mRNA expression was measured in triplicate and means
72
reported relative to Gapdh mRNA using qPCR (Roche Lightcycler 480 II). Primers were
designed using published GenBank sequences and Primer Designer Software version 2.01
(Scientific and Educational Software). Genes studied, primer sequences and standard curve
efficiencies are given in Appendix B. 3..
3.4.4 Statistical analyses
Statistical analysis was performed using Prism 5.0 Statistical Software (GraphPad). PGF
ELISA analysis in detectable mice (B6 only) was performed using one-way ANOVA; differences
between gd were determined by Tukey’s post-test. Comparisons between Pgf-/- and B6 genotypes
across gestation were performed using two-way ANOVA and differences at specific gd were
tested using Bonferroni’s post-test and data set-up as Pgf-/- vs B6. Data are presented as mean ±
standard error (SEM), using n=3-5 dams/group. Differences were defined as significant at p≤0.05.
Regression analysis was used to determine differences in changes over time, with a significantly
non-zero slope considered a change. Morphometric analysis between groups at gd16 was
performed using Student’s t-test.
73
3.5 Results
3.5.1 Maternal plasma PGF concentrations fluctuate over gestation
Plasma PGF levels were measured in virgin, pregnant and 30 days PP Pgf-/- and B6
females. PGF was not detected in any Pgf-/- sample. PGF levels in virgin and PP B6 were
detectable but very low; significantly higher levels were detected in all pregnant B6 samples.
PGF concentrations rose to gd10-14 (statistically similar) then declined. PGF concentrations in
B6 females were highest at gd10; this was the only time-point that showed a statistically
significant increase from virgin levels. Gd10 levels were not significantly higher than levels at
gd14; however, gd10 levels were higher than all other time points measured (Figure 3.1).
3.5.2 MAP over gestation
In virgin Pgf-/-, systolic arterial pressure (SAP) was elevated relative to B6 females
(Figure 3.2A). This was also true in late gestation (Figure 3.2A). However, the overall pattern of
change in Pgf-/- SAP was similar to B6. That is, SAP dropped from pre-conception baseline after
gd6 with a gd9 nadir. B6 recovery to baseline pressure was achieved by gd12 but was delayed in
Pgf-/-. Differences in SAP (delta from baseline) over pregnancy increased in a non-statistically
significant manner in Pgf-/- compared to B6 dams (p=0.055; Figure 3.2B). When raw data were
segregated into previously determined phases of embryonic and placental development thought to
influence BP 31, differences between groups were significant in Phase 1 (gd0-5, extent of the drop
in SAP) and Phase 4 (gd15-18, extent of the rebound) (p=0.0002 and p=0.047, respectively). In
both phases, Pgf-/- dams had higher SAP than B6 (Figure 3.2A). Duration of the hypotensive
phase was longer in Pgf-/- dams than the single day nadir in B6 (Figure 3.2B).
74
Figure 3.1. Circulating PGF concentrations in B6 mice using ELISA (n=3-5
pregnancies/time-point).
PGF was below detectable levels in all Pgf-/- dams (not shown). PGF concentrations in B6
females varied significantly over gestation (p=0.0018), levels peaked at gd10, the only time-point
that showed a significant difference from virgin levels. Gd10 levels were not significantly higher
than levels at gd14; but were higher than all other time points measured. Significance determined
by one-way ANOVA with Tukey’s post-test. * p≤0.05 from gd10, **p≤0.001 from gd10.
75
Figure 3.2. Gestation-induced hemodynamics and cardiac systolic function are altered in
Pgf-/- dams.
Systolic arterial pressure (SAP) (A-B) was analyzed in trained Pgf-/- and control females across
gestation using tail cuff plethysmography (n=4 B6, n=3 Pgf-/-). (A) Raw SAP over pregnancy was
segregated into phases according to typical blood pressure fluctuations in normal mouse
pregnancy (29). In phases 1 (gd0-5) and phase 4 (gd15-18), SAP was higher in Pgf-/- than B6
dams. Baseline (pre-pregnancy) values are indicated for Pgf-/- (horizontal dotted line) and B6
(horizontal solid line). Pre-pregnancy SAP was higher in Pgf-/- versus control females. (B) SAP
was normalized to baseline values and represented as a change from baseline over pregnancy.
Fluctuations in SAP in Pgf-/- dams appear to follow the same trends as B6 dams, however,
magnitude of fluctuations appear more pronounced. The nadir appearing at gd9 in control mice
appears to be prolonged to several days in Pgf-/- (A-B). Maternal cardiac systolic function (B-C)
was assessed using echocardiography (n=3-5/group/time-point). (C) Cardiac output (CO)
increases over gestation in B6 dams but not Pgf-/- dams (by linear regression). PGF has an affect
on CO in pregnancy, with decreased CO seen in Pgf-/- females, reaching significance at gd14 and
gd16. (D) Stroke volume (SV) increases across gestation only in B6 dams (by linear regression).
SV is lower overall in Pgf-/- females; differences at specific gds were reached at gd16. Changes
over time were determined by linear regression with a statistically non-zero slope (C-D).
Differences between groups were determined by Two-way ANOVA with Bonferroni’s post-test
(A-D). *P≤0.05, **P≤0.01, ***P≤0.001 versus age-matched B6.
76
3.5.3 Echocardiographic evaluation of cardiac function
Echocardiographic analyses in virgin Pgf-/- and B6 mice showed no functional
differences. In pregnant Pgf-/- females, cardiac output (CO) and stroke volume (SV) were stable
while in pregnant B6 females CO and SV increased over gestation, as expected for a normal
pregnancy (Figure 3.2C and D). CO was reduced overall in Pgf-/- dams across pregnancy
compared with B6 (p=0.008); significance at specific time-points was found at gd14 and gd16
(Figure 3.2C). Overall SV during pregnancy was also lower in Pgf-/- dams compared to B6
(p=0.005), reaching a specific time point statistical significance at gd16 (Figure 3.2D).
3.5.4 Echocardiographic and post-mortem assessment of cardiac structure
There were no statistical differences between Pgf-/- and B6 heart or LV weights for virgin
animals (determined by echocardiography) (Figure 3.3A-C). Echocardiography did not detect
any change in Pgf-/- LV mass over pregnancy while LV mass increased from virgin levels over
gestation in B6 (Figure 3.3A).
Post-mortem studies of hearts collected at each study time point supported the
echocardiographic data. When normalized to tibia length, Pgf-/- LV wet-weight did not change
over gestation while B6 LV wet-weight increased from its virgin level over gestation, as indicated
by a statistically non-zero slope (Figure 3.3B). Overall differences in normalized LV mass
throughout pregnancy and post-partum between Pgf-/- and B6 mice were not significant (p=0.088;
Figure 3.3B). Normalized total heart weight increased over gestation and post-partum only in B6
(Figure 3.3C). Lack of PGF had an effect on total heart weight with Pgf-/- hearts being heavier
than B6 over virgin, pregnancy and post-partum time-points (p=0.049); analysis of individual
pregnancy time-points did not show statistical differences between genotypes (p=0.089) (Figure
3.3C).
77
Virgin Pgf-/- and virgin B6 LVs appeared structurally similar by routine histological
examination (Appendix B. 4). Morphometric studies looking at wall width and chamber size at
gd16 (when cardiac functional differences were seen sonographically) suggested that Pgf-/- LVs
were not different from B6 (p=0.16; data not shown).
3.5.5 LV gene and protein expression
RT qPCR analysis for LV relative expression of the natriuretic peptide and VEGF gene
systems (Nppa, Nppb, Npra, Nprc, Vegfa, Vegfb, Vegfr1, Vegfr2) found no differences between
Pgf-/- versus B6 in virgin, gd8 or gd14 animals (Appendix B.3). Relative Eng expression across all
samples was greater in Pgf-/- LV versus B6 across gestation but did not reach significance at any
specific time point (Figure 3.4A). Genotype affected overall Nos3 relative expression, with
greater expression in Pgf-/- LV. Time-point specific differences in Nos3 were present in gd8 but
not virgin or gd14 Pgf-/- versus B6 LV (Figure 3.4B). PGF deficiency had a similar gestation day
effect on relative Nos2 expression, being higher in gd8 Pgf-/- LV. The effect of genotype on
overall Nos3 expression showed a statistically non-significant increase in Pgf-/- LV (p=0.09;
Figure 3.4C). These dynamic expression patterns were confirmed using IHC (Figure 3.4D-G).
3.5.6 Renal analyses in virgin and pregnant Pgf-/- mice
Renal artery RI, used to measure downstream vascular impedance, did not differ between
virgin Pgf-/- versus B6. Gestational RA RI in Pgf-/- was also not statistically different versus B6
(p=0.11; Figure 3.5A). Postmortem kidney weights normalized to tibia lengths were greater in
Pgf-/- than in pregnancy status-matched B6 (p=0.036; Figure 3.5B). Renal histopathology (Figure
3.5C) at gd16 quantified glomerular hypercellularity and depleted urinary spaces in Pgf-/- versus
B6 kidneys (p<0.001; Figure 3.5D-E).
78
Figure 3.3. PGF deficiency is accompanied by cardiac structural differences across
pregnancy and post-partum.
(A) Left ventricular (LV) mass, determined by echocardiography (n=3-5/group/time-point),
increased over gestation (virgin-gd18) in B6 but not Pgf-/- dams, as indicated by a significantly
positive slope in only the B6 group. Total heart wet weight and chamber weights were determined
at euthanasia (n=3-5/group/time-point) (B-C). Weights were normalized to tibia length
(unchanged between groups; p=0.17) to account for differences in body weight initially and over
the course of pregnancy (B-C). (B) Normalized LV mass appeared increased in Pgf-/- dams
compared to controls across pregnancy and post-partum, the difference was not significant
(p=0.088). (C) Normalized heart mass was greater in Pgf-/- versus B6 dams throughout pregnancy
and post-partum (p=0.049) but the differences did not reach significance at any specific timepoint. Changes over time were determined by linear regression with a statistically non-zero slope
(A). Differences between groups were determined by Two-way ANOVA with Bonferroni’s posttest (B-C).
79
3.5.7 Fetal outcomes in Pgf-/- pregnancy
Uterine artery RI was elevated in Pgf-/- versus B6 dams across gestation (Figure 3.6A) but
not at any specific gd. Fetal HR however did not differ between genotypes (Figure 3.6B).
Umbilical artery RI was also similar between genotypes (Figure 3.6C) as were intrapartum and
postpartum litter sizes (Figure 3.6D). Pgf-/- fetuses weighed less than B6 fetuses at both gd14 and
gd18. This difference did not persist postpartum with pup weights measured as equivalent by PP
day 4 (Table 3.1). These differences between groups in fetal and postnatal offspring weights were
not associated with differences between genotypes in maternal body weight across pregnancy
(Appendix B. 5).
80
81
Figure 3.4. Upregulated gene expression in left ventricular (LV) tissue of Pgf-/- mice at
midgestation.
(Previous Page) mRNA expression was determined using qPCR and normalized to expression of
Gapdh (n=4/group/time-point) (A-C). Differences in LV NOS2 and NOS3 protein levels were
measured by IHC (D-G). (A) Relative endoglin (Eng) expression was increased overall compared
to B6 controls (p=0.039) but did not reach significance at any specific time-point. (B) Relative
Nos3 (eNos) expression was increased in Pgf-/- LV compared to B6. Differences at specific time
points were significant at gd8. (C) Relative LV Nos2 (iNos) expression was increased in Pgf-/compared to B6 only at gd8. (D) NOS3 protein expression showed a non-statistically significant
increase in Pgf-/- LV compared to B6 overall (p=0.09); gestation-day specific differences reached
significance at gd8 (p<0.01). (E) NOS2 protein expression was also increased in Pgf-/- LV tissue
versus B6 control both overall (p<0.0001) and at gd8 (p<0.001). (F-G) Representative
micrographs from virgin, gd8 and gd14 Pgf-/- and B6 LV showing IHC staining for NOS3 and
NOS2 with hematoxylin counter-stain. Quantitative differences in IHC staining were determined
by relative pixel density. Inlets represent negative isotype control (F-G). Differences between
groups determined by Two-way ANOVA with Bonferroni’s post-test (A-C). *P≤0.05. **P≤0.01,
***P<0.001. Scale bars represent 20μm.
82
Figure 3.5. Renal hypertrophy and structural abnormalities are present in pregnancies
lacking PGF.
(A) Renal artery RI in Pgf-/- versus B6 did not reach a statistically significantce difference (n=35/group/time-point, p=0.11). (B) Total kidney wet-weight was measured at euthanasia and
normalized to tibia length (n=3-5/group/time-point). Kidney weight increased in Pgf-/- dams over
pregnancy compared to B6 controls (p=0.0015). (C) Representative sections from non-pregnant
(NP) and gd16 Pgf-/- and B6 dams. (D) Bowman’s capsular space (urinary space) was measured
in randomly selected cortical glomeruli by subtracting glomerular area from total corpuscle
surface area (n=3/group/time-point). Urinary space was significantly decreased in Pgf-/- kidneys
versus controls. (E) Cellularity was measured in 10 random glomeruli; cellularity was increased
in gd16 Pgf-/- versus B6 kidneys. Scale bars=20μm (C). Differences between groups were
determined by Two-way ANOVA with Bonferroni’s post-test (A-B). Differences in urinary space
and glomerular cellularity at gd16 were determined by Student’s T-Test (D-E). ***P≤0.0001.
83
Figure 3.6. Maternal CV consequences of PGF deficiency have negligible fetal impact.
High-frequency ultrasound was used for velocimetry of the uterine and umbilical arteries (n=3-5
dams/group/time-point; n=4 fetuses/dam) (A-C). (A) Uterine RI is increased in Pgf-/- dams
compared to B6 from virgin to across gestation (p=0.013) but did not reach significance at any
specific gd. When analyzing gestational time-points alone, the difference between groups
approached significance (p=0.08). (B) Fetal heart rate was measured between peaks on PW
Doppler cine loops of the umbilical artery. Fetal heart rate did not differ between genotypes at
any gestational time-point measured. BPM= Beats per minute. (C) Umbilical artery RI did not
differ between genotypes across gestation. (D) Litter size did not differ between Pgf-/- and B6
pregnancies. Differences between groups were assessed by Two-way ANOVA with Bonferroni’s
post-test (A-D).
84
Table 3.1.Fetal/Pup Weight in Gestation and Post-partum.
Pgf-/- fetal/pup weight
Pgf-/-
B6 fetal/pup weight
B6
(g)
(n)
(g)
(n)
gd14
0.206±0.006
16
0.27±0.004
16
<0.0001
gd18
0.976±0.034
12
1.217±0.049
12
0.0005
PND4
3.095±0.196
22
3.324±0.146
19
0.37
n =3-4 dams per group
PND4 = Postnatal day 4
85
p-value
3.6 Discussion
This study provides the first thorough physiological assessment of the effect of PGF
deficiency on mouse pregnancy. We postulated that the high PGF concentrations that develop in
the plasma of pregnant women between early pregnancy and week 30 may contribute to the
maternal CV adaptations necessary for support of conceptus growth and pregnancy success. Our
comparisons between Pgf-/- and B6 pregnancies document an involvement of PGF in the normal
cardiac adaptations that occur during mid to late pregnancy 266. We found that by gd8 PGF
concentrations in B6 maternal plasma were elevated over preconception values, however this did
not reach significance. Peak levels were found over gd10-14, after which PGF levels dropped and
had returned to baseline at PP day 30. This pattern reflects the Pgf-/- gene expression time-course
measured previously in decidua basalis 104 and is generally similar to that seen in human
pregnancy. The pattern of mouse PGF fluctuation was coordinated with various maternal cardiac
changes measured over normal B6 pregnancy. Cardiac functional parameters, such as CO and
SV, peaked during mid-gestation (gd10-14). Similarly, structural parameters, such as LV mass,
reached peak levels during mid-gestation.
In humans, maternal plasma PGF deficiency is linked to the hypertensive disorder
preeclampsia (PE) and fetal growth restriction 231,267,268. However, neither the effects of PGF on
regulation of maternal BP nor the roles of PGF in fetal development and growth are known. We
evaluated both features in Pgf-/- mice that were confirmed by ELISA and PCR to be PGF
deficient. Although radiotelemetric studies are regarded as the optimal approach for BP studies in
rodents 269 and were attempted, they could not be conducted in Pgf-/- mice due to cerebral vascular
anomalies, including an incomplete circle of Willis in >80% of adult Pgf-/- females and males 23.
We therefore used plethysmography to assess the impact of PGF deficiency on gestational BP.
86
The key findings in Pgf-/- dams were that preconception SAP was higher, and that the pregnancyinduced drop in SAP (between gd6-9) was extended in length. Once Pgf-/- SAP returned to
baseline (gd14), it differed from B6 by being unstable and dropping between gd16 and term.
These measurements suggest an association of PGF with fine control of gestational BP and with
the normal, mid-gestational rebound in MAP 31,270. The normal mid-gestational ascent of MAP
from nadir in normal mice occurs at the same time as completion of placental development,
opening of the placental circulation and intraluminal invasion of trophoblasts 31,271. Differences in
SAP were also present between gd0-5, with Pgf-/- dams having higher SAP than B6. A similar
finding that PGF levels inversely correlate with maternal BP was reported in a prospective study
of 110 women in their 1st trimester 272. Both the mouse and human data attribute significance to
the small elevations in plasma PGF that occur very early in pregnancy. SAP was elevated in Pgf-/dams versus controls in late pregnancy (gd15-18). This phase immediately follows normal peak
PGF levels in pregnancies. We postulate that differences in cardiac function between groups at
gd14 and gd16, has systemic consequences that are reflected as changes in BP by phase 4 of
pregnancy. Baseline/pre-pregnancy SAP appeared higher in Pgf-/- females but did not reach
statistical significance.
An important component of BP regulation is the kidney. Both PGF and VEGF are linked
to renal development and function and glomerular podocytes are known to express PGF 90. Renal
hypertrophy, glomerular hypercellularity and diminished urinary space were seen in Pgf-/compared to B6 kidneys in late pregnancy. The elevated SAP during early and late Pgf-/pregnancy could either contribute to or result from the renal hypertrophy observed in pregnant
Pgf-/- females.
87
Prior to conception, Pgf-/- hearts did not differ statistically from B6 hearts in any
parameter measured. This supports previously published data that Pgf-/- mice, prior to any
intervention, have no cardiac phenotype 124. Increases in CO and SV characterize normal
pregnancy in mice and women 33,273. These pregnancy-induced CV stressors bear similarities to
other CV stressors, such as pressure overload or myocardial infarct 106,121,124,128,274. In these latter
conditions, PGF administration decreases heart failure incidence and ameliorates recovery by
increasing cardiac angiogenesis and promoting adaptive hypertrophy. Gd16 Pgf-/- hearts
phenotypically resembled pressure overload-hearts, being enlarged by weight but having a similar
ventricular wall thickness than controls 106,121,124,128,274-276. The most pronounced cardiac
differences between pregnant Pgf-/- and B6 dams were in CO and SV at gd14 and gd16, days
following the highest circulating concentrations of PGF in normal pregnant mice. We suggest this
reflects a delay in adaptation to PGF deficiency and indicates a role for PGF in maternal cardiac
remodeling over mid pregnancy. Normalization of these parameters by gd18 in Pgf-/- dams
corresponds with the decrease in circulating PGF levels of normal pregnancy and suggests a
limited window for PGF activity during gestational CV adaptations. Dilatory growth is a possible
explanation for the failure of CO and SV to increase across Pgf-/- gestations.
Cardiac stress alters expression levels of many genes 277,278. Members of the NOS gene
system are prominent amongst the genes altered during cardiac stress and, like PGF, participate in
cardioprotection, the hypertrophic response and angiogenesis 275,277,279,280. In mice, overexpression
of Pgf increases LV Nos3 expression and NO production, steps pivotal to downstream
cardiomyocyte hypertrophy 275. Upregulation of Nos3 by pregnancy in Pgf-/- LV must be mediated
via another, as yet undefined pathway. Both PGF and NOS3 (through NO) increase adaptive
hypertrophy in a cardioprotective manner; however, NOS3 (through NO) also has strong
88
vasodilatory properties. This may contribute to the development of a more dilatory hypertrophy in
the hearts of late gestational Pgf-/- dams. Much like NOS3, NOS2 has cardioprotective effects 281
and increased NOS2 levels are a downstream, compensatory effect of the increased SAP in Pgf-/early in pregnancy 282. Exaggerated fluctuations in BP across pregnancy in Pgf-/- dams and their
diminished ability to quickly rebound from the mid-gestation nadir may contribute to altered
Nos2 expression. Nos2 and Nos3 expression in the heart appear to be inversely correlated with BP
in Pgf-/- dams at mid-gestation. The extended nadir in SAP in Pgf-/- dams may result from the
vasodilatory outcomes from increased Nos expression 283, however, this is yet to be addressed
experimentally.
PGF deficiency and its associated maternal CV alterations were of limited impact on fetal
blood flow and growth. Increased uterine artery RI in Pgf-/- dams indicated an increase in
downstream vascular impedance 249. PGF is known to contribute to uterine artery vasodilation,
and these effects are pronounced in pregnancy 122; in this way PGF contributes to uterine artery
remodeling in response to pregnancy 284. Spiral artery modification is only slightly delayed in
pregnant Pgf-/- versus B6 females 104, suggesting that SA are not the cause of the impedance we
observed. Intrapartum death was not elevated in Pgf-/- litters and fetuses had normal HR and
umbilical flow velocities. However, late gestational Pgf-/- fetuses were lighter than controls,
suggesting that PGF-driven angiogenesis may contribute directly to fetal growth rates, rather than
through measurable circulatory parameters. Normalization of offspring weight by PND 4 suggests
acquisition of an additional CV risk factor, as rapid postnatal growth after slower than normal
fetal growth is associated with subsequent CV and metabolic diseases 285-287. Thus, while PGF
appears redundant for fetal development (fetuses are phenotypically normal), the high levels of
PGF found in maternal plasma during normal pregnancy are associated with protective functions
89
on the maternal CV system across mid gestation. The late pregnancy decline in maternal plasma
PGF may reflect completion of the major steps of maternal cardiac and vascular remodeling
needed to support the latest stages of pregnancy.
This study reveals novel associations between PGF levels and normal maternal CV
adaptations to pregnancy. Continued efforts to stratify pregnant women who go on to develop
pregnancy complications into those with low or with normal levels of PGF are warranted. This
will enable refined evaluations of the exact role of PGF in the disturbed CV adaptations seen in
pregnancy complications. Further evaluations may also shed light on the role of PGF in
subsequent maternal CV risk after a complicated pregnancy 288.
90
3.7 Acknowledgements
The authors thank Ms. Tiziana Cotechini and Ms. Wilma Hopman for technical support
and assistance in statistical analysis. We thank Ms. Carolina Venditti for instruction in
plethysmography, Dr. Alastair Ferguson for provision of equipment and Dr. David Armstrong for
qPCR primer design. We appreciated the advice given by Dr. Iain Young on renal histological
data. We also thank Mr. Matthew Rätsep, Ms. Ashley Martin, Ms. Vanessa Kay and Dr. Patricia
Lima for technical assistance.
91
Chapter 4
In utero Dimethadione Exposure Causes Postnatal Disruption in
Cardiac Structure and Function in the Rat
This chapter was modified from the original publication: Aasa KL, Purssell E, Adams MA,
Ozolinš TRS. In Utero Dimethadione Exposure Causes Postnatal Disruption in Cardiac Structure
and Function in the Rat. Toxicological Sciences 2014, 142(2):350-60.
Modifications were made after publication to correct typographical errors, clarify concepts and to
make terminologies consistent throughout the thesis, yet maintain the integrity of the original
publication. Additional interpretation has been added to the General Discussion (Chapter 6).
92
4.1 Abstract
In utero exposure of rat embryos to dimethadione (DMO), the N-demethylated teratogenic
metabolite of the anticonvulsant trimethadione, induces a high incidence of cardiac heart defects
including ventricular septal defects (VSD). The same exposure regimen also leads to in utero
cardiac functional deficits, including bradycardia, dysrhythmia and a reduction in cardiac output
and ejection fraction that persist until parturition (10 days after the final dose). Despite a high rate
of spontaneous postnatal VSD closure, we hypothesize that functional sequelae will persist into
adulthood. Pregnant Sprague-Dawley rats were administered six 300mg/kg doses of DMO, one
every 12 h in mid-pregnancy, beginning on the evening of gestation day 8. Postnatal cardiac
function was assessed in control (CTL) and DMO-exposed offspring using radiotelemetry and
ultrasound at 3 and 11 months of age, respectively. Adult rats exposed to DMO in utero had an
increased incidence of arrhythmia, elevated blood pressure and cardiac output, greater left
ventricular volume and elevated locomotor activity versus CTL. The mean arterial pressure of
DMO-exposed rats was more sensitive to changes in dietary salt load compared with CTL.
Importantly, most treated rats had functional deficits in the absence of a persistent structural
defect. It was concluded that in utero DMO exposure causes cardiovascular deficits that persist
into postnatal life in the rat, despite absence of visible structural anomalies. We speculate this is
not unique to DMO, suggesting possible health implications for infants with unrecognized
gestational chemical exposures.
93
4.2 Introduction
Congenital heart defects (CHD) are the most common anomaly noted at birth 289,290; of
which, ventricular septal defects (VSDs) are the most prevalent. VSDs permit communication
between left and right ventricles, resulting in mixing of oxygenated and deoxygenated blood, 190.
Approximately 85 - 90% of VSDs spontaneously resolve within the first year of life and are
assumed to require no further clinical follow-up 190,291; however, depending upon the size and
location, unresolved VSDs may require surgical intervention 289,290. Persistent VSD may lead to
pulmonary arterial hypertension (PAH) and shunting of deoxygenated blood from the right to the
left ventricle (LV), resulting in hypoxia 190,292. Even with surgical repair of the structural defect,
patients with a surgically repaired VSD have a higher incidence of conduction anomalies,
cardiomyopathies and are at greater risk for developing PAH 293,294. The link between structural
and functional anomalies is expected because both develop simultaneously in the embryo 295,296,
and moreover, genes involved in embryo/fetal heart development are critical to homeostatic
control of cardiac function postnatally 203,296,297. Together, this suggests that all CHD, irrespective
of whether they resolve, may predispose an individual to significant functional pathologies later
in life.
The etiology of CHD is not fully understood. Approximately 10-30% of VSD are
estimated to be the result of genetic mutations 298, the remainder are a result of multifactorial
interactions often involving genetic predisposition and/or epigenetic and environmental factors,
including chemical exposures 207. Therefore, we have chosen to induce CHD using in utero
chemical exposure to dimethadione (DMO), the teratogenic N-demethylated metabolite of the
anticonvulsant trimethadione (TMD) 217. The use of DMO as a teratogenic model for the study of
VSDs in rats has several benefits. Firstly, the parent compound, TMD was removed from the
94
market because of its potency as a human teratogen, 215 producing similar effects to those noted in
rodents. Secondly, DMO has been shown to produce a 74% incidence of VSD in the absence of
significant maternal or embryo/fetal toxicity 229. Thirdly, DMO treatment induces both
membranous and muscular VSD, representing the clinical variability in VSD location 229. Lastly,
in utero exposure to TMD in rats produces offspring with a spontaneous VSD closure rate of 80%
postnatally 228, reflecting the clinical rate of postnatal VSD closure 289. Thus, DMO is a reliable
and clinically-relevant tool with which to generate rats born with VSDs that spontaneously
resolve by weaning, allowing us to investigate the postnatal functionality of the heart in the
absence of persistent structural defects.
DMO exposure during a critical window of heart development induces a high incidence
of structural anomalies at parturition 229 as well as in utero deficits in cardiac function 230. DMOexposed fetuses have a delay in closure of the interventricular septum, in addition to a reduction
in cardiac output (CO) and heart rate (HR), and a greater incidence of bradycardia and
dysrhythmia 230. These functional abnormalities persist in fetuses up to 10 days after the final
dose of DMO is administered, suggesting its deleterious effects are long term and perhaps
permanent 230. This prompted the current study to determine if the pathophysiological changes
induced by in utero DMO exposure persist into adulthood and if functional deficits persist in the
absence of structural defects.
95
4.3 Materials And Methods
4.3.1 Animals
Time-mated Sprague-Dawley rats [Crl:CD(SD)] were obtained from Charles River
Laboratory (St-Constant, QC); the morning after copulation was designated gestation day (gd)0.
All rats were housed singly on a 12 hour lights on /lights off cycle (07h00/19h00) and fed
standard rodent chow (Certified Rodent Diet 5001; PMI Nutrition International, LLC, Richmond,
IN), and water ad libitum. When offspring reached six months of age, low (0.6%; diet No. 8746
Teklad; Harlan Laboratories Inc. Indianapolis, IN) and high salt diets (8%; diet No. 5008, Teklad;
Harlan Laboratories Inc. Indianapolis, IN) were fed for one week each to investigate the effects of
salt load on cardiovascular (CV) parameters. Animal usage was conducted under protocols
approved by the Queen’s University Animal Care Committee and in accordance with the
Canadian Council on Animal Care’s Guide to the Care and Use of Experimental Animals.
Prior to dosing, dams were allocated to control (CTL) and DMO treatment groups using
body weight (BW) stratification. Six 300mg/kg doses of DMO (Sigma Aldrich Inc., St. Louis,
MO) (60 mg/ml drug solution) were administered by oral gavage (5ml/kg dose volume), one
every 12 h, beginning at 19h00 on gd8. This dosing regimen has been shown to induce a 75%
incidence of CHD in rats 229. CTL dams received an equivalent volume of distilled water by oral
gavage. DMO-treated (n=6) and CTL offspring (n=8) were obtained from 3 and 2 dams (one dam
was non-pregnant), respectively. Male and female offspring were used for both groups (2 treated
males and 3 CTL males; 4 treated females and 5 CTL females). CTL rats were randomly selected
from a larger cohort, whereas all viable DMO-treated pups were allocated to the study.
96
4.3.2 Radiotelemetry
Offspring underwent surgical implantation of radiotelemetry devices (Data Sciences
International™, St. Paul, MN) at 8 weeks of age by an experienced surgeon, under anaesthetic
(inhaled isoflurane in oxygen). Briefly, an incision was made down the midline of the abdomen
and the abdominal aorta was exposed and clamped just below the renal artery and vein. A 26gauge needle bent at a 90° angle was used to puncture the vessel and the transmitter was inserted
within the intraperitoneal cavity. Rats were given food and subcutaneous fluid supplements (5 –
10ml lactated ringer solution), and an analgesic (Metacam, 1mg/kg, every 24 h) for a minimum of
3 days following surgery. Rats were allowed two weeks recovery prior to telemeter activation, at
which point it was determined that one telemeter in the DMO group did not function, resulting in
5 rats in the DMO group and 8 CTL. Data was collected for 33 consecutive days and included
heart rate (HR), activity levels, as well as systolic and diastolic arterial pressure. The Data
Sciences software used the latter two parameters to automatically calculate mean arterial pressure
(MAP) and pulse pressure (the difference between systolic and diastolic arterial pressure).
Sampling included 30 seconds of continuous data at 12 min intervals. The averages for each
parameter were calculated for every 30 s recording period and these were used to calculate daily
averages for each animal. At six months of age the data was collected for an additional 18 days to
investigate the responsiveness of rats to salt load-induced CV changes and identify if there is
presence of salt-induced hypertension. During this period animals were transitioned in six-day
intervals from normal chow, to low salt (0.6%), then to high salt (8%) diet.
4.3.3 Echocardiography
Rats underwent echocardiographic (Vevo770, VisualSonics, Toronto, CA) examination at
10-12 months of age to assess long-term cardiac structure and function (n=8 CTL, n=6 treated).
97
Anesthesia was induced using 5% isoflurane in oxygen and maintained using 1-2% isoflurane in
oxygen. Animals were placed on a warmed handling platform and limbs fixed on electrode plates
in order to monitor cardiac activity, respiration and ECG recordings. Body temperature was
maintained at 37°C and HR was maintained at 350-425 bpm throughout the study. Hair was
removed from the ventral thorax using an electric razor and hair depilatory cream (Nair; Church
& Dwight Co. Inc, Princeton, NJ). Warmed, ultrasound-conducting gel (Ecogel 100; ECO-MED
Pharmaceutical, Mississauga, Ontario, Canada) was placed between the skin and the transducer
head. Cardiac scans were performed using a 17.5MHz 716 transducer (VisualSonics, Toronto,
Canada) in parasternal long axis (PLAX) and short axis (SAX) at a mid-papillary section in BMode and M-Mode.
Ultrasound data was analyzed post-acquisition using VisualSonicsTM software. The
integrity of the ventricular septum was superficially assessed from a modified PLAX B-mode
scan. The software used M-mode and B-mode traces to calculate both functional and structural
parameters. ECG scans were analyzed quantitatively and qualitatively for irregularities in the
cardiac cycle; using the time scale located on the ECG; the R-R, P-R, and Q-T intervals were
measured manually.
4.3.4 Data analysis
Data analysis was performed using Prism statistical software (GraphPad, San Diego,
CA). To account for large differences in BW both within and between groups echocardiographic
data was normalized to BW. The ratio values were compared between the DMO-treated and the
CTL rats using student’s T-tests. Due to differences in activity levels, the average HR and MAP
were stratified by activity level and analysed by two-way ANOVA with Bonferroni’s post-test.
98
The beat-to-beat data was quantitatively analyzed by calculating the coefficient of variation
for the HR (standard deviation divided by the average HR for 30 seconds of data) at each time
point. Student’s T-test was used to determine differences between the coefficients of variation of
the CTL vs. DMO-treated groups. Furthermore, the beat-to-beat HR data for each time point was
classified as having a normal level of variability or being hypervariable. The HR at any given
time point was defined as hypervariable when the standard deviation was greater than 5% of the
average HR (coefficient of variation > 0.05) 230. Fisher’s Exact Test was used to determine if
difference in the incidence of hypervariability between the CTL and DMO-treated group existed.
99
4.4 Results
4.4.1 Body weight and viability
The long-term postnatal viability of pups following the described DMO treatment
regimen had not been previously described. Offspring survival in the CTL group was near 100%.
Unexpectedly viability of DMO-treated pups was 45% by 12hs and 18% by postnatal day (PND)
14. The cause of lethality is unclear since only a portion of the non-viable pups had heart or
outflow tract anomalies that were incompatible with life. The surviving pups also had reduced
BW compared to CTL (data not shown)
Groups included both male and female rats, which led to substantial differences in BW
within groups. Higher than expected postnatal mortality resulted in an imbalance in males and
females within and between groups. At the termination of the study (1 year) females weighed
between 369-502g and the males weighed between 747-800g,
4.4.2 Activity levels
Activity recordings (obtained using radiotelemetry) were analyzed throughout the initial
33 day study period (beginning at three months of age). The mean cumulative locomoter
activities during rest (light phase) were similar in both CTL and DMO-exposed offspring (Figure
4.1A), but activity levels during active times (dark phase) were significantly higher in the DMO
group (Figure 4.1). A similar trend was noted during the salt-load phase (Figure 4.1C); however,
the increased variance suggests a cohort of animals in which activity levels increased with
advancing age (six months of age).
Activity levels were further analyzed during 48h periods to determine if higher activity
levels were linked to disturbances in diurnal rhythm. Representative depictions are shown for the
middle two days of the first study period (days 14 and 17) and days of peak MAP during high salt
100
Figure 4.1. Activity levels of telemetered rats.
Representative ambulations recorded by radiotelemetry during days 14 through 17 of the 33 day
baseline study (beginning at three months of age) (A,B) and from days 15 to 18 days in the salt
load study (C,D) (six months of age). Data are represented as 2 48hr periods superimposed onto
each other (B,D).The mean cumulative 24 h activity of DMO-exposed rats was significantly
higher than in CTL rats during the more active dark phase (A, C). The mean hourly activity levels
of DMO-exposed and CTL animals responded similarly to light/dark cues (B,D). Values are
mean ± SD. N= 8 CTL, 5 DMO-exposed. Unpaired T-test was used to determine significance for
outcomes with only one variable. ***p≤0.0001.
101
load (day15 and 18). Higher activities were noted in the DMO offspring during the active dark
phase, but there were no significant shifts in the pattern of when rats were active or at rest,
compared to CTL (Figure 4.1 (B,D)). Taken together, these data show that DMO exposure in
utero did not disrupt the diurnal rhythms, but did increase the ambulations during the active dark
phase.
4.4.3 Blood pressure parameters
Differences in average MAP between CTL and DMO-exposed groups did not reach
significance (p=0.15); however, MAP in the DMO-treated group were consistently between 3 – 9
mmHg greater than in the CTL group (Figure 4.2A); a difference which is of biological/clinical
relevance 299. DMO-treated rats had significantly increased pulse pressure versus CTL throughout
the study (Figure 4.2B). The difference in pulse pressure was attributed mainly to a nonstatistically significant trend of increased systolic arterial pressure (SAP) in DMO rats (p=0.092;
Figure 4.2C); diastolic pressure differences between groups were not statistically different
(p=0.19; Figure 4.2D). Higher activity levels in DMO-exposed offspring prompted us to stratify
MAP according to activity level. Under these conditions, MAP in the DMO-treated group was
significantly higher than in the CTL group across all activity levels (p≤0.0001), greatest
differences were observed at activity levels higher than 18 (Figure 4.2E).
Differences in MAP between study groups prompted investigation into the ability to
control MAP under conditions of high dietary sodium load. During the 18d period of low, then
high dietary salt, again the DMO group consistently trended toward higher blood pressure (BP) (>
3 mm Hg) for the entire study period, but this was not statistically significant between the groups
(Figure 4.3A). To assess the relative sensitivities to changes in salt load, the respective changes in
each animal’s MAP were expressed as percent change from baseline MAP (on normal chow)
102
103
Figure 4.2. Postnatal blood pressure recordings obtained using radiotelemetery in offspring
that were exposed in utero to vehicle or DMO.
(Previous Page) There was a trend towards increased mean arterial pressure (MAP) in DMOexposed offspring (A; p=0.15). Pulse pressure was significantly increased over the study period in
DMO-treated vs. CTL rats (B). Systolic pressure in DMO-exposed rats approached a statistical
increase compared to CTL (C; p=0.09), but no such trends were apparent with diastolic pressure
(D). Cardiovascular functional data was stratified based on activity level to account for
ambulation differences between groups, (E and F). MAP was increased in DMO treated rats vs.
CTL over the activity levels recorded (p≤0.0001). HR was also increased in DMO treated rats vs.
CTL over the activity levels recorded (F; p≤0.05). Data represented as mean ± SEM. Differences
determined by Two-way ANOVA with Bonferroni post-test and p≤0.05.
104
Figure 4.3. Changes in mean arterial pressure (MAP) in response to changing dietary salt
loads beginning at six months of age.
Rats were transitioned in six day intervals from standard rat chow to diets containing low (0.6%)
then high sodium content (8.0%). No statistical difference in raw MAP was noted between CTL
and DMO-exposed offspring after consumption of differing salt loads (A). Percentage change in
MAP (relative to the average MAP calculated for each animal during the chow feeding phase)
was calculated (B). At three time points during the high salt load phase (day 13,15,16), the DMOexposed offspring had a significantly increased percent rise in MAP. When MAP was stratified
based upon activity level, the DMO group had a significantly increased MAP, both in low (C)
and high salt load (D). Differences between groups was determined by two-way ANOVA with
Bonferroni’s post-test, significance at p≤0.05.
105
(Figure 4.3B). The CTL group maintained consistent MAP during low salt load and had a 3.5%,
non-significant peak in MAP in response to high sodium load. In contrast, the DMO-exposed
offspring were more sensitive to dietary changes in sodium as evidenced first, by the consistent,
but non-statistically significant decrease in MAP on low salt load (-2.7%). High salt load induced
a 6.8% increase in MAP in the DMO group; differences on specific days reached significance on
day 8 & 10-12 (p=0.01). Stratification of MAP by activity level also revealed significantly higher
MAP in DMO offspring when compared to CTL in response to both low and high sodium load
(Figure 4.3C,D; p = 0.0001 and 0.001, respectively). Interestingly, under conditions of high salt
load and higher activity levels (18-20), several CTL MAP values were elevated (>120 mm Hg)
suggesting that although rare, some CTL offspring were also hyper-sensitive to dietary sodium.
4.4.4 Cardiac functional parameters
No difference in raw HR was observed between the groups or over the 33d experimental
period (Appendix C.1). When stratified by activity level, in utero exposure to DMO significantly
increased HR (p=0.027), and the effect appeared more pronounced at higher activity levels
(Figure 4.2A). Ultrasound was used to ascertain if differences in HR had implications for cardiac
function. Technical difficulties with one CTL rat prevented the acquisition of a clear image, and it
was therefore excluded from this portion of the analyses. There was no significant difference in
stroke volume (SV), ejection fraction (EF) or fractional shortening (FS) between the CTL and
DMO-treated groups after normalization for BW (Table 4.1). Raw CO of the DMO-treated group
was increased versus CTL (p=0.016; Figure 4.4A); however, the broad weight range within and
between groups necessitated normalization of this parameter by BW. Statistical significance was
maintained (p=0.02; Figure 4.4B) suggesting this difference was biologically relevant and not an
artefact due to variances in BW.
106
Table 4.1. Assessment of Cardiac Contractility by Echocardiography
Stroke Volume
Ejection Fraction
Fractional Shortening
(μl)
(%)
(%)
CTL (n=8)
304±73.8
86.0±6.5
58.4±7.8
DMO (n=6)
342±112.8
79.5±8.0
51.4±9.5
p value
0.68
0.37
0.33
Values are mean ±SD
107
Figure 4.4. Cardiovascular function assessed by echocardiography at one year of age.
Raw cardiac output (CO) and CO normalized to body weight (BW) were significantly increased
in DMO-exposed offspring (A,B). The HR hypervariability for each study animal during the
baseline study phase (three months of age) (C). A hypervariable incident was defined as a 30 s
recording that had a standard deviation greater than 5% of the average HR for that animal. DMO
treated animals had a significantly greater number of episodes of HR hypervariability compared
to controls (p≤0.0001). Open circles represent females; closed circles represent males. Unpaired
T-test was used to determine significance for outcomes with only one variable (A-B). Fisher’s
Exact test used to determine differences in incidences of HR hypervariability between groups.
*p≤0.05; ***p≤0.0001.
108
Hypervariability in HR (standard deviation greater than 5% of the mean HR over the 30 second
period) was assessed as a crude indicator of dysrhythmia. There was no difference in the average
coefficient of variation between the CTL and DMO-treated groups, however, a comparison of the
incidence of hypervariability episodes (Figure 4.4C) revealed a significantly greater number of
hypervariable periods in the DMO-treated group. The differences in the mean group incidence of
HR hypervariability were primarily attributable to two treated animals (DMO5 and DMO6), with
incidences of hypervariability of 43.6% and 44.7%, respectively. Telemeter malfunction
prevented this data from being collected from rat DMO4.
4.4.5 Cardiac electrophysiology
The increased incidence of HR hypervariability suggested possible electrical disturbances
in DMO-exposed hearts. To investigate this possibility, ECG readings were obtained when
animals were anaesthetised for echocardiography. There was no significant difference in the
mean R-R, P-R, or corrected Q-T intervals between the CTL and DMO-treated groups (Table
4.2); however, there were readily identifiable qualitative anomalies in the DMO-exposed
offspring (Figure 4.5). The ECGs from the CTL rats were normal (Figure 4.5 (A-H)) with no
distinguishable pathologies. In contrast, ECG recordings from five of the six DMO-treated rats
showed varied abnormalities (Figure 4.5 (I-M)), including: a very flat QRS complex (Figure 4.5
(I-J)) and extreme saw-tooth wave appearance with or without indistinct P and T wave (Figure
4.5 (K-M)). Echocardiographic M-mode images depicting ventricular wall movement with
concurrent ECG tracings underscore the significant pathophysiological impact of the
aforementioned conduction system disturbances (Figure 4.6). In a representative example, the left
ventricular (LV) wall in the CTL heart has a rhythmic pattern of contraction and relaxation that
follows the expected ECG tracing (Figure 4.6A).
109
Table 4.2. Quantitative Assessment of Electrocardiogram Tracing
R-R Interval
P-R Interval
Q-T Interval
(ms)
(ms)
(ms)
CTL (n=8)
178.6±17.8
54.1±3.8
3.1±0.23
DMO (n=6)
193.0±31.2
54.9±9.0
3.3±0.72
p value
0.31
0.85
0.51
Values are mean ±SD
110
Figure 4.5. Representative ECGs of one year old rats exposed in utero to DMO or vehicle
(CTL).
Representative CTL ECGs showing no distinguishable pathologies (A-H). DMO1 (I) had a flat
QRS complex, indicative of reduced electrical activity through the ventricles. DMO2 (J) also had
a reduced QRS complex as well as an unusually large T wave. DMO3 (K) experienced periodic
episodes of premature ventricular contraction. DMO4 (L) and DMO5 (M) depict two different
patterns of saw-tooth p waves.
111
Figure 4.6. Cardiac motion analysis at one year of age by echocardiography.
Representative M-Mode cine loops from echocardiographic scans showing left ventricular wall
motion structure and corresponding ECG pattern (A-B). Normal left ventricular structure and
ECG seen in CTL rats (A), whereas abnormal ECG pattern is accompanied by disrupted wall
motion in a DMO treated rat (B). Left ventricular volume appeared greater in DMO treated rats,
approaching significance (p=0.067) in systole and reaching significance in diastole (C).
Differences between groups measured by Unpaired T-test; *significance of p≤0.05.
112
Contrastingly, in the DMO-exposed heart there are periods of partial relaxation/contraction that
shadow the abbreviated repolarizations in the synchronized ECG tracing (Figure 4.6B).
4.4.6 Cardiac structure
Mean heart dimensions (determined by echocardiography) were analyzed between CTL
and DMO treated rats. After normalizing for BW, the analysis revealed no difference in the
diameter of the LV anterior wall (LVAW) or the LV posterior wall (LVPW) in systole or
diastole, indicating that there was no difference in wall thickness at the location of the probe
(Table 4.3). Similarly, there was no difference in the calculated average wall thickness (Table
4.3). There was a trend towards an elevation in the systolic LV inner dimension in the DMOtreated rats (Table 4.3). LV volume in diastole (normalized to body weight) was significantly
larger in the DMO-treated group versus CTL (Figure 4.6C); and approached significance in
systole (p = 0.067; Figure 4.6C).
The preliminary investigation of the integrity of the interventricular septum in B-mode
revealed no obvious persisting VSDs with the exception one DMO-treated animal, which had a
suspected muscular VSD.
113
Table 4.3. Assessment of Heart Dimensions by Echocardiography.
CTL
LVIDa
LVAWb
LVPWc
(mm)
(mm)
(mm)
Wall
Thickness
(mm)
Systolic
Diastolic
Systolic
Diastolic
Systolic
Diastolic
3.3±1.0
7.9±1.2
3.6±0.69
1.9±0.56
4.1±0.89
2.7±0.93
2.36±0.25
4.5±1.6
9.0±1.6
3.8±0.31
1.9±0.27
3.7±0.58
2.3±0.49
2.44±0.34
0.12
0.18
0.66
1.0
0.32
0.36
0.66
(n=8)
DMO
(n=6)
p value
a
LVID = Left ventricular inner dimension
b
LVAW = Left ventricular anterior wall thickness
c
LVPW = Left ventricular posterior wall thickness
Values are mean ±SD
114
4.5 Discussion
Clinical findings in patients with mutations in genes critical to heart development 203,297,
and experiments in transgenic murine models 202,296,300 demonstrate a clear relationship between
cardiac structural defects and postnatal functional pathologies. Moreover, clinically,
approximately 80% of VSD resolve spontaneously by one year of age 190,301. In a rat model, in
utero exposure to TMD, the parent compound of DMO, resulted in an approximate 50%
incidence of VSD, 80% of which resolved by weaning 228. This led us to hypothesize that VSD
induced by an in utero chemical exposure would provoke functional deficits that persist into
adulthood, even if the VSD resolved by weaning. To test this assertion, we used an established rat
model in which in utero exposure to DMO produces a high incidence of VSD in offspring 229.
The current study demonstrates that in utero DMO exposure is associated with
pathophysiological sequelae of the CV system for up to one year postnatally in offspring.
Moreover, at study termination, only one of six DMO-exposed offspring had a suspected
muscular VSD, indicating that functional defects can occur without gross structural anomalies.
Technical limitations prevented us from assessing the patency of the septum prior to weaning
making it unclear what proportion of DMO-exposed offspring had resolved VSD versus an intact
septum at that time. However, several pieces of evidence suggest that some DMO-exposed rats
did in fact have a resolved VSD. The proteratogen TMD produces resolvable VSD in offspring 228
suggesting that the proximate teratogen, DMO, would act similarly. Despite the 18% survival rate
by PND 14 following DMO exposure, it is unlikely that this is solely the result of CHD, because
in a two hour viability test on gd21 less than half of the fetuses that died had CHD or outflow
tract anomalies (manuscript in preparation). Lastly, using B-mode we identified only one
suspected muscular VSD, which in rat is a rarer and more severe phenotype than spontaneously
115
resolvable membranous VSD. This dosing regimen has previously been associated with a 74%
incidence of VSD 229. Taken together, the weight of evidence supports the presence of resolved
VSD in a cohort of the DMO-exposed rats.
There are two significant implications of our observations. First, that functional
deficiencies of the heart are not always secondary to an existing structural defect, as is the general
perception 302. Second, if translatable to humans, those with resolved VSD may be at higher risk
for CV disease later in life. There is a dearth of literature pertaining to the follow-up of patients
with spontaneously resolved VSDs, in part because it is assumed they require no further clinical
follow-up; our data suggest that these patients may be exposed to insidious risks.
The high mortality rate postnatally was unexpected based on our previous work showing
only minor differences in viability between CTL and DMO-exposed pups at gd21 229. In the
current study only 18% of the DMO-treated pups survived into adulthood (cumulative dose of
1800 mg/kg over 60 h), whereas 75% made it to weaning (PND 21) when administered TMD
228
(cumulative dose 1200 mg/kg in 48 h) indicating that the latter regimen is likely the maximum
tolerated embryo/fetal dose. This observation also underscores the importance of assessing
viability not only at time of necropsy, but also several hours later. A one hour viability
assessment clearly identifies the high postnatal mortality (manuscript in preparation).
Although there have been reports of teratogenic exposures inducing hyperactivity in
offspring, the increased postnatal activity levels in DMO-exposed rats were an unexpected
finding. For example, maternal ethanol consumption in a Dunkin-Hartley guinea pig model
increased spontaneous locomotor activity in offspring 303, an effect that is also found in humans
with fetal alcohol syndrome 304. Due to the approximate 15% decline in BW relative to CTL, it is
116
unclear if hyperactivity is the result of a DMO-specific effect or a more general syndrome
secondary to intrauterine growth restriction (IUGR).
An important observation requiring further investigation is the variability of
pathophysiological outcomes after DMO exposure. Differential susceptibility to VSD may be
rooted in the variable effects of DMO exposure on heart development. ECGs of three DMOtreated rats displayed a saw-tooth p-wave, indicative of excessive atrial activity (atrial flutter or
fibrillation). These types of electrophysiological disturbances have been linked with
misexpression of connexin proteins including cx40 305. Additionally, the ECG of one treated rat
captured an incident of premature ventricular contraction, a pathology seen in loss-of-function
mutations in Nkx2.5, a homeodomain transcription factor critical to heart development 202,306. LV
volume was greater in DMO-treated hearts in diastole, which may reflect insufficient ventricular
relaxation, a condition associated with Holt Oram syndrome and decreased Serca2a expression as
a result of impaired activity of the transcription factor, Tbx5 300. Expression levels of these genes
would be of interest to further elucidate this finding, however, was not measured in this study.
DMO, has direct effects on embryonic ion channels resulting in electrophysiological disturbances
and arrhythmia 307 but it is unknown if this gestational perturbation has life-long implications.
The known links between the functional phenotypes observed postnatally, and disrupted
transcription factor activity suggest in utero DMO exposure may disrupt these pathways.
Ongoing studies are exploring this possibility.
Functional anomalies observed on ECG recordings in DMO-treated animals are
supported by telemetry findings. The DMO-treated rats had more episodes of HR
hypervariability, especially at high levels of activity. Our experimental results appear to be
consistent with clinical data suggesting there is a higher incidence of conduction disease found in
117
patients born with a CHD 293,294. Mice exposed to caffeine in utero exhibit a postnatal reduction in
CO and decreased LV volume 308, whereas the present studies with DMO shows the opposite
effect. The reason for this contrary finding is unclear.
Although there was no statistically significant difference in raw MAP between the DMOtreated and CTL rats, the average MAP of the DMO-treated group was consistently 3–9 mmHg
greater than CTL MAP. A meta-analysis of human populations has demonstrated that an increase
of 3–4 mmHg SAP translates into a 20% higher stroke mortality and a 12% higher mortality from
ischemic heart disease 299, suggesting this increase in MAP is of biological relevance. When MAP
was stratified based upon activity level, differences between CTL and DMO groups were
statistically significant suggesting that under cardiac load the DMO-exposed rats are unable to
compensate sufficiently. To further investigate the elevated MAP in DMO-exposed offspring, rats
were transitioned from normal chow to low sodium, then high sodium diet. The DMO group had
increased sensitivity to salt-induced elevations in MAP and, unlike the CTL animals, also had a
trend toward lower MAP in response to the low dietary salt load. Together this suggests a
possible disruption of the renin angiotensin pathway. It is unclear whether the effects of DMO on
MAP are specific or non-specific. On the one hand, in the rat embryo the pronephros and
mesonephros develop on gd9.5 and 11.5, respectively 309 which corresponds to the DMO dosing
window used in the current study. This suggests that exposure of the kidney anlage to DMO
disrupted renal development. Alternatively, DMO may have mediated its effects non-specifically
via IUGR. For example, a recent study showed elevated BP in offspring of dams exposed to
several different classes of teratogens 310. The SV was slightly increased in DMO-exposed hearts
and unexpectedly, the CO was significantly greater after DMO exposure. Both may be the result
of increased venous return and lead in turn to the observed increase in MAP 253.
118
One limitation of the current study is the small sample size, as a result of unexpectedly
high postnatal mortality in the DMO-exposed group. Nevertheless, radiotelemetry generates very
robust data and previously published rodent telemetry studies have used similar numbers of
animals per group 32,64. Some parameters such as LV volume approached, but did not quite reach
statistical significance, between the study groups. It is possible that a larger sample size may have
permitted differences to be identified, although the inability to detect differences may also be the
result of large variability in the size of the animals as a result of mixing both males and females in
the statistical analysis (recall there were only 2 males in the DMO-treated group). Despite the
varied sample population important differences in CV performance were noted giving confidence
in their biological relevance.
Our observations provide novel and important findings that may be of clinical
significance. We demonstrate that brief chemical exposure in utero produces functional deficits
of the heart and CV system that persist into adulthood in the rat, even in the absence of persistent
gross structural anomalies. Although we were unable to characterize the patency of the
interventricular septum at parturition, based upon our current understanding of the postnatal
outcomes after exposure of embryos to TMD and its teratogenic metabolite DMO, it is very
probable that a cohort of the DMO-exposed rats with no gross structural defects at the termination
of the study were born with VSD that resolved by weaning. This suggests that patients born with
VSD that later resolves may also be at risk for a constellation of heart and CV pathologies that
persist long-term. The molecular pathways underlying environmentally-induced heart pathologies
are largely unknown but the use of this robust DMO-induced VSD model may yield potential
targets for intervention strategies aimed at reducing their incidence and/or severity. This is an
important concern because increased chemical exposure during pregnancy as a result of
119
environmental contamination and pharmaceutical therapy is predicted to cause an increase in the
prevalence of CHD 311.
120
4.6 Acknowledgements
We thank Kim Laverty for excellent surgical support. Rebecca Maciver’s editorial
assistance and the spreadsheet data management of Amy Hilliard and Luka Snider are also
gratefully acknowledged. This work was supported by the following sources: Garfield-Kelly
Cardiovascular Research Fund, Queen’s University Senate Advisory Research Committee
(SARC) Grant, the Faculty of Health Sciences of Queen’s University and the Heart and Stroke
Foundation of Canada.
121
Chapter 5
In utero Exposure to a Cardiac Teratogen Causes Reversible Deficits in
Postnatal Cardiovascular Function, but Altered Adaptation to the
Burden of Pregnancy
122
5.1 Abstract
Congenital heart defects (CHD) are the most common birth anomaly, contributing significantly to
infant mortality; however, the life-long burden on survivors is poorly understood. Embryonic
exposure to dimethadione (DMO) in the rat induces structural defects that resolve by weaning,
mimicking the clinical scenario with ventricular septal defects. In the absence of structural defects
in adulthood, treated rats exhibit functional deficits under increased cardiac load. The effect of
pre-existing CHD on the increased cardiovascular (CV) burden of pregnancy is unknown.
Pregnant rats were administered distilled water or DMO [300 mg/kg on gestation day (gd)9 and
10] and allowed to deliver pups naturally. F1 offspring from treated and control dams were
scanned by echocardiography early postnatally and into adulthood. Radiotelemetry devices were
implanted into females, enabling continuous monitoring of hemodynamics and cardiac
electrophysiology. Females were then mated and scanned by echocardiography during pregnancy.
On gd18 maternal hearts were collected for further structural and molecular assessment. Postnatal
echocardiography revealed numerous differences in treated offspring compared to control; some
of these abnormalities persisted into early adulthood. By 10 weeks of age no differences existed
between treated and control females. Pregnancy revealed differences in cardiovascular function,
cardiac strain and left ventricular gene expression. In utero exposure to DMO also affected the
subsequent generation. Gd18 fetal and placental weights were increased in treated F2 offspring;
however, the ratio of placental/fetal weight was decreased compared to control. This study
demonstrates that teratogenic exposure may permanently alter the capacity of the postnatal heart
to adapt to pregnancy later in life.
Key Words: Congenital heart defect, pregnancy, teratogen, cardiovascular
123
5.2 Introduction
Congenital heart defects (CHD) represent a significant risk for pre and post-natal health
and quality of life, affecting 1.9-7.5% of live births 153. Ventricular septal defects (VSD) are the
most prevalent CHD, encompassing approximately 40% of defects, and with the most sensitive
diagnostic technologies, resulting in a 5% incidence at birth. The exact prevalence of VSD is
unclear due to its range of severity, various co-morbidities and its spontaneous resolution rate 189.
This leads to heterogeneity in treatment strategy as well. In asymptomatic patients with small
defects, a conservative, non-surgical approach is often taken due to the high rate of spontaneous
closure by one year of age 189. Followed long-term, patients with resolved VSDs appear to have
good clinical outcome 312.
The etiology of VSD is poorly understood, but genetic, epigenetic and environmental
factors (including chemical exposures) have all been implicated 313,314. To model the effects of in
utero chemical exposures on heart development, we have studied dimethadione (DMO), the
active metabolite and proximate teratogen of trimethadione (TMD) 217,315; TMD was removed
from market due to its potency as a cardiac teratogen in humans 215. When administered during a
critical window of heart development (gestation day (gd)8.5-11), DMO induces a 65-74%
incidence of VSD 229,316. About 80% of TMD-induced VSD resolves spontaneously by weaning
228
, similar to the rate noted clinically. Thus, TMD/DMO are useful agents to induce a high
incidence of VSD with postnatal resolution in the rat. Our lab has previously established that
dosing rats with 300 mg/kg of DMO every 12 h from gd8.5-11 results in structural and functional
deficits of the fetal heart 230, as well as functional deficits that persist postnatally, regardless of
resolution of the structural defect 317. DMO-induced anomalies included hypertension, increased
cardiac output (CO), higher incidence of arrhythmia and increased activity levels 317. Of interest
124
and of potential clinical significance is how rats with resolved DMO-induced VSD would
respond to a CV stressor or increased cardiac load.
A limitation of the previously described dosing regimen (cumulative dose of DMO 1800
mg/kg over 60 h) was low postnatal viability in treated offspring 317. Shorter duration of DMO
exposure has resulted in higher postnatal viability. Rats administered a cumulative 1200 mg/kg
dose of TMD over 48 h had a 48% incidence of VSD on gd21 yet viability was 73% at weaning
228
. A similar prevalence of VSD was noted using this 48 h dosing regimen with DMO 229.
Together, these data prompted us to conduct the current studies with a cumulative 1200 mg/kg
dose of DMO rather than 1800 mg/kg dose.
Clinically, pregnancy is often referred to as a cardiovascular (CV) “stress test” as it
presents a physiological challenge for the maternal CV system 7. Pregnancy-induced changes to
the maternal CV system include uterine spiral arterial remodeling 11, 30-40% increase in blood
volume, 30-60% increase in CO, and transient cardiac hypertrophy 9,10. The inability to adapt to
the burden of pregnancy may result in major complications of pregnancy (such as preeclampsia
(PE), intrauterine growth restriction or gestational diabetes) that in turn increases the maternal
and fetal risks for postpartum CV disease 6,41. The in utero environment is critical for
programming an individual towards health or disease in the long-term, and this is especially the
case for CV and metabolic disorders 134. This is seen both in epidemiological studies as well as
animal models 72,134,318, although the mechanisms leading to fetal programming are largely
unknown.
We hypothesize that a pre-existing CHD, even if it resolves postnatally, will permanently
render the rat heart more vulnerable to CV stressors. More specifically, resolved DMO-induced
CHD will alter the ability of the maternal CV system to adapt to the stress of pregnancy. This
125
failure to adapt may then lead to subsequent effects on the next generation of offspring. Results of
this study will shed light on the trans-generational effects of cardiac teratogenic exposure.
126
5.3 Materials And Methods
5.3.1 Experimental animals
Pregnant (time-mated) Sprague-Dawley rats were purchased from Charles River
Laboratories (St-Constant, Québec); the morning after copulation was designated gd0. Dams
were selected at random to be in either the treated or control group (n=2/group).
5.3.1.1 Dosing
CHD were induced in offspring by treating dams with four 300mg/kg doses (p.o.) of
DMO (60mg/ml drug solution; Sigma Aldrich Inc., St. Louis, Missouri) every 12 h beginning at
07h00 on gd9. This dose produces a high incidence of VSD (~50%) while simultaneously
allowing for a high postnatal survival (~70%). Control dams were given equivalent doses of
distilled water (5ml/kg volume dose).
5.3.1.2 Animal care during and after pregnancy
Maternal health was monitored throughout pregnancy and dams underwent natural
parturition. Newly born offspring (F1 generation) were monitored (but not handled) to observe
any incidences of neonatal loss. Postnatal body weight (BW) and viability of F1 offspring was
recorded from postnatal day (PND) 2 until weaning. Postnatal BW was standardized according to
previously established correction factors to account for variability in litter size and its effects on
postnatal growth 32,319.
Animals (both P and F1 generations) were housed under standard conditions with a 12-hr
light-dark cycle. All animal work was conducted under approved protocols and in accordance
with Queen’s University Animal Care Committee and the Canadian Council on Animal Care’s
Guide to the Care and Use of Experimental Animals. All experimental procedures are described
in Figure 5.1.
127
Figure 5.1. Schematic representation of study methodology.
Pregnant (F1) Sprague-Dawley dams were administered 4 times by oral gavage either 300mg/kg DMO (treated) or distilled water (control) every
12 hrs beginning at 07h00 on gestation day (gd)9. Dams were allowed to deliver naturally and offspring (F1 generation) were followed postnatally.
On postnatal day (PND) 4 and 21 offspring of both treated and control dams underwent echocardiography to assess cardiac structure and function.
Females were then aged to 8 weeks and implanted with ECG-capable radiotelemetry devices. After recovery and baseline recordings control and
treated females were again assessed by echocardiography prior to being mated. Once pregnant, F1 females underwent echocardiography and fetal
umbilical ultrasound at gd12 and gd18. Females were euthanized after ultrasound scanning on gd18 and tissue were collected for histological and
molecular analysis.
128
5.3.2 Ultrasonography
At various time-points F1 (PND4, PND21 and postnatal weeks 10-12) offspring
underwent high-frequency ultrasound examinations (Vevo770 and Vevo2100, VisualSonics,
Toronto, Canada; Figure 1). All scans, measurements, and analyses were carried out by an
experienced user, as described previously 317,320. Animals were anaesthetized using 5% isoflurane
in oxygen and maintained using 1.5-2% isoflurane in oxygen. Once anaesthetized, animals were
moved onto a heated platform that enabled continuous monitoring of heart rate (HR) and
respiration. Hair was removed from areas of interest using depilatory cream (Nair, Church &
Dwight Co Inc, Princeton, New Jersey) and warmed ultrasound conducting gel (Ecogel 100,
ECO-MED Pharmaceutical, Mississauga, Canada) was placed directly on the skin.
All data were analyzed post-acquisition using VisualSonics software. Cardiac functional
measurements were obtained from parasternal long axis (PLAX) M-mode cine loops at a midpapillary level. All measurements were made in triplicate.
5.3.2.1 Early postnatal scans
Treated and control F1 offspring underwent echocardiographic scanning at PND4 (n=30
and n=41, respectively) and PND21 (n=29 and n=34, respectively); both male and female
offspring were included. For PND4 scans, animals were induced with 3% isoflurane in oxygen
and maintained at 1.5-2%. Limbs were not fixed to the handling platform and no depilatory cream
was necessary. Scanning was done using the VisualSonics 707B transducer (Vevo770 system) or
the VisualSonics MS700 transducer (Vevo2100 system). Scans included PLAX B-mode and MMode cine loops. Length of time under anesthetic was closely monitored with scans lasting 27min in length. At PND21 scans were performed similarly as first described above. Scanning was
129
done using the VisualSonics 707B and MS550S transducers. PLAX B-mode and M-mode cine
loops were collected as well as pulmonary artery PW Doppler.
5.3.2.2 Baseline non-pregnant scans
Baseline scans of virgin adult rats were done on telemetry-implanted (see below for
details) female F1 offspring at 10.5-12.5 weeks of age (n=8 treated, n=8 control). Cardiac scans
were performed using the VisualSonics MS250 probe, as described above for general scans and
PND21 scans. In addition, cardiac strain and strain rate were analyzed using PLAX B-Mode
images and VevoStrain Software (VisualSonics, Toronto, Canada). In short, this software uses
speckle-tracking algorithms in order to detect cardiac wall motion throughout the cardiac cycle,
based on B-Mode cine loops. Cardiac strain and strain rate are sub-clinical measures of cardiac
contractility, wall synchrony and general systolic function 321,322. Measurements of global radial
and longitudinal strain and strain rate were obtained post-acquisition.
5.3.2.3 F1 gestational scans
Pregnant, telemetry-implanted females underwent cardiac and reproductive scans at gd12
and gd18 (n=4 treated, n=5 control). Cardiac scans were performed as described above for virgin
animals. Scanning was then focused on the fetuses; umbilical artery PW Doppler cine loops were
taken from 3-6 fetuses per dam. Peak umbilical flow as well as fetal HR was measured from these
recordings.
5.3.3 Radiotelemetry
Control and treated F1 females (n=5, n=8, respectively) were aged to 8-11 weeks (248312g) and surgically implanted with HD-S21 radiotelemetry devices (Data Sciences International,
St. Paul, Minnesota). Surgery was performed under general anesthetic (inhaled isoflurane in
130
oxygen) by an experienced surgeon. Catheter insertion into the left femoral artery, subcutaneous
implantation of the transmitter on the left flank and post-operative care was carried out as
described by Cotechini et al. 32. Prior to closure of the subcutaneous pouch containing the
transmitter, subcutaneous tunnels were created by blunt dissection in order to facilitate ECG lead
placement over the left subcostal and right pectoral regions. ECG leads were sutured into place
and the skin incisions were stapled closed. Animals were allowed 3-8 weeks for recovery and
baseline recordings prior to mating.
5.3.3.1 Radiotelemetry data acquisition and analysis
Sampling schedule for recordings was set for 5min of continuous recording every 12min
(n=2 control, n=2 treated) or 24min (n=2 control, n=3 treated) and was acquired using Dataquest
Art Software (Data Sciences International, St. Paul, Minnesota). Sampling protocol varied
because of minimal capacity for simultaneous recordings (4) and a larger sample size during the
second set of surgeries. Data are presented as raw 24 h means (00:00 h-23:59 h) for each
gestation day, with the exception of gd0 (recording began after separation from males,
approximately 09:30 h) and gd18 (recording stopped at 10:00 h when animals were removed for
ultrasound and study termination). Further analyses were performed on 6 h night-time means
(22:00 h – 04:00 h) for each gestation day in order to minimize variance due to the stress of room
disturbances during the day (Appendix D.1). Analyses were also performed on data normalized to
baseline values (for each individual animal) in order to determine differences between treated and
control animals in changes from baseline over pregnancy.
131
5.3.4 Mating
After baseline recordings were achieved, treated and control females were mated with
Sprague-Dawley males in a 1:1 ratio. Pregnancy was confirmed by vaginal swab and presence of
sperm in estrous. The morning after copulation was designated gd0.
5.3.5 Tissue collection
Animals were euthanized at gd18 by asphyxiation with carbon dioxide and
exsanguination. Hearts were removed, weighed and micro-dissected by chamber. The LV apex
was flash frozen for molecular analysis while the remainder of the LV was cut in parasternal short
axis and fixed in 4% PFA for histological analysis. The uterus was removed and fetuses as well as
corresponding placentas were weighed. Right tibias were collected and tissue was digested
overnight at 60 °C in 0.2M NaOH. Tibia length was then measured using digital calipers and used
in normalizing heart weight data.
5.3.6 Histological and morphometric analyses
LV tissue was fixed overnight in 4% PFA and then stored in 70% EtOH. Tissue was
processed and paraffin-embedded for sectioning and long-term storage using an automated
processor. Samples were cut at 6μm, stained with Mason’s Trichrome and digitized and analyzed
using Leica Microsystems software (LASV4.4, Switzerland).
5.3.7 Real-time quantitative PCR (RT-qPCR)
RNA extraction was performed on flash frozen LV tissue using a commercial kit,
following manufacturers instructions (RNeasy Mini Kit, Qiagen, Toronto, Canada). All primers
were designed using published GenBank sequences and Primer 3 software. RT was performed
using Life Technology reagents and SuperScript III Reverse Transcriptase protocol (Life
132
Technologies, Burlington, Canada). PCR protocol was from Kapa Biosystems (Wilmington, MA)
using SYBR green (Life Technologies, Burlington, Canada) and run using a Bio-Rad C1000
thermocycler (Bio-Rad, Mississauga, Canada).
Primer sequences and standard curve efficiencies can be found in Appendix D. 2. . All
samples were run in triplicate with Gusb as a housekeeping gene. Analysis was performed using
the delta delta CT method 323,324.
5.3.8 Statistical analyses
All statistical analyses were performed using Prism statistical software (GraphPad, San
Diego, CA). All parameters with only two groups were analyzed using two-tailed Student’s t-Test
(PND4 and PND21 ultrasound data, postnatal BW, gene expression by PCR). F1 virgin and
gestational ultrasounds were analyzed using two-way ANOVA with differences between groups
at each gd determined with Sidak’s post-test. Radiotelemetry data was analyzed using two-way
ANOVA with Sidak’s post-test to identify differences between groups overall and at specific gd.
Two-way ANOVA with Dunnett’s post-test was used to identify gestational differences within
groups from baseline. Statistical significance was considered at p≤0.05.
133
5.4 Results
5.4.1 F1 treated offspring were smaller than age-matched controls.
Both litter size and pup weights were smaller in the treated versus control cohort,
necessitating the use of a normalizing/ litter correction factor. Treated F1 male and female
offspring were smaller than age-matched control offspring from PND2 until PND21 with
differences in BW subsiding by 8 weeks of age in female offspring (Table 5.1). Males were
removed from the study after PND21. Raw BW showed a similar trend; however, by PND16 BW
no longer differed between treatment groups (Appendix D. 3). F1 offspring postnatal viability
differed slightly between treated and control groups, however, viability in treated litters remained
relatively high (86% by weaning) (Appendix D.4).
5.4.2 Early postnatal changes in CV structure and function resolve by adulthood in F1
offspring.
PND4 ultrasounds on F1 offspring revealed both structural and functional differences
between treated (n=30) and control (n=41) groups (Table 5.2). Treated offspring had decreased
cardiac output (CO), stroke volume (SV), HR, fractional shortening (FS) and ejection fraction
(EF) compared to age-matched controls. Treated hearts also appeared smaller with decreased LV
mass, and LV anterior wall thickness. Some of these differences subsided by weaning age
(PND21), yet many differences remained (Table 5.2). CO and SV remained decreased in PND21
treated offspring, despite similarities in HR, EF and FS. Treated hearts remained smaller in
structural parameters versus controls. Raw data separated by litter can be seen in Appendix D. 5
(PND4) and Appendix D. 6 (PND21). Limitations of scanning sensitive PND4 offspring
prevented obtaining pulmonary artery measurements, however, at PND21 pulmonary artery
regurgitation was increased in treated offspring compared to age-matched controls.
134
Table 5.1. F1 Postnatal Weight Gain
Control (g)
Treated (g)
n= 29-42
n= 21-33
2
9.64 ± 1.00
8.53 ± 1.15
< 0.0001
4
13.09 ± 1.42
11.03 ± 1.21
< 0.0001
7
18.34 ± 2.15
15.54 ± 1.58
< 0.0001
10
25.55 ± 2.76
21.44 ± 2.62
< 0.0001
13
32.60 ± 3.46
28.39 ± 3.13
< 0.0001
16
38.77 ± 3.94
36.16 ± 3.77
0.0049
22
61.86 ± 8.88
56.99 ± 3.98
0.0084
282.0 ± 23.37
270.4 ± 17.59
(n=12)
(n=11)
Postnatal Day
p-value
0.1949
8 weeks
Data normalized by a litter correction factor to account for differences in postnatal weight gain
due to differences in litter size. Data are presented as mean ± standard deviation. Both male and
female offspring were included in all time-points except 8 weeks.
135
Table 5.2. Postnatal Cardiac Function and Structure in F1 Offspring by Echocardiography
PND4
Control
n= 41
60.8 ± 1.7
Treated
n= 30
48.3 ± 1.6
PND21
p-value
Control
n= 34
185.6 ± 7.7
Treated
n= 29
150.4 ± 5.3
p-value
< 0.0001
< 0.001
LV Mass
(mg)
1.2 ± 0.03 1.0 ± 0.03
0.0013
1.5 ± 0.06
1.2 ± 0.05
< 0.001
LVAW;s
(mm)
0.8 ± 0.02 0.7 ± 0.02
< 0.001
0.9 ± 0.03
0.8 ± 0.02
0.023
LVAW;d
(mm)
< 0.001
393.9 ± 6.6
385.1 ± 9
0.43
Heart Rate 315.7 ± 5.9 283.5 ± 7
(BPM)
Cardiac
10.2 ± 0.3
8.3 ± 0.3
0.003
36.9 ± 1.7
31.6 ± 1.3
0.02
Output
(ml/min)
32.0 ± 0.8 29.2 ± 0.9
0.017
94.3 ± 3.7
84.2 ± 3.1
0.047
Stroke
Volume (μl)
Ejection
82.1 ± 0.7
77.6 ± 1
< 0.001
76.6 ± 1.2
75.0 ± 0.9
0.29
Fraction
(%)
Fractional
50.0 ± 0.8 45.3 ± 0.9
< 0.001
46.2 ± 1.2
44.2 ± 0.8
0.19
Shortening
(%)
NA
NA
NA
116.8 ± 10.9 163.1 ± 10.6
0.0044
PA regurg.
(mm/s)
PND = postnatal day, LVAW;s = Left ventricular anterior wall diameter in systole, LVAW;d =
Left ventricular anterior wall diameter in diastole, PA regurg. = pulmonary artery regurgitation.
Grey highlights represent significant differences. Data are presented as mean ± SEM.
136
After surgical implantation of radiotelemetry devices and recovery, females were again scanned
by echocardiography (10-12 weeks of age). No statistically significant differences between virgin
treated and control rats were observed in any parameter measured, suggesting complete resolution
of CHD by adulthood (Table 5.3); although there was a decrease in LV mass in treated females
that approached statistical significance (p=0.089).
5.4.3 Pregnancy revealed functional differences between treated and control dams.
Gestational echocardiography revealed several differences between control rats and rats
that were exposed to DMO in utero. CO was increased in treated dams versus control dams
across gestation, with gestation-day specific differences reaching significance at gd12 (Figure
5.2A). Despite differences in CO, treated dams did not differ from controls in SV across
pregnancy (Figure 5.2B). Cardiac strain analysis was not able to detect differences in radial and
longitudinal strain between treated and control hearts (p=0.73, p=0.66, respectively). However, an
interaction effect between gestation and treatment group was present in radial strain data
(p=0.025; Figure 5.2C). Longitudinal strain was also influenced differently across gestation in
treated and control rats; however, the interaction effect did not reach significance (p=0.061;
Figure 5.2D).
5.4.4 Radiotelemetric recordings revealed changes in the maternal hemodynamic response
to pregnancy between treated and control dams.
Baseline mean arterial pressure (MAP) (prior to mating) did not differ between control
and treated rats. Raw MAP (Figure 5.3A) also did not differ between control and treated dams
throughout pregnancy. Both groups underwent dynamic changes in 24hr average MAP across
gestation, as expected from previous literature on blood pressure in rodent pregnancy 31,32. Only
control rats reached a statistically significant nadir from baseline at gd11. Qualitatively, control
137
Table 5.3. Baseline (10 weeks of age) Cardiac Function and Structure by Echocardiography
in Virgin F1 Females
Virgin (10 Weeks)
Control
Treated
p-value
n=8
n=8
LV Mass (mg)
676.9 ± 32.6
599.3 ± 27.2
0.09
LVAW;s (mm)
3.7 ± 0.2
3.8 ± 0.2
0.84
LVAW;d (mm)
7.7 ± 0.2
7.7 ± 0.1
0.95
Heart Rate (BPM)
372.2 ± 11.2
399.5 ± 11.6
0.11
Cardiac Output (ml/min)
96.1 ± 5.6
100.8 ± 3.3
0.49
Stroke Volume (μl)
259.2 ± 16.0
253.8 ± 10.5
0.78
Ejection Fraction (%)
81.1 ± 1.9
80.0 ± 2.5
0.74
Fractional Shortening (%)
51.8 ± 2.0
50.9 ± 2.7
0.79
207.3 ± 20.6
215 ± 27.6
0.83
Pulmonary artery
regurgitation (mm/s)
PND = postnatal day, LVAW;s = Left ventricular anterior wall diameter in systole
LVAW;d – Left ventricular anterior wall diameter in diastole. Data are presented as mean ±
SEM.
138
Figure 5.2. Cardiovascular function in control and treated F1 offspring prior to and during
pregnancy, as assessed using echocardiography.
Cardiac function was calculated using standard M-mode LV trace measurements (A-B) and by
strain and strain rate analyses using B-Mode cine loops and VevoStrain software (C-D). Cardiac
output changed in a gestation day-dependent manner and was significantly increased in treated vs
control dams on gd12 (p=0.03; A). Gestation had a significant effect on stroke volume as well,
but no differences were seen between control and treated groups (B). No significant effect of
gestation or treatment was found in longitudinal LV strain; there was an interaction effect that
approached significance (p=0.06; C). Similarly, an interaction effect between gestation and
treatment group was observed on radial strain (p=0.02); no differences between groups were
observed (D). Significant differences considered at p≤0.05 (*).
139
Figure 5.3. Cardiovascular and hemodynamic parameters measured by radiotelemetry.
Cardiovascular and hemodynamic changes in treated and control dams over pregnancy were
measured using radiotelemetry and data are represented as average of 24hr means from each
animal (A-F). No overall significant differences between groups were observed in raw values in
any parameter. Several differences were observed across all parameters in changes from baseline
at various gestational time-points. Effects of treatment and gestation determined by two-way
ANOVA. Differences between groups at specific gestation days determined by Sidak’s post-test,
differences within groups at specific time-point from baseline determined by Dunnett’s post-test.
Horizontal solid line represents the average 4 day (pre-pregnancy) baseline for the treated group.
Horizontal dashed lines represent 4 day (pre-pregnancy) baseline for control animals. # represent
significance in the control group from baseline, * represents significance in the treated group
from baseline. * or # = p≤05, ** or ## = p≤0.01, *** or ### = p≤0.001.
140
rats remained at or below starting baseline MAP whereas treated rats often had MAP above
starting baseline values. Treated rats showed a significant decrease from baseline only very late in
gestation (gd18). Differences in MAP were mainly attributed to variations in systolic arterial
pressure (SAP). Baseline values were not different between control and treated dams. Gestation
had a significant effect on SAP but no differences existed between groups overall or at any
gestation day (Figure 5.3B). SAP in the control group reached a statistically significant nadir
from baseline at gd10 and gd11, but the nadir did not reach statistical significance in treated
dams. Instead, a significant drop in SAP was seen late in pregnancy (gd17) in the treated group,
while SAP in controls appeared to remain stable or increase towards baseline. Similar to MAP
and SAP, baseline diastolic arterial pressure (DAP) did not differ between control and treated
females; there were also no differences between groups throughout gestation (Figure 5.3C).
Unlike MAP and SAP, DAP did not reach a statistically significant mid-gestational nadir in either
group. Similar to SAP, DAP was decreased from baseline late in gestation (gd18) only in the
treated group. Pulse pressure did not differ at baseline between control and treated dams. Pulse
pressure was dynamic across gestation; control rats had decreased pulse pressure (from baseline)
at gd10, whereas treated rats showed no differences from baseline on any gd (Figure 5.3D). HR
did not differ between groups at baseline or over the gestational time-points measured (Figure
5.3E). However, when HR was sub-analyzed as 6hr nightly means (to remove daytime variability
due to in-room disturbances), treated rats had significantly higher HR versus controls at baseline
(Appendix D.1). Differences between groups across gestation were also significant only during
6hr night-time data when normalized to baseline (delta HR). Delta HR over gestation was
decreased in treated rats versus controls (p=0.05), reaching significance specifically at gd14
(Appendix D.7). When HR data was analyzed within groups, an increase from baseline in 24hr
141
raw HR was seen early in pregnancy (gd6) only in the control group, whereas both control and
treated groups had increased HR from baseline on the last day of pregnancy measured (gd18).
Further differences in 6hr HR from baseline were seen, with increased HR in control rats in midlate pregnancy (gd13 and gd14; Appendix D.1). Activity levels of control versus treated females
were neither different at baseline nor different across gestation. Analysis within groups from
baseline revealed decreased activity in only treated dams at mid-gestation (gd8-10) and late
gestation (gd15-17) (Figure 5.3F). When activity was transformed to reflect a change from
baseline, pregnant treated rats had reduced activity levels versus control (Appendix D.8).
5.4.5 Despite differences in CV function over pregnancy, treated hearts were not
structurally different from control hearts.
Echocardiography, cardiac and chamber specific wet-weight and cardiac histology
revealed no differences in cardiac structure between treatment groups. (Figure 5.4).
Echocardiography on gd12 and gd18 showed similar gestation-induced fluctuations in LV mass
in treated and control dams, with no significant differences between groups (Figure 5.4A). Gd18
LV and whole heart wet-weight also did not differ between control and treated dams (Figure
5.4B-C). These results were confirmed by morphometric analyses of Mason’s Trichrome stained
gd18 hearts; no visual (Figure 5.4D-E) or measureable differences (data not shown) were
observed between groups.
5.4.6 LV gene expression analysis revealed subtle differences in expression of genes related
to the hypertrophic response in treated hearts.
LV gene expression was measured by RT-qPCR in snap frozen samples taken from gd18
treated and control maternal hearts. Jumonji, ATP rich interactive domain 2 (Jarid2) expression
was increased in LV tissue in gd18 treated versus control rats (p=0.02; Figure 5.5A). Treated LV
142
Figure 5.4. Cardiac structure on gd 12 and 18 of pregnancy.
Cardiac structural differences were assessed using echocardiography from M-mode images (A),
as well as cardiac and chamber wet-weights at euthanasia (B-C) and cardiac histological and
morphometric measurements (D-E). Wet-weight measurements were normalized by right tibia
length in order to account for variances in body weight due to pregnancy (B-C). Pregnancy had a
similar significant effect on LV mass in both treated and control dams during gestation. There
were no differences between treated and control groups overall or at any specific gestational timepoint (A). No differences were seen between gd18 treated and control dams in normalized LV
mass (B) or normalized heart weight (C). No differences in Mason’s Trichrome stain were seen
between control (D) and treated (E) left ventricles. Two-way ANOVA with Sidak’s post-test was
used to determine differences in LV mass over gestation and between groups (A). Unpaired
Student’s t-test was used to determine differences between control and treated hearts at gd18 only
(B-E). Significant differences considered at p≤0.05.
143
Figure 5.5. Left ventricular gene expression in hearts of treated versus control F1 dams
during pregnancy.
Expression of genes pertinent to cardiogenesis and the cardiac hypertrophic response were
measured in snap frozen LV tissue from gd18 dams by RT-qPCR. Jarid2 expression was
decreased during F1 pregnancy in DMO treated versus control hearts (p=0.02) (A). Expression of
Nppa was greater in treated versus control hearts (B) although this did not reach statistical
significance (p=0.06). The expression of both Vegf and Vegfr in the LV appeared to be decreased
in the treated versus the control group (C,D), but this did not reach statistical significance
(respectively, p=0.14 and p=0.06). Differences between groups determined by unpaired
Student’s t-test, significance determined at p≤0.05 (*).
144
tissue also had increased Nppa expression in pregnancy versus control, however, this change did
not reach statistical significance (p=0.06; Figure 5.5B). Both VegfA and Vegfr1 expression in
treated LV showed non-statistically significant decreases in expression compared to controls
(p=0.14, p=0.06 respectively; Figure 5.5C-D). Expression levels of several other pertinent genes
(Nkx2.5, Tbx5, Gata4, Serca2a, Cx40, Myh6, Myh7, Nppb and Per2) were also measured,
however no differences were seen between groups (Appendix D. 2).
5.4.7 Maternal CV changes in F1 treated dams were linked with differences in F2
generation fetuses.
F2 offspring were studied at gd12 and gd18 by ultrasonography. Fetal HR significantly
increased with gestation in both treated and control pregnancies; however, there were no
differences between groups at either time-point (Figure 5.6A). Similarly, peak umbilical artery
flow velocity increased with gestation in both groups but did not differ between treated and
control pregnancies (Figure 5.6B). Fetuses and placentas were also weighed when dams were
euthanized (gd18). Despite the lack of differences in fetal blood flow, gd18 fetuses from treated
dams were significantly heavier than age-matched fetuses from control dams (p≤0.0001; Figure
5.6C). F2 generation gd18 placentas from treated dams were also significantly heavier than gd18
placentas from control pregnancies (p≤0.0001, Figure 5.6D). The gd18 placental to fetal weight
ratio was decreased in treated pregnancies versus controls (p=0.03; Figure 5.6E).
145
Figure 5.6. F2 generation fetal parameters.
Fetal heart rate and umbilical artery peak flow velocity was measured using high-frequency
ultrasound at gd12 and gd18 (A-B). Gd18 fetal and placental wet-weights were measured at
euthanasia from all fetuses of treated and control F1 females (C-E). Fetal heart rate exhibited
gestation-dependent effects, but was not different between treated and control groups (A).
Similarly, umbilical artery flow velocity changed in both groups over gestation but was
unchanged between treated and control groups (B). Gd18 fetal weight (C) and placental weight
(D) was greater in treated versus control F2 offspring (p<0.0001 for both C and D). The ratio of
fetal to placental weight (E) showed a decrease in fetuses carried by treated dams relative to
control dams (p=0.035). Differences in fetal heart rate and umbilical flow (A-B) between groups
and different gestation days was assessed by two-way ANOVA with Sidak’s post-test.
Differences in wet-weights (C-E) between groups was determined by unpaired T-test.
Significance was determined at p≤0.05 (*), ***p≤0.0001.
146
5.5 Discussion
The anticonvulsant TMD was removed from the market, in part, because of its potency as
an inducer of CHD 215. Since then, many investigators have used TMD and its active metabolite
DMO, as a tool to experimentally produce malformations of the heart in animal models in a dose
and time-dependent manner 228,229,316,320. Here, we have used DMO to study the long-term
postnatal consequences of CHD, a subject sparsely studied. In our model, in utero exposure to
DMO during cardiac development elicited significant deficits in postnatal CV structure and
function. Our present study identified significant structural and functional differences that were
most profound on PND4, with a slight decrease in incidence and severity at weaning, but that did
not fully resolve until PND70. If translatable to humans, it suggests that even if major structural
malformations resolve by one year of age (equivalent to weaning in rats), there may be insidious
functional deficits that persist long-term. Also troubling was our observation that under basal
conditions control and treated rats had similar CV function, yet under the CV burden of
pregnancy differences in cardiac performance reemerged. This indicates there may be long-term
unrecognized CV risks to those with resolved major malformations that manifest only under CV
stress.
Previous studies have shown that fetal exposure to DMO causes long-term changes to
fetal cardiac function until gd21 (10 days after administration of the last dose of DMO) 230.
Moreover, DMO-induced changes to CV function were evident at one year of age even in the
absence of persistent gross structural anomalies such as VSD 320. The aforementioned studies
used a dosing regiment that resulted in peak DMO serum concentrations of between 1245 and
1850 g/ml, with a mean value of 1560 ± 207 g/ml (mean ± SD) (Ozolinš et al, submitted). This
is slightly above the human therapeutic concentration of 500-1200 μg/ml 325. The present study
147
administered 66% of the total dose used in our previous studies and we expect the peak serum
concentrations to be approximately 900 μg/ml, in the mid-therapeutic concentration range. This
dosing regimen was embryotoxic as evidenced by the decreased raw (uncorrected) BW in DMOexposed pups that persisted until PND13, after which there were no differences between groups.
After normalizing by litter number correction factors 32,319, postnatal BW remained significantly
decreased versus controls until adulthood (8 weeks). Lack of differences in raw BW late
postnatally are attributed to differences in litter size between groups (some control litters were
very large) and competition and availability for nourishment 319.
Using a similar dosing regimen of TMD, others have tracked the postnatal closure of
VSD in rats and demonstrated that about 80% of the VSD had resolved by weaning 228. This
reflects the estimated 75-80% of VSD that close by one year of age in infants 190,312. Our findings
examining subtle yet equally important structural and functional endpoints, confirm resolution of
defects by adulthood rather than weaning. Clinically, infants born with a VSD that spontaneously
resolves by 1 yr of age are generally thought to have good long-term clinical outcomes 190,312. In
contrast, one study following patients with spontaneously resolved VSDs found increased
incidence of cardiac complications and increased mortality versus age-matched controls 326.
Taken together, these studies suggest there is a general lack of understanding about the long-term
risks to infants with resolved CHD. No studies could be found looking at general CV function as
opposed to hard surgical or mortality end-points. Follow-up may also not have been long enough
to detect clinically relevant CV outcomes that may only become evident with old age or under
cardiac stress.
The paucity of data pertaining to the clinical outcomes after spontaneously resolved CHD
312,326
is worrisome because our studies in rat suggest CHD might predispose women to CV
148
dysfunction or complications during later pregnancy. In other cases, pregnancy has unmasked
formerly undetected heart disease in patients 18. Our results indicate that exposure to a chemical
teratogen and the presence of VSD at birth may affect the capacity of the maternal CV system to
adapt to pregnancy, regardless of resolution of the defect and absence of symptoms or deficits
under normal conditions in adulthood.
Previous work in mice identified a consistent gestational blood pressure (BP) profile with
5 characteristic phases of pregnancy, based on normal physiological and anatomical processes 31.
A similar gestational MAP profile has been seen in Wistar rats, with a mid-gestational nadir in
pressure as a landmark feature 32. Results presented here with control Sprague-Dawley rats show
an identical gestational MAP profile to that seen in normal, pregnant Wistar rats 32, indicating that
this gestational profile may be conserved in rodentia. This general pattern of blood pressure (BP)
fluctuations are also seen in healthy human pregnancies, characterized by a mid-gestational nadir
and an increase in pressure to term 18. F1 dams previously treated with DMO in utero did not
display a similar statistically significant nadir in MAP from baseline at gd11, as seen in normal
rats. Similarly, a mid-gestational drop in SAP and pulse pressure was only seen in control rats.
Instead, significant drops in MAP and DAP were only noted on gd18, a time point with a
truncated data collection period because the study was terminated at 9:30am. Clinically, HR is
increased in normal pregnancy 18, which is also seen in control rats after normalization to
baseline. Changes from baseline HR are significantly increased in control rats versus treated rats,
reaching significance at gd14 when analyzing night-time data only (Appendix D.4). This suggests
failure of maternal HR to increase during pregnancy in treated rats. Interestingly, treated dams
have an exaggerated increase in CO during pregnancy compared to control, however, this
difference does not reach significance for SV. Increased HR in treated rats at baseline may
149
explain this seemingly paradoxical effect on HR and CO, since there were no differences in raw
HR between groups during pregnancy. Differences in the CV and hemodynamic adaptations to
pregnancy in treated dams were not accompanied by differences in cardiac structure versus
controls. This may indicate that changes in cardiac function were not pronounced enough to
translate into changes in structure. Together, these outcomes demonstrate that previously resolved
CHD is linked to a maladaptive response to the CV burden of pregnancy with possible
detrimental effects on progeny outcome.
Previous studies using higher doses of DMO revealed that treated offspring had higher
activity levels than age-matched controls 317. Here, using a lower dose of DMO, no differences
were seen between groups in pre-pregnancy, but gestation-induced changes from baseline were
significantly different; treated F1 dams had decreased activity versus controls.
Jarid2 is a member of the Jumonji family of proteins; functional mutations of Jarid2
during development lead to severe CHD, including VSD 327. In the adult heart, Jarid2 is
negatively regulated by microRNA-155 (miR-155) in the hypertrophic pathway 328. In response to
cardiac pressure overload, diminished miR-155 preserves cardiac function and represses the
hypertrophic and fibrotic responses by allowing for increased Jarid2 expression 328. The decreased
expression of Jarid2 in treated rats during pregnancy did not lead to hypertrophy or fibrosis
during pregnancy, suggesting that the pregnancy-induced CV burden may differ from other forms
of CV stress. It is also possible that this effect is mitigated by a decrease in angiogenic factors
(which would repress hypertrophy) 329; recall treated rats had decreases in Vegf and Vegfr1
expression that approached statistical significance.
Jarid2 expression has also been linked to suppression of ANP 328. Therefore, the
decreased levels of Jarid2 in treated rats may be mechanistically linked with the almost
150
statistically significant increase in Nppa (the gene encoding ANP) expression in the treated dams.
Increases in ANP occur during normal pregnancy and postpartum due increased blood volume
and its role in blood volume homeostasis and diuresis 330. Unexpectedly, in clinical cases of PE,
which is associated with volume depletion, ANP levels are abnormally elevated. The degree of
elevation of ANP in PE patients has been correlated with the degree of LV dysfunction 331.
Increased levels of Nppa in treated rats during pregnancy may, therefore, also suggest some level
of LV dysfunction. Elevated Nppa and the concomitant exaggerated increase in CO (due to the
Frank Starling effect 253) could also be the result of increased blood volume (which would result
in increased myocyte stretch and contractile strength), however, this was not measured.
Pre-existing CV disease is a risk factor for development of pregnancy complications 42.
Occurrences of pregnancy complications are strongly linked with increased maternal and
offspring risk for CV and metabolic disease 6,332. The latter is in part attributed to altered
intrauterine environment leading to fetal developmental programming. The Barker hypothesis
explains that placental development and the intrauterine environment can predict development of
adult CV disease and diabetes in offspring 333,334. Both extremes of fetal/newborn BW
(macrosomia or growth restriction) are linked with maternal pregnancy complications and
offspring CV disease later in life 5. Here, treated dams had an altered CV response to pregnancy,
and although there were no differences in utero-placental blood flow or F2 fetal HR, fetuses and
placentas were both significantly heavier at gd18 compared to control F2 offspring. Altered
placental weight and macrosomia in offspring are seen in cases of gestational diabetes 5,
indicating that F1 dams may have some metabolic abnormalities as well; this is the subject of
future studies.
151
In summary, this study demonstrates that CHD even if resolved may lead to long-term
persistent cardiac dysfunction. Altered in utero heart development caused a maladaptive response
to pregnancy, a potent CV stressor. Clinically, this suggests the need for more long-term studies
on patients with resolved VSD, to determine their CV risk when subjected to CV burden,
including pregnancy. DMO may be a useful tool to generate resolvable CHD to experimentally
test intervention strategies aimed at mitigating the long-term CV risk associated with resolved
CHD.
152
5.6 Acknowledgements
We thank Kim Laverty for her surgical and technical expertise as well as Dr. Andrew Winterborn
and Dr. Janine Handforth for advice and surgical assistance and consultations. We acknowledge
Dr. Tiziana Cotechini for advice relating to study design, experimental procedure and analysis.
This work was supported by the Heart and Stroke Foundation [to M.A.A.]; Canadian Institutes
for Health Research [to M.A.A.]; and Ontario Centers of Excellence Medical Sciences Proof of
Principle Grant [grant number 20656 to T.R.S.O. and S.R.].
153
Chapter 6
General Discussion
154
6.1 Overall Summary
The adaptive responses of the maternal cardiovascular (CV) system to the hemodynamic
demands of pregnancy are integral for pregnancy success, as well as immediate and long-term
health of the mother and offspring. Failure of the maternal CV system to adapt properly in any
way can have negative consequences on both parties. For example, pregnancy complications,
such as preeclampsia (PE), intrauterine growth restriction (IUGR) and maternal diabetes, pose a
risk for mother and fetus and are associated with a variety of impairments to maternal CV
adaptations 1,2,40,335. Most notably, failed remodeling of the maternal spiral arteries (SA) has been
observed in all of the aforementioned pregnancy complications and is implicated in the aberrant
effects on the fetus, primarily through diminished uteroplacental blood flow 21,336-340. In turn, poor
uteroplacental blood flow is linked to development of an adverse intrauterine environment, which
through changes in fetal programming, increase the risk for adult onset CV and metabolic
diseases 57,72,136. More disturbingly, these high-risk pregnancy conditions contribute to a vicious
cycle of CV and metabolic disorders that are self-perpetuating across generations. Insomuch as
the presence of obesity, diabetes or other metabolic disorders increases the risk for developing PE
during pregnancy 4; there is also a very strong correlation between PE and IUGR in the offspring
341,342
. In turn, offspring of diabetic, PE or IUGR pregnancies are at higher risk for CV or
metabolic disorders into adulthood 57,136, thereby, being at higher risk for developing pregnancy
complications themselves later in life.
The work in this thesis, along with a concert of other studies in the field, emphasizes the
importance of CV adaptations in pregnancy 9,343. This is evidenced by the altered CV profiles
observed during pregnancies complicated by preexisting maternal diabetes, deficient placental
growth factor (PGF), or resolved congenital heart defect (CHD). Here we provide evidence that
155
maternal cardiac structure and function are altered during pregnancies complicated by diabetes in
a murine model (Chapter 2). These altered adaptations are characterized by a blunted increase in
cardiac output (CO) and left ventricular (LV) mass, with hypertrophy resembling a pathological,
eccentric phenotype. Evidence of glomerular abnormalities were also observed, again
corroborating previously observed alterations in maternal blood pressure (BP) 64. Together, the
aforementioned maternal deficiencies were linked with fetal deficiencies in heart rate (HR) and
umbilical blood flow. This substantiates previous work from the lab demonstrating that SA
remodeling is delayed and maternal pregnancy-induced hemodynamics are altered due to diabetes
progression in the nonobese diabetic (NOD) mouse 64,68. This aberrant maternal response to
pregnancy may have long-term implication and, therefore, may also be relevant to the CV risk
experienced by women with hyperglycemia both during gestation and post-partum.
In pregnancies complicated by PE are associated with aberrant maternal CV
consequences as well as differences in maternal plasma levels of growth factors 79,84,231. This
altered expression profile is suspected to have a role in the pathogenesis of the disorder, however,
to what capacity has not been definitively proven. It is likely that imbalance of these angiogenic
and antiangiogenic factors contributes to the abnormalities in uteroplacental blood vessels and
deviations in SA remodeling 104. Work in Chapter 3 suggests that this imbalance may also be
influencing other maternal CV adaptations as well. PGF is known to have cardioprotective roles
in certain disease states 127,129,130 and results presented in this dissertation suggest a similar
protective function during pregnancy. For example, the absence of PGF during pregnancy in the
mouse results in an altered BP profile, deficient augmentation in systolic function and an
abnormal cardiac hypertrophic response. Expression levels of nitric oxide synthase (NOS) genes
are upregulated in pregnant Pgf-/- murine hearts, which is postulated to be a compensatory
156
response to the absence of PGF. Associated with the aberrant BP response, kidney weight was
increased in knockout pregnant females compared to controls and there was evidence of
glomerular pathologies in Pgf-/- dams. Absence of PGF also affected uterine artery blood flow and
resulted in decreased fetal weights. Diminished weights in Pgf-/- offspring did not persist
postnally; this may be indicative of catch-up growth, and fetal programming. Further studies
using PGF reconstitution would be required to prove that PGF is mechanistically linked to the
pregnancy-induced changes in the heart. If diminished PGF was causally linked to the
pathological maternal CV response that occurs during PE pregnancies, or the CV risks
experienced thereafter, it might be a pharmacologic target for therapeutic intervention.
Amongst several other risk factors, pre-existing CV disease or CHD increases the
likelihood of pregnancy complications such as gestational diabetes, IUGR or PE 42. The most
prevalent CHD at birth are ventricular septal defects (VSDs), of which 80% resolve
spontaneously and are not known to be associated with any long-term sequelae 189,190. Results
from Chapter 4 demonstrate that high-dose, chemically induced VSD in the rat results in
significant differences in CV function that persist well into adulthood in surviving offspring
despite postnatal resolution of the structural defect, These included profound conduction system
abnormalities while anesthetized, increased periods of HR hypervariability, clinically relevant
increases in mean arterial pressure (MAP) and significant differences in cardiac function (Chapter
4).
The chemically induced VSD model employed in Chapter 4 utilized a dimethadione
(DMO) dosing regimen that resulted in high postnatal mortality. To ensure a vastly improved rate
of postnatal survival and reflect more clinically relevant blood concentrations of DMO, a
different dosing regimen was used for Chapter 5. Several key observations were made. In relation
157
to outcome in progeny after in utero exposure to DMO, neonates and weanlings exhibited
profound differences in multiple measures of cardiac structure and function and these differences
resolved by adulthood. Although there were no discernable alterations in CV function under basal
conditions, latent differences emerged when animals were challenged by pregnancy. In adulthood
there were no differences in cardiac structure (including no persistent VSD), however, alterations
in CO, global cardiac strain and LV gene expression were observed in F1 offspring of treated
versus controls rats over pregnancy. Noteworthy was a failure for treated dams to achieve a midgestational nadir in MAP, which is characteristic for normal pregnancy in both mouse and rat
31,32
. Of interest would be if this difference in BP profile was reflective of deficient or delayed SA
remodeling, a characteristic of many known pregnancy complications; however, this remains to
be elucidated. Umbilical artery blood flow was similar between treated and control pregnancies in
both peak flow velocity as well as fetal HR. No conclusions can be made about total blood flow
to the fetuses, as umbilical artery diameter would be needed for these calculations. Therefore,
there may be some difference in total blood flow to the fetus at some point during gestation,
undetectable by peak flow velocity. Other gestational time-points would also need to be studied
to ensure there is no evidence of altered fetal-placental blood flow. Interestingly, despite
discovering no differences in fetal HR or umbilical flow velocity, near term (gestation day
(gd)18) fetuses from treated dams were significantly larger than those of control dams. It is
unknown if this is a consequence of maternal CV maladaptations, or perhaps an undetected
maternal metabolic condition 69,344. The metabolic status of dams with previous VSD or other
CHD in general is unknown, but this may be of clinical relevance.
158
6.2 Maternal cardiovascular adaptations in pregnancy and pregnancy success
The physiological adaptations of the maternal CV system during pregnancy are very well
characterized not only in humans but in murine, rat and other animals as well 8,9,31-33,35. The
mechanistic underpinnings of these adaptations are also well understood. For example, systemic
vascular resistance (SVR) decreases in pregnancy due to increased vasodilation (mediated by
hormones such as progesterone, prostaglandin 345 and relaxin 346 as well as increased nitric oxide
(NO) 347) and remodeling of uterine vasculature into lower resistance vessels 18. Decreased
vascular sensitivity to vasoconstrictors also contributes to the decreased SVR observed in normal
pregnancy 17,18. Blood volume increases across gestation mainly due to hormone-induced
increases in the renin-angiotensin system (RAS) system (estrogen increases production of both
renin and angiotensinogen), leading to increased sodium and water retention and, therefore,
increased plasma volume. The diuretic and vasodilatory hormones ANP and BNP are also
increased systemically in pregnancy, contributing to increased blood volume 330,348. Despite
extensive knowledge characterizing these pregnancy-induced changes, studies investigating the
effects of inadequate adaptations of the maternal CV system are sparse. Although the studies
presented in Chapters 2, 3 and 5 contribute to our understanding of the importance of CV
adaptations in both complicated and uncomplicated pregnancies, the causal link between
inadequate CV adaptations and negative pregnancy outcome is extremely difficult to establish.
Each adaptation to pregnancy is the result of a multitude of pleiotropic factors, making it very
difficult to isolate each parameter and determine its individual contribution to pregnancy
outcome.
The acclimation of the heart and vascular system to rodent pregnancy mimic the human
condition. Adaptations in normal pregnant mice (normoglycemic NOD and C57Bl/6J (B6)) as
159
well as Sprague-Dawley rats were analyzed in Chapters 2, 3 and 5, respectively. In all of these
models, gestation-induced increases in CO, stroke volume (SV) and LV mass were observed.
This corroborates previously published work in B6 and CD-1 mouse strains 33,34 as well as Wistar
rats 32,35. Blood volume was not measured in the experiments included herein, however,
previously published work in pregnant rodents has established equivalent increases to that of
human pregnancy 33,35. We infer similar increases of blood volume in the models studied in this
thesis, because increases in SV (noted in the current studies) are often the result of increased
blood volume (as described by the Frank-Starling Law of the heart) 253. Although pregnancyinduced fluctuations in murine BP are well described in the literature 31 and corroborated with B6
mice in Chapter 3, BP measurement in rat pregnancy has been poorly documented. Results in
Chapter 5 using Sprague-Dawley rats substantiate the gestation-induced fluctuations in BP
described by Cotechini et al. in pregnant Wistar rats 32. Together, these represent the only
comprehensive characterizations of BP during normal rat gestation. Although several other
reports of BP in rat pregnancy exist in the literature, the majority are incomplete or technically
flawed. Many studies report blood pressure only on certain gestational time-points, overlooking
the minute fluctuations that occur day by day in response to continued pregnancy 349-351. Other
studies introduced biases based on when and how the telemetry procedure was performed; for
example, not allowing adequate post-surgical recovery or even performing the intensive surgery
during pregnancy itself 352,353.
6.3 Pregnancy-related cardiac gene expression
Many changes in cardiac gene expression are expected in response to: hormonal changes,
growth factor and vasodilator expression changes, changes in RAS, vascular adaptations,
160
increased demand on the maternal heart and increased blood volume; all characteristic of
pregnancy–induced changes in cardiac function and structure 3,8,9,354. Adaptive, transient cardiac
hypertrophy is physiological during normal pregnancy and this sub-class of hypertrophy is
associated with unique characteristic changes in cardiac gene expression 355,356. Pregnancy
complications can have acute and long-term effects on the maternal heart and vasculature. In
cases of pregnancy-induced hypertension (with or without PE), abnormal remodeling of the
maternal heart is likely to occur. In response to pathology, cardiac expression of fetal genes are
upregulated 8. Pathological hypertrophy can also be recognized by changes in expression of
specific genes such as natriuretic propeptide a (Nppa), α- and β-myosin heavy chain (Mhc), and
Sarcoplasmic reticulum Ca2+ ATPase (Serca 2a) (amongst others). In contrast, expression levels
of these genes remain stable in pregnancy-associated cardiac hypertrophy 356; however, it is not
known if this is conserved in circumstances of pregnancy complications. In fact, little is known of
maternal cardiac gene expression in these instances. Experiments performed in Chapters 3 and 5
attempted to examine some of the changes in LV gene expression expected in normal rodent
pregnancy as well as pregnancies associated with abnormal CV adaptations. However, a more
comprehensive analysis, to include additional gestational time-points is needed to completely
understand pregnancy-associated gene-expression changes. The expression of several genes
examined in Chapter 3 proved dynamic across both normal and abnormal pregnancies. Nppa
expression for example appeared to remain stable across pregnancy in B6 mice but spiked (nonstatistically) at gd8 in Pgf-/- mice. Expression levels across multiple gestational time-points were
not analyzed in Chapter 5 due to lack of available samples; however, expression of Nppa in
DMO-treated offspring approached a statistically significant increase on gd18 compared to
controls. These results are congruent with a previous study showing that Nppa and Nppb levels in
161
the maternal LV remain stable across normal pregnancy in the rat 357, whereas increases in Nppa
and Nppb were associated with pathological hypertrophy and concomitant functional deficits 355.
Expression of Jumonji ATP rich interactive domain 2 (Jarid2) is involved in inhibition of Nppa
358
and of pressure-induced (concentric) cardiac hypertrophy 328. Decreased levels of Jarid2 seen
in the hearts of treated dams in late gestation compared to control dams correlates well with the
increased levels of Nppa in treated hearts and may indicate an abnormal form of pregnancyinduced hypertrophy occurring in treated dams only. However, lack of non-pregnant DMO
treated dams as controls makes this difficult to interpret. LV expression of Nos2 and Nos3 was
stable over normal B6 pregnancy in Chapter 3, but was significantly increased at mid-gestation in
Pgf-/- dams. Protein expression of NOS3, on the other hand, was increased from baseline at
midgestation (gd8) in LV of B6 hearts. In normal rat pregnancy cardiac expression of LV Nos2
and Nos3 is increased from baseline 357. An NO-dependent mechanism of angiogenesis and
cardiomyocyte growth has been elucidated in the development of cardiac hypertrophy (outside of
pregnancy) 275, however results in Chapter 3 and elsewhere in rats 357 indicates that this
mechanism may be conserved in pregnancy-induced adaptations of the heart as well. However,
measurements of bioavailable NO would be required to better elucidate the role of NOS-derived
NO in this model of PGF deficiency. Increased angiogenesis in the heart is expected during
pregnancy in order to promote this cardiac hypertrophy. As such, cardiac-specific expression
levels of pro-angiogenic factors such as VEGF and their receptors are increased during gestation
359
. Although non-pregnant levels were unavailable for treated and control rats in Chapter 5,
cardiac-specific expression of VEGF approached a significant decrease in treated versus control
dams. This may indicate that dams previously treated in utero with DMO are unable to initiate a
normal hypertrophic response to pregnancy.
162
Together these results suggest a normal pattern of gene expression in pregnancy-induced
hypertrophy in rodents and a disturbance in this pattern in the absence of PGF or in the presence
of subclinical CV abnormalities. This altered cardiac gene expression pattern may be reflective of
an abnormal pregnancy-associated cardiac hypertrophic phenotype that may be related to the
functional abnormalities seen in these models during gestation.
6.4 Mechanisms of cardiac maladaptations in complicated pregnancies
Inappropriate maternal cardiac or vascular responses to pregnancy are strongly associated
with a wide variety of pregnancy complications 360-363. The mechanisms by which these
maladaptations relate to the pathogenesis of pregnancy complications are largely unknown.
Whether pre-existing maternal CV vulnerabilities relate to the pathogenesis of pregnancy
complications or if these alterations in maternal CV system occur as a result of a pregnancy
disorder is a contested matter 364. There is evidence that suggests that latent CV abnormalities are
unmasked by the stress of pregnancy and contribute to the development of PE or IUGR 2,365. By
contrast, there is also evidence that supports maternal endothelial dysfunction occurring as a
consequence of pregnancy complications, which then leads to maternal CV abnormalities 366-368.
Despite maternal CV maladaptations seen in Pgf-/- mice as well as in F1 female rats from dams
treated with DMO, all pregnancies came to term and most fetuses were viable. This suggests that
the changes to the maternal CV system observed were not severe enough to seriously and
immediately compromise fetal health, and yet fetal growth, and at times uteroplacental blood
flow, was still affected in most cases. Thus, despite successful pregnancy with viable offspring,
deviations from the typical modifications of the maternal CV system during pregnancy may still
have important, long-term effects on offspring health by way of fetal programming as evidenced
163
by the increased fetal BW and placental weights in F2 offspring of DMO-exposed dams and
decreased fetal weights in Pgf-/-offspring. Longitudinal follow-up of these offspring might reveal
important long-term consequences with respect to the prevalence of CV and metabolic diseases.
Offspring of dNOD pregnancies on the other hand, had more severe fetal effects that resulted in
decreased viability and a more discernible effect on both immediate and long-term health of
offspring.
6.5 Potential effects of altered cardiovascular responses in pregnancy on offspring
Of all the models studied herein, the offspring of dNOD pregnancies were impacted most
severely. Affected endpoints included decreased fetal HR, umbilical artery flow and viability of
offspring. In contrast, offspring of Pgf-/- dams had no difference in fetal HR or umbilical blood
flow versus normal (B6) offspring, yet fetal BW was dramatically decreased. Similarly, F2
fetuses of DMO treated dams had similar umbilical blood flow and fetal HR compared to control
fetuses, however, fetal BW was increased at gd18. Larger than normal fetal weight can occur as a
consequence of diabetic pregnancy 69, therefore, we suspect that in utero DMO treatment may
lead to metabolic vulnerabilities, and that these are unmasked by later pregnancy. It is not known
if any potential metabolic sequelae would be a direct consequence of DMO treatment or a
secondary effect of CV abnormalities; however, additional studies are investigating blood glucose
levels as well as pancreatic morphology and histopathology in samples collected in Chapter 5.
This would be of interest on two accounts. First, pancreatic damage and blood glucose
dysregulation have not been documented in DMO or trimethadione exposed rats or in the clinical
trimethadione syndrome 221. Second, fetal pancreatic damage and postnatal insulin dysregulation
has been reported after in utero exposure to ethanol 369,370, suggesting perhaps that other
164
teratogens may elicit metabolic disturbances, even if offspring escape more obvious structural or
functional deficits.
In contrast, substantial aberrant fetal effects (acute as well as long-term) as a consequence
of poorly controlled diabetes in pregnancy are well documented in both humans as well as rodent
models 54,60,233. Results of Chapter 2 indicate that effects were severe enough to cause an increase
in fetal death in diabetic NOD (dNOD) pregnancies. This is congruent with previous reports in
NOD mice 68,371 and the strong association between increased perinatal mortality and stillbirths
with maternal diabetes clinically 372,373. Although fetal weight was not measured in Chapter 2,
previous work from the laboratory using NOD mice showed that offspring of dNOD pregnancies
were growth restricted with heavier placentas and deficient SA remodeling 68. There have also
been incidences of macrosomia noted in offspring in other animal models of diabetes in
pregnancy 69,234,374. Timing and severity of hyperglycemia as well as presence of associated
pathologies seem to be the variables determining if poor glycemic control results in accelerated or
diminished fetal growth 234. Severe cases of maternal diabetes are often associated with
development of vasculopathies and impaired renal function, which in turn, contributes to the
pathogenesis of growth restriction 375. In these instances of severe maternal hyperglycemia, fetal
pancreatic β cells become overstimulated, degranulated and depleted of insulin. This then causes
fetal hypoinsulinaemia, decreased glucose uptake and, eventually, decreased fetal weight 375.
Although there have been conflicting reports, incidences of macrosomia have been most strongly
linked to poor glycemic control prior to the third trimester 376 or, specifically, during the first
trimester of human pregnancy 377. Growth restriction as a result of hyperglycemia in pregnancy
has not been as thoroughly studied and has not been conclusively linked or associated to poor
glycemic index in any particular trimester of pregnancy. Rather, presence of fetal IUGR has been
165
associated with diabetes-induced maternal vasculopathies and severity of the disease 375.
However, timing of hyperglycemia influences development of other diabetes-associated defects/
anomalies as well 47. For example, hyperglycemia in the first trimester is associated with
increased risk for conotruncal CHD as well as decreased myocardial performance 47,378, whereas
in the second trimester fetal myocardial hypertrophy and dysfunction are more commonly seen
372
. First trimester hyperglycemia is also associated with delayed placental growth and decreased
trophoblast proliferation 379.
The direct effects of PGF deficiency on short-term and long-term health of offspring have
yet to be elucidated. Studies using Pgf-/- mice (including experiments conducted in Chapter 3)
show that pups are viable and phenotypically normal, suggesting that PGF is redundant during
development 118,122,380. We suspect that decreased weight in Pgf-/- fetuses reflects CV
programming occurring due to an altered in utero environment. This programming towards
increased CV risk may not be potent enough to result in phenotypic differences at birth or largescale disease later postnatally, however, it may be revealed using CV stressors (such as
pregnancy). Similarly, poor prognosis of Pgf-/- mice undergoing transverse aortic constriction
(TAC) 124,125 may reflect not only a protective role for PGF in the diseased adult heart, but also an
effect of fetal programming due to development in a PGF-deficient environment. The potential
role of PGF in fetal CV programming is difficult to extrapolate in experiments using Pgf-/- due to
the already established role of PGF in disease state-induced inflammation and adaptive
hypertrophy in adults 121,129. To separate these confounding variables, embryo transfer or
conditional knock-out models could be used to investigate the impact of PGF deficiency on fetal
programming or adult cardiac function alone. The mechanisms by which PGF influences fetal
programming could also be multifactorial. As an important growth factor in placental
166
development and growth, absence of PGF alone may impact fetal nutrient transport. These effects
would likely occur in conjunction with decreased levels of bioavailable vascular endothelial
growth factor (VEGF) as a result of absence of PGF (due to an increased proportion of VEGF
binding to soluble Fms-like tyrosine kinase (sFlt) and VEGFR1).
6.6 Conclusions
Results presented herein demonstrate that altered maternal CV responses occur as a
consequence of pregnancies complicated by preexisting maternal diabetes, PGF deficiency or
underlying, subclinical CHD. Several novel conclusions are drawn from results presented in this
thesis with regards to CV adaptations in both normal and abnormal pregnancies.
1. Glucose imbalance during NOD mouse pregnancy leads to aberrant maternal CV adaptations
and negative sequelae on uteroplacental blood flow and offspring growth (Chapter 2).
2. PGF may be involved in the pregnancy-induced adaptations of the maternal CV system,
because the absence of PGF in pregnancy leads to alterations in maternal cardiac function and
the expected gestational-induced hemodynamic fluctuations (Chapter 3).
3. Absence of PGF in pregnancy leads to decreased fetal growth and evidence of postnatal catchup growth that may affect long-term health of offspring (Chapter 3).
4. Highly embryotoxic exposure to a cardiac teratogen has deleterious effects on long-term CV
function, even in the absence of a persistent structural anomaly (Chapter 4).
5. Mildly embryotoxic exposure to a cardiac teratogen results in resolution of CV structural and
functional deficits with advancing postnatal age; however, latent deficiencies persist that are
unmasked by the CV stress of pregnancy (Chapter 5).
167
6. An in utero chemical exposure capable of inducing CHD in female rats causes F2 effects as
evidenced by increased fetal and placental weights in her offspring (Chapter 5).
6.7 Future Directions
6.7.1 Role of placental growth factor in normal and complicated pregnancies.
Chapter 3 highlights a novel link between maternal circulating PGF levels and CV
adaptations to pregnancy. This represents the first evidence suggesting that PGF may have a
cardioprotective role, not only in incidences of heart disease (such as myocardial infarct or
pressure overload 124,127), but also in the physiological demands of pregnancy. Of future interest
would be evidence for a causal link between PGF levels and normal/abnormal pregnancy-induced
cardiac and vascular modifications. To establish this causal link several experiments should be
conducted. Firstly, a similar study to Chapter 3 should be carried out with an additional group of
Pgf-/- mice receiving PGF-reconstitution. A preliminary study would be required in order to
determine the optimal concentrations of PGF required to achieve physiologically relevant levels
throughout mouse pregnancy, or even supraphysiological levels, if proved beneficial. Once
dosing levels are optimized, blood pressure, cardiac structure and function, renal structure and
function as well as fetal consequences could be measured in Pgf-/- dams reconstituted with PGF
and compared to both Pgf-/- dams and B6 dams. In this group we would expect to see at least a
partial rescue of the CV maladaptations seen in Pgf-/- dams sans intervention.
We anticipate PGF reconstitution will only partially rescue the phenotype seen in Chapter
3 due to the effects of in utero development in a PGF deficient environment. To alleviate this
potential confounder, an additional group could also be studied; wherein, transfer of a Pgf-/embryo into a PGF-competent B6 dam would create Pgf-/- offspring that would not have been
168
affected by an altered in utero environment. Once female offspring reach adulthood they could
also be studied in a similar manner to that described in Chapter 3; some being allocated to receive
PGF reconstitution and others not. We would expect that embryo transferred Pgf-/- females
receiving PGF reconstitution in pregnancy would result in a full rescue of the Pgf-/- phenotype
seen in Chapter 3. This would not only help establish a causal link between PGF levels and
normal maternal CV adaptations, but would also provide insight into the role of increased
maternal PGF in pregnancy on fetal development and fetal programming. To examine the role of
fetal programming (in a PGF deficient environment) alone, an identical experiment could be
conducted as described above with the use PGF-competent embryos being transferred into a Pgf-/dam.
Lastly, a similar study paradigm could be used to probe the role of diminished PGF in the
pathogenesis of PE. Using an established animal model of PE, maternal CV and fetal
consequences of PGF reconstitution could be studied as described above. An example of an
appropriate model for use in this study is the reduced uterine perfusion pressure (RUPP) model.
The RUPP model has already been established to produce clinical symptoms similar to PE 381,382
as well as similar anti/angiogenic growth factor profiles (increased sENG 383, increased sFlt and
decreased PGF 384). Justification for this study and a potential link between pathogenesis of PE
and PGF levels has previously been established using a different animal model of PE, wherein
treatment with pravastatin, an HmG CoA reductase inhibitor, resulted in increased serum PGF
levels as well as amelioration of PE symptoms 385. Although no adverse fetal outcomes were
noted in this study, pravastatin is currently labeled as an FDA category X drug (defined in
Section 1.7.2) 385. There has been a clinical case report of improved maternal and fetal outcome
after pravastatin use in PE 386, however, further studies and extreme caution would be required
169
before this is recommended. It would be very interesting to see the effects of PGF reconstitution
in the RUPP model of PE on maternal BP, cardiac function as well as maternal macro and microvasculature. The downstream fetal effects would also be of interest, as IUGR offspring is another
documented consequence of RUPP in rodents and clinical PE 387-390. PGF is also known to be
involved in angiogenesis of placental vasculature and in proper fetal development 103. I
hypothesize that some adverse maternal symptoms as well as fetal growth restriction may be
ameliorated after PGF reconstitution in the RUPP model.
6.7.2 Teratogenic exposure and associated long-term cardiac dysfunction.
Long-term cardiac functional deficits were observed in rat offspring exposed to DMO in
utero regardless of persistence of a structural defect (VSD) (Chapter 4). Due to the high/toxic
range of DMO dosing used in Chapter 4 postnatal viability was very low (18% by weaning) and
these long-term CV functional deficits were seen only in the surviving population of offspring.
Lower total exposure to DMO (used in Chapter 5) resulted in much better postnatal viability
(86% by weaning) and therefore a lack of long-term deficits seen at baseline. Despite absence of
overt CV dysfunction in these offspring as adults, the physiological stress of pregnancy unmasked
deficits in treated versus control dams that were otherwise imperceptible. Long-term offspring
effects of other developmental toxicants have also been observed 310. However, it is unknown if
other models of chemically-induced VSD (specifically) also result in long-term functional deficits
after spontaneous resolution of the structural defect. To determine if this paradigm is conserved
amongst other known causes of VSD (or other chemically-induced CHD), long-term assessments
of offspring CV systems could be undertaken. Of particular interest would be use of therapeutic
drugs that continue to be used during pregnancy but are also known to have clear teratogenic
effects (for example valproic acid or diphenylhydantoin). I hypothesize that the presence of
170
cardiac defects in utero alters cardiogenesis in an irreversible manner (regardless of postnatal
persistence of the defect). Therefore, despite prenatal or postnatal resolution of a structural defect,
cardiac gene expression and overt or covert functional deficits or vulnerabilities will endure into
adulthood. Taken further, different CV stressors (besides pregnancy, as studied in Chapter 5)
could be employed to unmask any underlying or benign differences. Examples of CV stressors
include dobutamine cardiac stress test 391,392 or cardiac pressure overload by TAC 393. These tests
could be used to measure and exacerbate differences in cardiac function in adult rats exposed to
cardiac teratogens during development versus untreated/normal rats. These additional stress tests
would also act as a “second hit”, distinguishing if even after survival from a “first hit”
(teratogenic exposure in this case) health is still compromised in the long-term.
6.7.3 Ventricular septal defects at birth and negative pregnancy outcomes.
Results of Chapter 5 indicate that previous CHD, and VSD in particular, are associated
with long-term CV effects (Chapter 4) and lead to altered CV adaptations in pregnancy. One
limitation of the study was the technical inability to positively identify treated offspring that
developed a VSD versus those that were unaffected. This technical limitation prevented us from
ascertaining the exact effects of resolved VSD, instead our analysis revealed more about previous
treatment with a teratogen on later CV health. Other groups have been able to identify septal
defects in prenatal and neonatal rats 228,394. If this technical skill were employed (in a manner that
was able to preserve fetal life) to our DMO rat model (using the dosing regimen described in
Chapter 5), stratification of treated offspring by presence of previous VSD would be possible.
This stratification would better enable us to observe, longitudinally, the long-term CV effects of
resolved VSD versus persistent VSD versus normal offspring. Additionally, pair-feeding control
and DMO dams during dosing would eliminate any potentially confounding effect of decreased
171
nutritional intake in treated dams on their offspring. Separation of the groups and removal of this
confounder would also allow more precise analysis of the impact of a resolved VSD on maternal
CV adaptations to pregnancy as well as assessment of pregnancy outcome. This would, in turn;
indicate if women with resolved VSD should be more closely followed in the long-term because
of higher risk for pregnancy complications.
172
Bibliography
1.
Hawthorne G. Maternal complications in diabetic pregnancy. Best practice & research
Clinical obstetrics & gynaecology 2011;25:77-90.
2.
Smith GN, Walker MC, Liu A, et al. A history of preeclampsia identifies women who
have underlying cardiovascular risk factors. American journal of obstetrics and gynecology
2009;200:58 e1-8.
3.
Liu LX, Arany Z. Maternal cardiac metabolism in pregnancy. Cardiovascular research
2014;101:545-53.
4.
Catov JM, Ness RB, Kip KE, Olsen J. Risk of early or severe pre-eclampsia related to
pre-existing conditions. International journal of epidemiology 2007;36:412-9.
5.
Evers IM, de Valk HW, Visser GH. Risk of complications of pregnancy in women with
type 1 diabetes: nationwide prospective study in the Netherlands. BMJ 2004;328:915.
6.
Sattar N, Greer IA. Pregnancy complications and maternal cardiovascular risk:
opportunities for intervention and screening? BMJ 2002;325:157-60.
7.
Craici I, Wagner S, Garovic VD. Preeclampsia and future cardiovascular risk: formal risk
factor or failed stress test? Therapeutic advances in cardiovascular disease 2008;2:249-59.
8.
Chung E, Leinwand LA. Pregnancy as a cardiac stress model. Cardiovascular research
2014;101:561-70.
9.
Hunter S, Robson SC. Adaptation of the maternal heart in pregnancy. British heart
journal 1992;68:540-3.
10.
Tsiaras S, Poppas A. Cardiac disease in pregnancy: value of echocardiography. Current
cardiology reports 2010;12:250-6.
11.
Harris LK, Aplin JD. Vascular remodeling and extracellular matrix breakdown in the
uterine spiral arteries during pregnancy. Reprod Sci 2007;14:28-34.
12.
Heineke J, Molkentin JD. Regulation of cardiac hypertrophy by intracellular signalling
pathways. Nature reviews Molecular cell biology 2006;7:589-600.
13.
Moutquin JM, Rainville C, Giroux L, et al. A prospective study of blood pressure in
pregnancy: prediction of preeclampsia. American journal of obstetrics and gynecology
1985;151:191-6.
14.
Conti E, Zezza L, Ralli E, et al. Growth factors in preeclampsia: a vascular disease
model. A failed vasodilation and angiogenic challenge from pregnancy onwards? Cytokine &
growth factor reviews 2013;24:411-25.
15.
Mustafa R, Ahmed S, Gupta A, Venuto RC. A comprehensive review of hypertension in
pregnancy. Journal of pregnancy 2012;2012:105918.
16.
Poppas A, Shroff SG, Korcarz CE, et al. Serial assessment of the cardiovascular system
in normal pregnancy. Role of arterial compliance and pulsatile arterial load. Circulation
1997;95:2407-15.
17.
Sanghavi M, Rutherford JD. Cardiovascular physiology of pregnancy. Circulation
2014;130:1003-8.
18.
Ouzounian JG, Elkayam U. Physiologic changes during normal pregnancy and delivery.
Cardiology clinics 2012;30:317-29.
19.
Hamilton WJ, Boyd JD. Trophoblast in human utero-placental arteries. Nature
1966;212:906-8.
173
20.
Burton GJ, Jauniaux E, Watson AL. Maternal arterial connections to the placental
intervillous space during the first trimester of human pregnancy: the Boyd collection revisited.
American journal of obstetrics and gynecology 1999;181:718-24.
21.
Pijnenborg R, Vercruysse L, Hanssens M. The uterine spiral arteries in human
pregnancy: facts and controversies. Placenta 2006;27:939-58.
22.
Charalambous F, Elia A, Georgiades P. Decidual spiral artery remodeling during early
post-implantation period in mice: investigation of associations with decidual uNK cells and
invasive trophoblast. Biochemical and biophysical research communications 2012;417:847-52.
23.
Ratsep MT, Felker AM, Kay VR, Tolusso L, Hofmann AP, Croy BA. Uterine natural
killer cells: supervisors of vasculature construction in early decidua basalis. Reproduction
2015;149:R91-R102.
24.
Pijnenborg R, Dixon G, Robertson WB, Brosens I. Trophoblastic invasion of human
decidua from 8 to 18 weeks of pregnancy. Placenta 1980;1:3-19.
25.
Kurjak A, Zudenigo D, Funduk-Kurjak B, Shalan H, Predanic M, Sosic A. Transvaginal
color Doppler in the assessment of the uteroplacental circulation in normal early pregnancy.
Journal of perinatal medicine 1993;21:25-34.
26.
Acharya G, Wilsgaard T, Berntsen GK, Maltau JM, Kiserud T. Doppler-derived
umbilical artery absolute velocities and their relationship to fetoplacental volume blood flow: a
longitudinal study. Ultrasound in obstetrics & gynecology : the official journal of the
International Society of Ultrasound in Obstetrics and Gynecology 2005;25:444-53.
27.
Bower S, Vyas S, Campbell S, Nicolaides KH. Color Doppler imaging of the uterine
artery in pregnancy: normal ranges of impedance to blood flow, mean velocity and volume of
flow. Ultrasound in obstetrics & gynecology : the official journal of the International Society of
Ultrasound in Obstetrics and Gynecology 1992;2:261-5.
28.
Nakai Y, Imanaka M, Nishio J, Ogita S. Umbilical cord venous pulsation in normal
fetuses and its incidence after 13 weeks of gestation. Ultrasound in medicine & biology
1995;21:443-6.
29.
Bude RO, Rubin JM. Relationship between the resistive index and vascular compliance
and resistance. Radiology 1999;211:411-7.
30.
Dickey RP, Hower JF. Ultrasonographic features of uterine blood flow during the first 16
weeks of pregnancy. Hum Reprod 1995;10:2448-52.
31.
Burke SD, Barrette VF, Bianco J, et al. Spiral arterial remodeling is not essential for
normal blood pressure regulation in pregnant mice. Hypertension 2010;55:729-37.
32.
Cotechini T, Komisarenko M, Sperou A, Macdonald-Goodfellow S, Adams MA, Graham
CH. Inflammation in rat pregnancy inhibits spiral artery remodeling leading to fetal growth
restriction and features of preeclampsia. The Journal of experimental medicine 2014;211:165-79.
33.
Kulandavelu S, Qu D, Adamson SL. Cardiovascular function in mice during normal
pregnancy and in the absence of endothelial NO synthase. Hypertension 2006;47:1175-82.
34.
Wong AY, Kulandavelu S, Whiteley KJ, Qu D, Langille BL, Adamson SL. Maternal
cardiovascular changes during pregnancy and postpartum in mice. American journal of
physiology Heart and circulatory physiology 2002;282:H918-25.
35.
Slangen BF, Out IC, Verkeste CM, Peeters LL. Hemodynamic changes in early
pregnancy in chronically instrumented, conscious rats. The American journal of physiology
1996;270:H1779-84.
174
36.
Greenwood JD, Minhas K, di Santo JP, Makita M, Kiso Y, Croy BA. Ultrastructural
studies of implantation sites from mice deficient in uterine natural killer cells. Placenta
2000;21:693-702.
37.
Adamson SL, Lu Y, Whiteley KJ, et al. Interactions between trophoblast cells and the
maternal and fetal circulation in the mouse placenta. Developmental biology 2002;250:358-73.
38.
Caluwaerts S, Vercruysse L, Luyten C, Pijnenborg R. Endovascular trophoblast invasion
and associated structural changes in uterine spiral arteries of the pregnant rat. Placenta
2005;26:574-84.
39.
Mu J, Adamson SL. Developmental changes in hemodynamics of uterine artery, uteroand umbilicoplacental, and vitelline circulations in mouse throughout gestation. American journal
of physiology Heart and circulatory physiology 2006;291:H1421-8.
40.
Zhang J, Adams MA, Croy BA. Alterations in maternal and fetal heart functions
accompany failed spiral arterial remodeling in pregnant mice. American journal of obstetrics and
gynecology 2011;205:485 e1-16.
41.
Brosens I, Pijnenborg R, Vercruysse L, Romero R. The "Great Obstetrical Syndromes"
are associated with disorders of deep placentation. American journal of obstetrics and gynecology
2011;204:193-201.
42.
Palinski W. Effect of maternal cardiovascular conditions and risk factors on offspring
cardiovascular disease. Circulation 2014;129:2066-77.
43.
Langley-Evans SC, Welham SJ, Jackson AA. Fetal exposure to a maternal low protein
diet impairs nephrogenesis and promotes hypertension in the rat. Life sciences 1999;64:965-74.
44.
Verlohren S, Herraiz I, Lapaire O, et al. New gestational phase-specific cutoff values for
the use of the soluble fms-like tyrosine kinase-1/placental growth factor ratio as a diagnostic test
for preeclampsia. Hypertension 2014;63:346-52.
45.
Guariguata L, Linnenkamp U, Beagley J, Whiting DR, Cho NH. Global estimates of the
prevalence of hyperglycaemia in pregnancy. Diabetes research and clinical practice
2014;103:176-85.
46.
Linnenkamp U, Guariguata L, Beagley J, Whiting DR, Cho NH. The IDF Diabetes Atlas
methodology for estimating global prevalence of hyperglycaemia in pregnancy. Diabetes research
and clinical practice 2014;103:186-96.
47.
Turan S, Turan OM, Miller J, Harman C, Reece EA, Baschat AA. Decreased fetal cardiac
performance in the first trimester correlates with hyperglycemia in pregestational maternal
diabetes. Ultrasound in obstetrics & gynecology : the official journal of the International Society
of Ultrasound in Obstetrics and Gynecology 2011;38:325-31.
48.
Kim C. Maternal outcomes and follow-up after gestational diabetes mellitus. Diabetic
medicine : a journal of the British Diabetic Association 2014;31:292-301.
49.
Bellamy L, Casas JP, Hingorani AD, Williams D. Type 2 diabetes mellitus after
gestational diabetes: a systematic review and meta-analysis. Lancet 2009;373:1773-9.
50.
Simeoni U, Barker DJ. Offspring of diabetic pregnancy: long-term outcomes. Seminars in
fetal & neonatal medicine 2009;14:119-24.
51.
Jauniaux E, Burton GJ. Villous histomorphometry and placental bed biopsy investigation
in Type I diabetic pregnancies. Placenta 2006;27:468-74.
52.
Haeri S, Khoury J, Kovilam O, Miodovnik M. The association of intrauterine growth
abnormalities in women with type 1 diabetes mellitus complicated by vasculopathy. American
journal of obstetrics and gynecology 2008;199:278 e1-5.
175
53.
Persson B. Neonatal glucose metabolism in offspring of mothers with varying degrees of
hyperglycemia during pregnancy. Seminars in fetal & neonatal medicine 2009;14:106-10.
54.
Fraser A, Lawlor DA. Long-term health outcomes in offspring born to women with
diabetes in pregnancy. Current diabetes reports 2014;14:489.
55.
Silverman BL, Metzger BE, Cho NH, Loeb CA. Impaired glucose tolerance in adolescent
offspring of diabetic mothers. Relationship to fetal hyperinsulinism. Diabetes care 1995;18:611-7.
56.
Dabelea D, Pettitt DJ. Intrauterine diabetic environment confers risks for type 2 diabetes
mellitus and obesity in the offspring, in addition to genetic susceptibility. Journal of pediatric
endocrinology & metabolism : JPEM 2001;14:1085-91.
57.
Bunt JC, Tataranni PA, Salbe AD. Intrauterine exposure to diabetes is a determinant of
hemoglobin A(1)c and systolic blood pressure in pima Indian children. The Journal of clinical
endocrinology and metabolism 2005;90:3225-9.
58.
Pettitt DJ, Baird HR, Aleck KA, Bennett PH, Knowler WC. Excessive obesity in
offspring of Pima Indian women with diabetes during pregnancy. The New England journal of
medicine 1983;308:242-5.
59.
Kousseff BG. Gestational diabetes mellitus (class A): a human teratogen? American
journal of medical genetics 1999;83:402-8.
60.
Corrigan N, Brazil DP, McAuliffe F. Fetal cardiac effects of maternal hyperglycemia
during pregnancy. Birth defects research Part A, Clinical and molecular teratology 2009;85:52330.
61.
Bucci M, Roviezzo F, Brancaleone V, et al. Diabetic mouse angiopathy is linked to
progressive sympathetic receptor deletion coupled to an enhanced caveolin-1 expression.
Arteriosclerosis, thrombosis, and vascular biology 2004;24:721-6.
62.
Welzen-Coppens JM, van Helden-Meeuwsen CG, Leenen PJ, Drexhage HA, Versnel
MA. The kinetics of plasmacytoid dendritic cell accumulation in the pancreas of the NOD mouse
during the early phases of insulitis. PloS one 2013;8:e55071.
63.
Makino S, Kunimoto K, Muraoka Y, Mizushima Y, Katagiri K, Tochino Y. Breeding of a
non-obese, diabetic strain of mice. Jikken dobutsu Experimental animals 1980;29:1-13.
64.
Burke SD, Barrette VF, David S, Khankin EV, Adams MA, Croy BA. Circulatory and
renal consequences of pregnancy in diabetic NOD mice. Placenta 2011;32:949-55.
65.
Takiishi T, Ding L, Baeke F, et al. Dietary supplementation with high doses of regular
vitamin D3 safely reduces diabetes incidence in NOD mice when given early and long term.
Diabetes 2014;63:2026-36.
66.
Tomlinson KC, Gardiner SM, Hebden RA, Bennett T. Functional consequences of
streptozotocin-induced diabetes mellitus, with particular reference to the cardiovascular system.
Pharmacological reviews 1992;44:103-50.
67.
Rakieten N, Rakieten ML, Nadkarni MV. Studies on the diabetogenic action of
streptozotocin (NSC-37917). Cancer chemotherapy reports Part 1 1963;29:91-8.
68.
Burke SD, Dong H, Hazan AD, Croy BA. Aberrant endometrial features of pregnancy in
diabetic NOD mice. Diabetes 2007;56:2919-26.
69.
Formby B, Schmid-Formby F, Jovanovic L, Peterson CM. The offspring of the female
diabetic "nonobese diabetic" (NOD) mouse are large for gestational age and have elevated
pancreatic insulin content: a new animal model of human diabetic pregnancy. Proceedings of the
Society for Experimental Biology and Medicine Society for Experimental Biology and Medicine
1987;184:291-4.
176
70.
Sehested LT, Pedersen P. Prognosis and risk factors for intrauterine growth retardation.
Danish medical journal 2014;61:A4826.
71.
Gardosi J, Chang A, Kalyan B, Sahota D, Symonds EM. Customised antenatal growth
charts. Lancet 1992;339:283-7.
72.
Brodszki J, Lanne T, Marsal K, Ley D. Impaired vascular growth in late adolescence
after intrauterine growth restriction. Circulation 2005;111:2623-8.
73.
Tintu A, Rouwet E, Verlohren S, et al. Hypoxia induces dilated cardiomyopathy in the
chick embryo: mechanism, intervention, and long-term consequences. PloS one 2009;4:e5155.
74.
Soothill PW, Nicolaides KH, Rodeck CH, Gamsu H. Blood gases and acid-base status of
the human second-trimester fetus. Obstetrics and gynecology 1986;68:173-6.
75.
Ream M, Ray AM, Chandra R, Chikaraishi DM. Early fetal hypoxia leads to growth
restriction and myocardial thinning. American journal of physiology Regulatory, integrative and
comparative physiology 2008;295:R583-95.
76.
Giaccia AJ, Simon MC, Johnson R. The biology of hypoxia: the role of oxygen sensing
in development, normal function, and disease. Genes & development 2004;18:2183-94.
77.
Tong W, Xue Q, Li Y, Zhang L. Maternal hypoxia alters matrix metalloproteinase
expression patterns and causes cardiac remodeling in fetal and neonatal rats. American journal of
physiology Heart and circulatory physiology 2011;301:H2113-21.
78.
Powers RW, Jeyabalan A, Clifton RG, et al. Soluble fms-Like tyrosine kinase 1 (sFlt1),
endoglin and placental growth factor (PlGF) in preeclampsia among high risk pregnancies. PloS
one 2010;5:e13263.
79.
Zhao W, Qiao J, Zhang Q, Zhao Y, Chen Q. Levels of antiangiogenic factors in
preeclamptic pregnancies. Growth Factors 2010;28:293-8.
80.
Thadhani R, Kisner T, Hagmann H, et al. Pilot study of extracorporeal removal of soluble
fms-like tyrosine kinase 1 in preeclampsia. Circulation 2011;124:940-50.
81.
American College of O, Gynecologists, Task Force on Hypertension in P. Hypertension
in pregnancy. Report of the American College of Obstetricians and Gynecologists' Task Force on
Hypertension in Pregnancy. Obstetrics and gynecology 2013;122:1122-31.
82.
Welch PC, Amankwah KS, Miller P, McAsey ME, Torry DS. Correlations of placental
perfusion and PlGF protein expression in early human pregnancy. American journal of obstetrics
and gynecology 2006;194:1625-9; discussion 9-31.
83.
Valdes G, Kaufmann P, Corthorn J, Erices R, Brosnihan KB, Joyner-Grantham J.
Vasodilator factors in the systemic and local adaptations to pregnancy. Reproductive biology and
endocrinology : RB&E 2009;7:79.
84.
Rana S, Karumanchi SA, Lindheimer MD. Angiogenic factors in diagnosis, management,
and research in preeclampsia. Hypertension 2014;63:198-202.
85.
Maynard SE, Karumanchi SA. Angiogenic factors and preeclampsia. Seminars in
nephrology 2011;31:33-46.
86.
Levine RJ, Lam C, Qian C, et al. Soluble endoglin and other circulating antiangiogenic
factors in preeclampsia. The New England journal of medicine 2006;355:992-1005.
87.
Levine RJ, Maynard SE, Qian C, et al. Circulating angiogenic factors and the risk of
preeclampsia. The New England journal of medicine 2004;350:672-83.
88.
Shibuya M. Involvement of Flt-1 (VEGF receptor-1) in cancer and preeclampsia.
Proceedings of the Japan Academy Series B, Physical and biological sciences 2011;87:167-78.
89.
Robinson CJ, Stringer SE. The splice variants of vascular endothelial growth factor
(VEGF) and their receptors. Journal of cell science 2001;114:853-65.
177
90.
Tjwa M, Luttun A, Autiero M, Carmeliet P. VEGF and PlGF: two pleiotropic growth
factors with distinct roles in development and homeostasis. Cell and tissue research 2003;314:514.
91.
Ulger H, Ozdamar S, Unur E, Pratten MK. The effect of vascular endothelial growth
factor on in vitro embryonic heart development in rats. Anatomia, histologia, embryologia
2004;33:334-8.
92.
Breier G, Albrecht U, Sterrer S, Risau W. Expression of vascular endothelial growth
factor during embryonic angiogenesis and endothelial cell differentiation. Development
1992;114:521-32.
93.
Risau W. Embryonic angiogenesis factors. Pharmacology & therapeutics 1991;51:371-6.
94.
Ferrara N, Carver-Moore K, Chen H, et al. Heterozygous embryonic lethality induced by
targeted inactivation of the VEGF gene. Nature 1996;380:439-42.
95.
Miquerol L, Langille BL, Nagy A. Embryonic development is disrupted by modest
increases in vascular endothelial growth factor gene expression. Development 2000;127:3941-6.
96.
Evans PW, Wheeler T, Anthony FW, Osmond C. A longitudinal study of maternal serum
vascular endothelial growth factor in early pregnancy. Hum Reprod 1998;13:1057-62.
97.
Bosio PM, Wheeler T, Anthony F, Conroy R, O'Herlihy C, McKenna P. Maternal plasma
vascular endothelial growth factor concentrations in normal and hypertensive pregnancies and
their relationship to peripheral vascular resistance. American journal of obstetrics and gynecology
2001;184:146-52.
98.
Kaufmann P, Mayhew TM, Charnock-Jones DS. Aspects of human fetoplacental
vasculogenesis and angiogenesis. II. Changes during normal pregnancy. Placenta 2004;25:11426.
99.
Kendall RL, Wang G, Thomas KA. Identification of a natural soluble form of the
vascular endothelial growth factor receptor, FLT-1, and its heterodimerization with KDR.
Biochemical and biophysical research communications 1996;226:324-8.
100.
Ruiz de Almodovar C, Lambrechts D, Mazzone M, Carmeliet P. Role and therapeutic
potential of VEGF in the nervous system. Physiological reviews 2009;89:607-48.
101.
He Y, Smith SK, Day KA, Clark DE, Licence DR, Charnock-Jones DS. Alternative
splicing of vascular endothelial growth factor (VEGF)-R1 (FLT-1) pre-mRNA is important for
the regulation of VEGF activity. Mol Endocrinol 1999;13:537-45.
102.
Maynard SE, Min JY, Merchan J, et al. Excess placental soluble fms-like tyrosine kinase
1 (sFlt1) may contribute to endothelial dysfunction, hypertension, and proteinuria in
preeclampsia. The Journal of clinical investigation 2003;111:649-58.
103.
Vrachnis N, Kalampokas E, Sifakis S, et al. Placental growth factor (PlGF): a key to
optimizing fetal growth. The journal of maternal-fetal & neonatal medicine : the official journal
of the European Association of Perinatal Medicine, the Federation of Asia and Oceania Perinatal
Societies, the International Society of Perinatal Obstet 2013;26:995-1002.
104.
Tayade C, Hilchie D, He H, et al. Genetic deletion of placenta growth factor in mice
alters uterine NK cells. J Immunol 2007;178:4267-75.
105.
De Falco S. The discovery of placenta growth factor and its biological activity.
Experimental & molecular medicine 2012;44:1-9.
106.
Iwasaki H, Kawamoto A, Tjwa M, et al. PlGF repairs myocardial ischemia through
mechanisms of angiogenesis, cardioprotection and recruitment of myo-angiogenic competent
marrow progenitors. PloS one 2011;6:e24872.
178
107.
Verlohren S, Stepan H, Dechend R. Angiogenic growth factors in the diagnosis and
prediction of pre-eclampsia. Clin Sci (Lond) 2012;122:43-52.
108.
Gu Y, Lewis DF, Wang Y. Placental productions and expressions of soluble endoglin,
soluble fms-like tyrosine kinase receptor-1, and placental growth factor in normal and
preeclamptic pregnancies. The Journal of clinical endocrinology and metabolism 2008;93:260-6.
109.
Cheifetz S, Bellon T, Cales C, et al. Endoglin is a component of the transforming growth
factor-beta receptor system in human endothelial cells. The Journal of biological chemistry
1992;267:19027-30.
110.
Toporsian M, Gros R, Kabir MG, et al. A role for endoglin in coupling eNOS activity and
regulating vascular tone revealed in hereditary hemorrhagic telangiectasia. Circulation research
2005;96:684-92.
111.
Li DY, Sorensen LK, Brooke BS, et al. Defective angiogenesis in mice lacking endoglin.
Science 1999;284:1534-7.
112.
Venkatesha S, Toporsian M, Lam C, et al. Soluble endoglin contributes to the
pathogenesis of preeclampsia. Nature medicine 2006;12:642-9.
113.
Signore C, Mills JL, Qian C, et al. Circulating angiogenic factors and placental abruption.
Obstetrics and gynecology 2006;108:338-44.
114.
Muttukrishna S, Swer M, Suri S, et al. Soluble Flt-1 and PlGF: new markers of early
pregnancy loss? PloS one 2011;6:e18041.
115.
Backes CH, Markham K, Moorehead P, Cordero L, Nankervis CA, Giannone PJ.
Maternal preeclampsia and neonatal outcomes. Journal of pregnancy 2011;2011:214365.
116.
Minet E, Michel G, Remacle J, Michiels C. Role of HIF-1 as a transcription factor
involved in embryonic development, cancer progression and apoptosis (review). International
journal of molecular medicine 2000;5:253-9.
117.
Diaz-Flores L, Gutierrez R, Varela H. Angiogenesis: an update. Histology and
histopathology 1994;9:807-43.
118.
Carmeliet P, Moons L, Luttun A, et al. Synergism between vascular endothelial growth
factor and placental growth factor contributes to angiogenesis and plasma extravasation in
pathological conditions. Nature medicine 2001;7:575-83.
119.
Zhou X, Qi Y. PLGF inhibition impairs metastasis of larynx carcinoma through MMP3
downregulation. Tumour biology : the journal of the International Society for Oncodevelopmental
Biology and Medicine 2014;35:9381-6.
120.
Yano K, Okada Y, Beldi G, et al. Elevated levels of placental growth factor represent an
adaptive host response in sepsis. The Journal of experimental medicine 2008;205:2623-31.
121.
Carnevale D, Lembo G. Placental growth factor and cardiac inflammation. Trends in
cardiovascular medicine 2012;22:209-12.
122.
Dewerchin M, Carmeliet P. PlGF: a multitasking cytokine with disease-restricted
activity. Cold Spring Harbor perspectives in medicine 2012;2.
123.
Krauss T, Pauer HU, Augustin HG. Prospective analysis of placenta growth factor (PlGF)
concentrations in the plasma of women with normal pregnancy and pregnancies complicated by
preeclampsia. Hypertension in pregnancy : official journal of the International Society for the
Study of Hypertension in Pregnancy 2004;23:101-11.
124.
Accornero F, van Berlo JH, Benard MJ, Lorenz JN, Carmeliet P, Molkentin JD. Placental
growth factor regulates cardiac adaptation and hypertrophy through a paracrine mechanism.
Circulation research 2011;109:272-80.
179
125.
Carnevale D, Cifelli G, Mascio G, et al. Placental growth factor regulates cardiac
inflammation through the tissue inhibitor of metalloproteinases-3/tumor necrosis factor-alphaconverting enzyme axis: crucial role for adaptive cardiac remodeling during cardiac pressure
overload. Circulation 2011;124:1337-50.
126.
Takeda N, Manabe I, Uchino Y, et al. Cardiac fibroblasts are essential for the adaptive
response of the murine heart to pressure overload. The Journal of clinical investigation
2010;120:254-65.
127.
Kolakowski S, Jr., Berry MF, Atluri P, et al. Placental growth factor provides a novel
local angiogenic therapy for ischemic cardiomyopathy. Journal of cardiac surgery 2006;21:55964.
128.
Iwama H, Uemura S, Naya N, et al. Cardiac expression of placental growth factor
predicts the improvement of chronic phase left ventricular function in patients with acute
myocardial infarction. Journal of the American College of Cardiology 2006;47:1559-67.
129.
Lu ZX, Mao LL, Lian F, et al. Cardioprotective activity of placental growth factor in a rat
model of acute myocardial infarction: nanoparticle-based delivery versus direct myocardial
injection. BMC cardiovascular disorders 2014;14:53.
130.
Takeda Y, Uemura S, Iwama H, et al. Treatment with recombinant placental growth
factor (PlGF) enhances both angiogenesis and arteriogenesis and improves survival after
myocardial infarction. Circulation journal : official journal of the Japanese Circulation Society
2009;73:1674-82.
131.
Nakamura K. Impact of Cardiovascular Risk Factors on Medical Expenditure: Evidence
From Epidemiological Studies Analysing Data on Health Checkups and Medical Insurance.
Journal of epidemiology / Japan Epidemiological Association 2014.
132.
Abramson BL, Melvin RG. Cardiovascular risk in women: focus on hypertension. The
Canadian journal of cardiology 2014;30:553-9.
133.
Maclagan LC, Park J, Sanmartin C, et al. The CANHEART health index: a tool for
monitoring the cardiovascular health of the Canadian population. CMAJ : Canadian Medical
Association journal = journal de l'Association medicale canadienne 2014;186:180-7.
134.
Barker DJ, Osmond C, Golding J, Kuh D, Wadsworth ME. Growth in utero, blood
pressure in childhood and adult life, and mortality from cardiovascular disease. BMJ
1989;298:564-7.
135.
Barker DJ, Osmond C. Low birth weight and hypertension. BMJ 1988;297:134-5.
136.
Barker DJ. Adult consequences of fetal growth restriction. Clinical obstetrics and
gynecology 2006;49:270-83.
137.
Bowers K, Liu G, Wang P, et al. Birth weight, postnatal weight change, and risk for high
blood pressure among chinese children. Pediatrics 2011;127:e1272-9.
138.
de Boo HA, Harding JE. The developmental origins of adult disease (Barker) hypothesis.
The Australian & New Zealand journal of obstetrics & gynaecology 2006;46:4-14.
139.
Barker DJ, Osmond C. Infant mortality, childhood nutrition, and ischaemic heart disease
in England and Wales. Lancet 1986;1:1077-81.
140.
Barker DJ, Osmond C. Death rates from stroke in England and Wales predicted from past
maternal mortality. British medical journal 1987;295:83-6.
141.
Barker DJ. The fetal and infant origins of adult disease. BMJ 1990;301:1111.
142.
Barker DJ, Osmond C, Law CM. The intrauterine and early postnatal origins of
cardiovascular disease and chronic bronchitis. Journal of epidemiology and community health
1989;43:237-40.
180
143.
Barker DJ, Meade TW, Fall CH, et al. Relation of fetal and infant growth to plasma
fibrinogen and factor VII concentrations in adult life. BMJ 1992;304:148-52.
144.
Hales CN, Barker DJ. Type 2 (non-insulin-dependent) diabetes mellitus: the thrifty
phenotype hypothesis. Diabetologia 1992;35:595-601.
145.
Barker DJ, Godfrey KM, Osmond C, Bull A. The relation of fetal length, ponderal index
and head circumference to blood pressure and the risk of hypertension in adult life. Paediatric and
perinatal epidemiology 1992;6:35-44.
146.
Barker DJ, Bull AR, Osmond C, Simmonds SJ. Fetal and placental size and risk of
hypertension in adult life. BMJ 1990;301:259-62.
147.
Visentin S, Grumolato F, Nardelli GB, Di Camillo B, Grisan E, Cosmi E. Early origins of
adult disease: Low birth weight and vascular remodeling. Atherosclerosis 2014;237:391-9.
148.
Plagemann A, Harder T, Kohlhoff R, Rohde W, Dorner G. Glucose tolerance and insulin
secretion in children of mothers with pregestational IDDM or gestational diabetes. Diabetologia
1997;40:1094-100.
149.
Vaag AA, Grunnet LG, Arora GP, Brons C. The thrifty phenotype hypothesis revisited.
Diabetologia 2012;55:2085-8.
150.
Srivastava D, Olson EN. A genetic blueprint for cardiac development. Nature
2000;407:221-6.
151.
Sadler TW. Langman's medical embryology: Lippincott Williams & Wilkins; 2011.
152.
Moorman A, Webb S, Brown NA, Lamers W, Anderson RH. Development of the heart:
(1) formation of the cardiac chambers and arterial trunks. Heart 2003;89:806-14.
153.
Bruneau BG. The developmental genetics of congenital heart disease. Nature
2008;451:943-8.
154.
Xin M, Olson EN, Bassel-Duby R. Mending broken hearts: cardiac development as a
basis for adult heart regeneration and repair. Nature reviews Molecular cell biology 2013;14:52941.
155.
Lamers WH, Wessels A, Verbeek FJ, et al. New findings concerning ventricular septation
in the human heart. Implications for maldevelopment. Circulation 1992;86:1194-205.
156.
Hew KW, Keller KA. Postnatal anatomical and functional development of the heart: a
species comparison. Birth defects research Part B, Developmental and reproductive toxicology
2003;68:309-20.
157.
Walsh SZ, Meyer WW, Lind J. The human fetal and neonatal circulation: Function and
structure: CC Thomas; 1974.
158.
Broccoli F, Carinci P. Histological and histochemical analysis of the obliteration
processes of ductus arteriosus Botalli. Acta anatomica 1973;85:69-83.
159.
Tortora GJ, Grabowski SR. Principles of anatomy and physiology: Wiley; 2003.
160.
Marcela SG, Cristina RM, Angel PG, et al. Chronological and morphological study of
heart development in the rat. Anatomical record 2012;295:1267-90.
161.
Challice CE, Viragh S. The architectural development of the early mammalian heart.
Tissue & cell 1974;6:447-62.
162.
Savolainen SM, Foley JF, Elmore SA. Histology atlas of the developing mouse heart with
emphasis on E11.5 to E18.5. Toxicologic pathology 2009;37:395-414.
163.
Kaufman MH, Bard J. The anatomical basis of mouse development: Gulf Professional
Publishing; 1999.
164.
Fananapazir K, Kaufman MH. Observations on the development of the aorticopulmonary spiral septum in the mouse. Journal of anatomy 1988;158:157-72.
181
165.
Kisanuki YY, Hammer RE, Miyazaki J, Williams SC, Richardson JA, Yanagisawa M.
Tie2-Cre transgenic mice: a new model for endothelial cell-lineage analysis in vivo.
Developmental biology 2001;230:230-42.
166.
Sissman NJ. Developmental landmarks in cardiac morphogenesis: comparative
chronology. The American journal of cardiology 1970;25:141-8.
167.
Momma K, Ito T, Ando M. In situ morphology of the foramen ovale in the fetal and
neonatal rat. Pediatric research 1992;32:669-72.
168.
Jarkovska D, Janatova T, Hruda J, Ostadal B, Samanek M. The physiological closure of
ductus arteriosus in the rat. An ultrastructural study. Anatomy and embryology 1989;180:497504.
169.
Tada T, Kishimoto H. Ultrastructural and histological studies on closure of the mouse
ductus arteriosus. Acta anatomica 1990;139:326-34.
170.
Lints TJ, Parsons LM, Hartley L, Lyons I, Harvey RP. Nkx-2.5: a novel murine
homeobox gene expressed in early heart progenitor cells and their myogenic descendants.
Development 1993;119:419-31.
171.
Harvey RP. NK-2 homeobox genes and heart development. Developmental biology
1996;178:203-16.
172.
Thomas PS, Kasahara H, Edmonson AM, et al. Elevated expression of Nkx-2.5 in
developing myocardial conduction cells. The Anatomical record 2001;263:307-13.
173.
Pikkarainen S, Tokola H, Kerkela R, Ruskoaho H. GATA transcription factors in the
developing and adult heart. Cardiovascular research 2004;63:196-207.
174.
Zhou P, He A, Pu WT. Regulation of GATA4 transcriptional activity in cardiovascular
development and disease. Current topics in developmental biology 2012;100:143-69.
175.
Molkentin JD, Lin Q, Duncan SA, Olson EN. Requirement of the transcription factor
GATA4 for heart tube formation and ventral morphogenesis. Genes & development
1997;11:1061-72.
176.
Srivastava D, Cserjesi P, Olson EN. A subclass of bHLH proteins required for cardiac
morphogenesis. Science 1995;270:1995-9.
177.
Firulli AB, McFadden DG, Lin Q, Srivastava D, Olson EN. Heart and extra-embryonic
mesodermal defects in mouse embryos lacking the bHLH transcription factor Hand1. Nature
genetics 1998;18:266-70.
178.
Srivastava D, Thomas T, Lin Q, Kirby ML, Brown D, Olson EN. Regulation of cardiac
mesodermal and neural crest development by the bHLH transcription factor, dHAND. Nature
genetics 1997;16:154-60.
179.
Greulich F, Rudat C, Kispert A. Mechanisms of T-box gene function in the developing
heart. Cardiovascular research 2011;91:212-22.
180.
Hiroi Y, Kudoh S, Monzen K, et al. Tbx5 associates with Nkx2-5 and synergistically
promotes cardiomyocyte differentiation. Nature genetics 2001;28:276-80.
181.
Takeuchi JK, Ohgi M, Koshiba-Takeuchi K, et al. Tbx5 specifies the left/right ventricles
and ventricular septum position during cardiogenesis. Development 2003;130:5953-64.
182.
Ghosh TK, Song FF, Packham EA, et al. Physical interaction between TBX5 and MEF2C
is required for early heart development. Molecular and cellular biology 2009;29:2205-18.
183.
Pearce WJ, Khorram O. Maturation and differentiation of the fetal vasculature. Clinical
obstetrics and gynecology 2013;56:537-48.
182
184.
Butler SM, Abrassart JM, Hubbell MC, et al. Contributions of VEGF to age-dependent
transmural gradients in contractile protein expression in ovine carotid arteries. American journal
of physiology Cell physiology 2011;301:C653-66.
185.
Hubbell MC, Semotiuk AJ, Thorpe RB, et al. Chronic hypoxia and VEGF differentially
modulate abundance and organization of myosin heavy chain isoforms in fetal and adult ovine
arteries. American journal of physiology Cell physiology 2012;303:C1090-103.
186.
Adeoye OO, Butler SM, Hubbell MC, Semotiuk A, Williams JM, Pearce WJ.
Contribution of increased VEGF receptors to hypoxic changes in fetal ovine carotid artery
contractile proteins. American journal of physiology Cell physiology 2013;304:C656-65.
187.
Patterson AJ, Zhang L. Hypoxia and fetal heart development. Current molecular
medicine 2010;10:653-66.
188.
Giussani DA, Camm EJ, Niu Y, et al. Developmental programming of cardiovascular
dysfunction by prenatal hypoxia and oxidative stress. PloS one 2012;7:e31017.
189.
Penny DJ, Vick GW, 3rd. Ventricular septal defect. Lancet 2011;377:1103-12.
190.
Gomez O, Martinez JM, Olivella A, et al. Isolated ventricular septal defects in the era of
advanced fetal echocardiography: risk of chromosomal anomalies and spontaneous closure rate
from diagnosis to age of 1 year. Ultrasound in obstetrics & gynecology : the official journal of the
International Society of Ultrasound in Obstetrics and Gynecology 2014;43:65-71.
191.
Minette MS, Sahn DJ. Ventricular septal defects. Circulation 2006;114:2190-7.
192.
Rudolph AM. Circulatory adjustments after birth: effects on ventricular septal defect.
British heart journal 1971;33:Suppl:32-4.
193.
Afouda BA, Martin J, Liu F, Ciau-Uitz A, Patient R, Hoppler S. GATA transcription
factors integrate Wnt signalling during heart development. Development 2008;135:3185-90.
194.
Kuo CT, Morrisey EE, Anandappa R, et al. GATA4 transcription factor is required for
ventral morphogenesis and heart tube formation. Genes & development 1997;11:1048-60.
195.
Garg V, Kathiriya IS, Barnes R, et al. GATA4 mutations cause human congenital heart
defects and reveal an interaction with TBX5. Nature 2003;424:443-7.
196.
Pu WT, Ishiwata T, Juraszek AL, Ma Q, Izumo S. GATA4 is a dosage-sensitive regulator
of cardiac morphogenesis. Developmental biology 2004;275:235-44.
197.
Shan JP, Wang XL, Qiao YG, et al. Novel and functional DNA sequence variants within
the GATA5 gene promoter in ventricular septal defects. World journal of pediatrics : WJP
2014;10:348-53.
198.
Liu CX, Shen AD, Li XF, et al. Association of TBX5 gene polymorphism with
ventricular septal defect in the Chinese Han population. Chinese medical journal 2009;122:30-4.
199.
Hurst JA, Hall CM, Baraitser M. The Holt-Oram syndrome. Journal of medical genetics
1991;28:406-10.
200.
Holt M, Oram S. Familial heart disease with skeletal malformations. British heart journal
1960;22:236-42.
201.
Prall OW, Menon MK, Solloway MJ, et al. An Nkx2-5/Bmp2/Smad1 negative feedback
loop controls heart progenitor specification and proliferation. Cell 2007;128:947-59.
202.
Pashmforoush M, Lu JT, Chen H, et al. Nkx2-5 pathways and congenital heart disease;
loss of ventricular myocyte lineage specification leads to progressive cardiomyopathy and
complete heart block. Cell 2004;117:373-86.
203.
Schott JJ, Benson DW, Basson CT, et al. Congenital heart disease caused by mutations in
the transcription factor NKX2-5. Science 1998;281:108-11.
183
204.
Chang CP, Bruneau BG. Epigenetics and cardiovascular development. Annual review of
physiology 2012;74:41-68.
205.
Chen JN, Haffter P, Odenthal J, et al. Mutations affecting the cardiovascular system and
other internal organs in zebrafish. Development 1996;123:293-302.
206.
Wilson PD, Loffredo CA, Correa-Villasenor A, Ferencz C. Attributable fraction for
cardiac malformations. American journal of epidemiology 1998;148:414-23.
207.
Jenkins KJ, Correa A, Feinstein JA, et al. Noninherited risk factors and congenital
cardiovascular defects: current knowledge: a scientific statement from the American Heart
Association Council on Cardiovascular Disease in the Young: endorsed by the American
Academy of Pediatrics. Circulation 2007;115:2995-3014.
208.
van Spronsen FJ. Phenylketonuria: a 21st century perspective. Nature reviews
Endocrinology 2010;6:509-14.
209.
Levy HL, Guldberg P, Guttler F, et al. Congenital heart disease in maternal
phenylketonuria: report from the Maternal PKU Collaborative Study. Pediatric research
2001;49:636-42.
210.
Becerra JE, Khoury MJ, Cordero JF, Erickson JD. Diabetes mellitus during pregnancy
and the risks for specific birth defects: a population-based case-control study. Pediatrics
1990;85:1-9.
211.
Dorrie N, Focker M, Freunscht I, Hebebrand J. Fetal alcohol spectrum disorders.
European child & adolescent psychiatry 2014;23:863-75.
212.
Tikkanen J, Heinonen OP. Risk factors for ventricular septal defect in Finland. Public
health 1991;105:99-112.
213.
Williams LJ, Correa A, Rasmussen S. Maternal lifestyle factors and risk for ventricular
septal defects. Birth defects research Part A, Clinical and molecular teratology 2004;70:59-64.
214.
Azarbayjani F, Danielsson BR. Pharmacologically induced embryonic dysrhythmia and
episodes of hypoxia followed by reoxygenation: a common teratogenic mechanism for
antiepileptic drugs? Teratology 1998;57:117-26.
215.
Zackai EH, Mellman WJ, Neiderer B, Hanson JW. The fetal trimethadione syndrome.
The Journal of pediatrics 1975;87:280-4.
216.
Tanaka E, Ishikawa A, Abei M, Kobayashi S. Trimethadione as a probe drug to estimate
hepatic oxidizing capacity in humans. Comparative biochemistry and physiology Part C,
Pharmacology, toxicology & endocrinology 1996;115:211-6.
217.
Butler TC, Mahaffee D, Mahaffee C. Metabolic demethylation of 3, 5, 5-trimethyl-2, 4oxazolidinedione (trimethadione, tridione). Proceedings of the Society for Experimental Biology
and Medicine Society for Experimental Biology and Medicine 1952;81:450-2.
218.
German J, Kowal A, Ehlers KH. Trimethadione and human teratogenesis. Teratology
1970;3:349-62.
219.
Zellweger H. Anticonvulsants during pregnancy: a danger to the developing fetus?
Clinical pediatrics 1974;13:338-41.
220.
Nichols MM. Fetal anomalies following maternal trimethadione ingestion. The Journal of
pediatrics 1973;82:885-6.
221.
Feldman GL, Weaver DD, Lovrien EW. The fetal trimethadione syndrome: report of an
additional family and further delineation of this syndrome. American journal of diseases of
children 1977;131:1389-92.
184
222.
Rogawski MA, Porter RJ. Antiepileptic drugs: pharmacological mechanisms and clinical
efficacy with consideration of promising developmental stage compounds. Pharmacological
reviews 1990;42:223-86.
223.
Tanaka E, Funae Y. Trimethadione: metabolism and assessment of hepatic drugoxidizing capacity. Methods in enzymology 1996;272:163-9.
224.
Azarbayjani F, Danielsson BR. Embryonic arrhythmia by inhibition of HERG channels: a
common hypoxia-related teratogenic mechanism for antiepileptic drugs? Epilepsia 2002;43:45768.
225.
Coulter DA, Huguenard JR, Prince DA. Specific petit mal anticonvulsants reduce
calcium currents in thalamic neurons. Neuroscience letters 1989;98:74-8.
226.
Davies MP, An RH, Doevendans P, Kubalak S, Chien KR, Kass RS. Developmental
changes in ionic channel activity in the embryonic murine heart. Circulation research 1996;78:1525.
227.
Solomon HM, Wier PJ, Fish CJ, et al. Spontaneous and induced alterations in the cardiac
membranous ventricular septum of fetal, weanling, and adult rats. Teratology 1997;55:185-94.
228.
Fleeman TL, Cappon GD, Hurtt ME. Postnatal closure of membranous ventricular septal
defects in Sprague-Dawley rat pups after maternal exposure with trimethadione. Birth defects
research Part B, Developmental and reproductive toxicology 2004;71:185-90.
229.
Weston AD, Brown NA, Ozolins TR. Co-variation in frequency and severity of
cardiovascular and skeletal defects in Sprague-Dawley rats after maternal administration of
dimethadione, the N-demethylated metabolite of trimethadione. Birth defects research Part B,
Developmental and reproductive toxicology 2011;92:206-15.
230.
Purssell E, Weston AD, Thomson JJ, Swanson TA, Brown NA, Ozolins TR. Noninvasive
high-resolution ultrasound reveals structural and functional deficits in dimethadione-exposed fetal
rat hearts in utero. Birth defects research Part B, Developmental and reproductive toxicology
2012;95:35-46.
231.
Powers RW, Roberts JM, Plymire DA, et al. Low placental growth factor across
pregnancy identifies a subset of women with preterm preeclampsia: type 1 versus type 2
preeclampsia? Hypertension 2012;60:239-46.
232.
Crowther CA, Hiller JE, Moss JR, McPhee AJ, Jeffries WS, Robinson JS. Effect of
treatment of gestational diabetes mellitus on pregnancy outcomes. The New England journal of
medicine 2005;352:2477-86.
233.
Hay WW, Jr. Care of the Infant of the Diabetic Mother. Curr Diab Rep 2011.
234.
Vambergue A, Fajardy I. Consequences of gestational and pregestational diabetes on
placental function and birth weight. World journal of diabetes 2011;2:196-203.
235.
Tarquini R, Lazzeri C, Pala L, Rotella CM, Gensini GF. The diabetic cardiomyopathy.
Acta diabetologica 2011;48:173-81.
236.
Desai DK, Moodley J, Naidoo DP. Echocardiographic assessment of cardiovascular
hemodynamics in normal pregnancy. Obstetrics and gynecology 2004;104:20-9.
237.
Burke SD, Barrette VF, Carter AL, Gravel J, Adams MA, Croy BA. Cardiovascular
adaptations of pregnancy in T and B cell-deficient mice. Biology of reproduction 2011;85:60514.
238.
Kitzmiller JL, Dang-Kilduff L, Taslimi MM. Gestational diabetes after delivery. Shortterm management and long-term risks. Diabetes care 2007;30 Suppl 2:S225-35.
239.
Dawson SI. Glucose tolerance in pregnancy and the long-term risk of cardiovascular
disease. Diabetes research and clinical practice 2009;85:14-9.
185
240.
Platt MJ, Stanisstreet M, Casson IF, et al. St Vincent's Declaration 10 years on: outcomes
of diabetic pregnancies. Diabetic medicine : a journal of the British Diabetic Association
2002;19:216-20.
241.
Mongiovi M, Fesslova V, Fazio G, Barbaro G, Pipitone S. Diagnosis and prognosis of
fetal cardiomyopathies: a review. Current pharmaceutical design 2010;16:2929-34.
242.
Zimmerman MA, Haskins K, Bradley B, Gilman J, Gamboni-Robertson F, Flores SC.
Autoimmune-mediated vascular injury occurs prior to sustained hyperglycemia in a murine
model of type I diabetes mellitus. The Journal of surgical research 2011;168:e195-202.
243.
AFIP Laboratory Methods in Histotechnology. Washington, DC: American Registry of
Pathology; 1992.
244.
Moon JY, Tanimoto M, Gohda T, et al. Attenuating effect of angiotensin-(1-7) on
angiotensin II-mediated NAD(P)H oxidase activation in type 2 diabetic nephropathy of KKA(y)/Ta mice. American journal of physiology Renal physiology 2011;300:F1271-82.
245.
Wang H, Madhusudhan T, He T, et al. Low but sustained coagulation activation
ameliorates glucose-induced podocyte apoptosis: protective effect of factor V Leiden in diabetic
nephropathy. Blood 2011;117:5231-42.
246.
Ahokas RA, Sibai BM. The relationship between experimentally determined litter size
and maternal blood pressure in spontaneously hypertensive rats. American journal of obstetrics
and gynecology 1990;162:841-7.
247.
Otto CM, Pearlman AS. Textbook of clinical echocardiography. Philadelphia: W.B.
Saunders; 1995.
248.
Locatelli P, Olea FD, De Lorenzi A, et al. Reference values for echocardiographic
parameters and indexes of left ventricular function in healthy, young adult sheep used in
translational research: comparison with standardized values in humans. International journal of
clinical and experimental medicine 2011;4:258-64.
249.
Ogueh O, Clough A, Hancock M, Johnson MR. A longitudinal study of the control of
renal and uterine hemodynamic changes of pregnancy. Hypertension in pregnancy : official
journal of the International Society for the Study of Hypertension in Pregnancy 2011;30:243-59.
250.
Gross V, Tank J, Partke HJ, et al. Cardiovascular autonomic regulation in Non-Obese
Diabetic (NOD) mice. Autonomic neuroscience : basic & clinical 2008;138:108-13.
251.
Airaksinen KE, Ikaheimo MJ, Salmela PI, Kirkinen P, Linnaluoto MK, Takkunen JT.
Impaired cardiac adjustment to pregnancy in type I diabetes. Diabetes care 1986;9:376-83.
252.
Heitritter SM, Solomon CG, Mitchell GF, Skali-Ounis N, Seely EW. Subclinical
inflammation and vascular dysfunction in women with previous gestational diabetes mellitus. The
Journal of clinical endocrinology and metabolism 2005;90:3983-8.
253.
Katz AM. Ernest Henry Starling, his predecessors, and the "Law of the Heart".
Circulation 2002;106:2986-92.
254.
Frustaci A, Kajstura J, Chimenti C, et al. Myocardial cell death in human diabetes.
Circulation research 2000;87:1123-32.
255.
Fiordaliso F, Li B, Latini R, et al. Myocyte death in streptozotocin-induced diabetes in
rats in angiotensin II- dependent. Laboratory investigation; a journal of technical methods and
pathology 2000;80:513-27.
256.
Malhotra A, Vashistha H, Yadav VS, et al. Inhibition of p66ShcA redox activity in
cardiac muscle cells attenuates hyperglycemia-induced oxidative stress and apoptosis. American
journal of physiology Heart and circulatory physiology 2009;296:H380-8.
186
257.
Debrah DO, Novak J, Matthews JE, Ramirez RJ, Shroff SG, Conrad KP. Relaxin is
essential for systemic vasodilation and increased global arterial compliance during early
pregnancy in conscious rats. Endocrinology 2006;147:5126-31.
258.
Byun YJ, Kim HS, Yang JI, Kim JH, Kim HY, Chang SJ. Umbilical artery Doppler study
as a predictive marker of perinatal outcome in preterm small for gestational age infants. Yonsei
medical journal 2009;50:39-44.
259.
Corrigan N, Treacy A, Brazil DP, McAuliffe FM. Cardiomyopathy and Diastolic
Dysfunction in the Embryo and Neonate of a Type 1 Diabetic Mouse Model. Reprod Sci 2012.
260.
Holmes VA, Young IS, Patterson CC, et al. Optimal glycemic control, pre-eclampsia, and
gestational hypertension in women with type 1 diabetes in the diabetes and pre-eclampsia
intervention trial. Diabetes care 2011;34:1683-8.
261.
Mathiesen ER, Ringholm L, Damm P. Pregnancy management of women with
pregestational diabetes. Endocrinology and metabolism clinics of North America 2011;40:72738.
262.
Luttun A, Tjwa M, Carmeliet P. Placental growth factor (PlGF) and its receptor Flt-1
(VEGFR-1): novel therapeutic targets for angiogenic disorders. Annals of the New York
Academy of Sciences 2002;979:80-93.
263.
Ratsep MT, Carmeliet P, Adams MA, Croy BA. Impact of placental growth factor
deficiency on early mouse implant site angiogenesis. Placenta 2014.
264.
Armstrong DW, Tse MY, Wong PG, et al. Gestational hypertension and the
developmental origins of cardiac hypertrophy and diastolic dysfunction. Molecular and cellular
biochemistry 2014;391:201-9.
265.
Wong PG, Armstrong DW, Tse MY, Brander EP, Pang SC. Sex-specific differences in
natriuretic peptide and nitric oxide synthase expression in ANP gene-disrupted mice. Molecular
and cellular biochemistry 2013;374:125-35.
266.
Melchiorre K, Sharma R, Thilaganathan B. Cardiac structure and function in normal
pregnancy. Current opinion in obstetrics & gynecology 2012;24:413-21.
267.
Alahakoon TI, Zhang W, Trudinger BJ, Lee VW. Discordant clinical presentations of
preeclampsia and intrauterine fetal growth restriction with similar pro- and anti-angiogenic
profiles. The journal of maternal-fetal & neonatal medicine : the official journal of the European
Association of Perinatal Medicine, the Federation of Asia and Oceania Perinatal Societies, the
International Society of Perinatal Obstet 2014;27:1854-9.
268.
Molvarec A, Gullai N, Stenczer B, Fugedi G, Nagy B, Rigo J, Jr. Comparison of
placental growth factor and fetal flow Doppler ultrasonography to identify fetal adverse outcomes
in women with hypertensive disorders of pregnancy: an observational study. BMC pregnancy and
childbirth 2013;13:161.
269.
Kurtz TW, Griffin KA, Bidani AK, Davisson RL, Hall JE. Recommendations for blood
pressure measurement in humans and experimental animals. Part 2: Blood pressure measurement
in experimental animals: a statement for professionals from the subcommittee of professional and
public education of the American Heart Association council on high blood pressure research.
Hypertension 2005;45:299-310.
270.
Tejera E, Areias MJ, Rodrigues AI, Nieto-Villar JM, Rebelo I. Blood pressure and heart
rate variability complexity analysis in pregnant women with hypertension. Hypertension in
pregnancy : official journal of the International Society for the Study of Hypertension in
Pregnancy 2012;31:91-106.
187
271.
Hofmann AP, Gerber SA, Croy BA. Uterine natural killer cells pace early development
of mouse decidua basalis. Molecular human reproduction 2014;20:66-76.
272.
Kasdaglis T, Aberdeen G, Turan O, et al. Placental growth factor in the first trimester:
relationship with maternal factors and placental Doppler studies. Ultrasound in obstetrics &
gynecology : the official journal of the International Society of Ultrasound in Obstetrics and
Gynecology 2010;35:280-5.
273.
Savu O, Jurcut R, Giusca S, et al. Morphological and functional adaptation of the
maternal heart during pregnancy. Circulation Cardiovascular imaging 2012;5:289-97.
274.
Gmeiner M, Zimpfer D, Holfeld J, et al. Improvement of cardiac function in the failing
rat heart after transfer of skeletal myoblasts engineered to overexpress placental growth factor.
The Journal of thoracic and cardiovascular surgery 2011;141:1238-45.
275.
Jaba IM, Zhuang ZW, Li N, et al. NO triggers RGS4 degradation to coordinate
angiogenesis and cardiomyocyte growth. The Journal of clinical investigation 2013;123:1718-31.
276.
Gigante B, Morlino G, Gentile MT, Persico MG, De Falco S. Plgf-/-eNos-/- mice show
defective angiogenesis associated with increased oxidative stress in response to tissue ischemia.
FASEB journal : official publication of the Federation of American Societies for Experimental
Biology 2006;20:970-2.
277.
Romero M, Caniffi C, Bouchet G, et al. Sex differences in the beneficial cardiac effects
of chronic treatment with atrial natriuretic Peptide in spontaneously hypertensive rats. PloS one
2013;8:e71992.
278.
Wong J, Chang C, Agrawal R, et al. Gene expression profiling: classification of mice
with left ventricle systolic dysfunction using microarray analysis. Critical care medicine
2010;38:25-31.
279.
Jones SP, Greer JJ, Kakkar AK, et al. Endothelial nitric oxide synthase overexpression
attenuates myocardial reperfusion injury. American journal of physiology Heart and circulatory
physiology 2004;286:H276-82.
280.
Manoury B, Montiel V, Balligand JL. Nitric oxide synthase in post-ischaemic
remodelling: new pathways and mechanisms. Cardiovascular research 2012;94:304-15.
281.
Guo Y, Jones WK, Xuan YT, et al. The late phase of ischemic preconditioning is
abrogated by targeted disruption of the inducible NO synthase gene. Proceedings of the National
Academy of Sciences of the United States of America 1999;96:11507-12.
282.
Otani H. The role of nitric oxide in myocardial repair and remodeling. Antioxidants &
redox signaling 2009;11:1913-28.
283.
Palmer RM, Ferrige AG, Moncada S. Nitric oxide release accounts for the biological
activity of endothelium-derived relaxing factor. Nature 1987;327:524-6.
284.
Osol G, Celia G, Gokina N, et al. Placental growth factor is a potent vasodilator of rat
and human resistance arteries. American journal of physiology Heart and circulatory physiology
2008;294:H1381-7.
285.
Tarry-Adkins JL, Martin-Gronert MS, Fernandez-Twinn DS, et al. Poor maternal
nutrition followed by accelerated postnatal growth leads to alterations in DNA damage and repair,
oxidative and nitrosative stress, and oxidative defense capacity in rat heart. FASEB journal :
official publication of the Federation of American Societies for Experimental Biology
2013;27:379-90.
286.
Singhal A, Cole TJ, Fewtrell M, Deanfield J, Lucas A. Is slower early growth beneficial
for long-term cardiovascular health? Circulation 2004;109:1108-13.
188
287.
Eriksson JG, Forsen T, Tuomilehto J, Winter PD, Osmond C, Barker DJ. Catch-up
growth in childhood and death from coronary heart disease: longitudinal study. BMJ
1999;318:427-31.
288.
Hypertension in pregnancy. Report of the American College of Obstetricians and
Gynecologists' Task Force on Hypertension in Pregnancy. Obstetrics and gynecology
2013;122:1122-31.
289.
Hoffman JI, Kaplan S. The incidence of congenital heart disease. Journal of the American
College of Cardiology 2002;39:1890-900.
290.
Asou T. Surgical management of muscular trabecular ventricular septal defects. General
thoracic and cardiovascular surgery 2011;59:723-9.
291.
Du ZD, Roguin N, Wu XJ. Spontaneous closure of muscular ventricular septal defect
identified by echocardiography in neonates. Cardiology in the young 1998;8:500-5.
292.
Engelfriet PM, Duffels MG, Moller T, et al. Pulmonary arterial hypertension in adults
born with a heart septal defect: the Euro Heart Survey on adult congenital heart disease. Heart
2007;93:682-7.
293.
Kidd L, Driscoll DJ, Gersony WM, et al. Second natural history study of congenital heart
defects. Results of treatment of patients with ventricular septal defects. Circulation 1993;87:I3851.
294.
Roos-Hesselink JW, Meijboom FJ, Spitaels SE, et al. Outcome of patients after surgical
closure of ventricular septal defect at young age: longitudinal follow-up of 22-34 years. European
heart journal 2004;25:1057-62.
295.
Maitra M, Schluterman MK, Nichols HA, et al. Interaction of Gata4 and Gata6 with Tbx5
is critical for normal cardiac development. Developmental biology 2009;326:368-77.
296.
Nemer M. Genetic insights into normal and abnormal heart development. Cardiovascular
pathology : the official journal of the Society for Cardiovascular Pathology 2008;17:48-54.
297.
Benson DW, Silberbach GM, Kavanaugh-McHugh A, et al. Mutations in the cardiac
transcription factor NKX2.5 affect diverse cardiac developmental pathways. The Journal of
clinical investigation 1999;104:1567-73.
298.
Hoffman JI. Congenital heart disease: incidence and inheritance. Pediatric clinics of
North America 1990;37:25-43.
299.
Lewington S, Clarke R, Qizilbash N, Peto R, Collins R. Age-specific relevance of usual
blood pressure to vascular mortality: a meta-analysis of individual data for one million adults in
61 prospective studies. Lancet 2002;360:1903-13.
300.
Zhu Y, Gramolini AO, Walsh MA, et al. Tbx5-dependent pathway regulating diastolic
function in congenital heart disease. Proceedings of the National Academy of Sciences of the
United States of America 2008;105:5519-24.
301.
Hu K, Duan D, Li GR, Nattel S. Protein kinase C activates ATP-sensitive K+ current in
human and rabbit ventricular myocytes. Circulation research 1996;78:492-8.
302.
Mitchell SC, Korones SB, Berendes HW. Congenital heart disease in 56,109 births.
Incidence and natural history. Circulation 1971;43:323-32.
303.
Shea KM, Hewitt AJ, Olmstead MC, Brien JF, Reynolds JN. Maternal ethanol
consumption by pregnant guinea pigs causes neurobehavioral deficits and increases ethanol
preference in offspring. Behavioural pharmacology 2012;23:105-12.
304.
Driscoll CD, Streissguth AP, Riley EP. Prenatal alcohol exposure: comparability of
effects in humans and animal models. Neurotoxicology and teratology 1990;12:231-7.
189
305.
Bevilacqua LM, Simon AM, Maguire CT, et al. A targeted disruption in connexin40
leads to distinct atrioventricular conduction defects. Journal of interventional cardiac
electrophysiology : an international journal of arrhythmias and pacing 2000;4:459-67.
306.
Jay PY, Harris BS, Maguire CT, et al. Nkx2-5 mutation causes anatomic hypoplasia of
the cardiac conduction system. The Journal of clinical investigation 2004;113:1130-7.
307.
Danielsson C, Azarbayjani F, Skold AC, Sjogren N, Danielsson BR. Polytherapy with
hERG-blocking antiepileptic drugs: increased risk for embryonic cardiac arrhythmia and
teratogenicity. Birth defects research Part A, Clinical and molecular teratology 2007;79:595-603.
308.
Buscariollo DL, Fang X, Greenwood V, Xue H, Rivkees SA, Wendler CC. Embryonic
caffeine exposure acts via A1 adenosine receptors to alter adult cardiac function and DNA
methylation in mice. PloS one 2014;9:e87547.
309.
Dressler GR. Advances in early kidney specification, development and patterning.
Development 2009;136:3863-74.
310.
Rogers JM, Ellis-Hutchings RG, Grey BE, et al. Elevated blood pressure in offspring of
rats exposed to diverse chemicals during pregnancy. Toxicological sciences : an official journal
of the Society of Toxicology 2014;137:436-46.
311.
van der Linde D, Konings EE, Slager MA, et al. Birth prevalence of congenital heart
disease worldwide: a systematic review and meta-analysis. Journal of the American College of
Cardiology 2011;58:2241-7.
312.
Gabriel HM, Heger M, Innerhofer P, et al. Long-term outcome of patients with
ventricular septal defect considered not to require surgical closure during childhood. Journal of
the American College of Cardiology 2002;39:1066-71.
313.
Nora JJ. Multifactorial inheritance hypothesis for the etiology of congenital heart
diseases. The genetic-environmental interaction. Circulation 1968;38:604-17.
314.
Shan J, Pang S, Wanyan H, Xie W, Qin X, Yan B. Genetic analysis of the SIRT1 gene
promoter in ventricular septal defects. Biochemical and biophysical research communications
2012;425:741-5.
315.
Buttar HS, Dupuis I, Khera KS. Dimethadione-induced fetotoxicity in rats. Toxicology
1978;9:155-64.
316.
Rodger I, Lam I, Purssell E, Thompson M, Rutter A, Ozolins TR. Maternal rat serum
concentrations of dimethadione do not explain intra-litter differences in the incidence of
dimethadione-induced birth defects, including novel findings in foetal lung. Toxicology
2014;326:142-52.
317.
Aasa KL, Purssell E, Adams MA, Ozolins TR. In Utero Dimethadione Exposure Causes
Postnatal Disruption in Cardiac Structure and Function in the Rat. Toxicological sciences : an
official journal of the Society of Toxicology 2014.
318.
Leeson CP, Kattenhorn M, Morley R, Lucas A, Deanfield JE. Impact of low birth weight
and cardiovascular risk factors on endothelial function in early adult life. Circulation
2001;103:1264-8.
319.
Chahoud I, Paumgartten FJ. Influence of litter size on the postnatal growth of rat pups: is
there a rationale for litter-size standardization in toxicity studies? Environmental research
2009;109:1021-7.
320.
Aasa KL, Kwong KK, Adams MA, Croy BA. Analysis of maternal and fetal
cardiovascular systems during hyperglycemic pregnancy in the nonobese diabetic mouse. Biology
of reproduction 2013;88:151.
190
321.
D'Hooge J, Heimdal A, Jamal F, et al. Regional strain and strain rate measurements by
cardiac ultrasound: principles, implementation and limitations. European journal of
echocardiography : the journal of the Working Group on Echocardiography of the European
Society of Cardiology 2000;1:154-70.
322.
Dandel M, Lehmkuhl H, Knosalla C, Suramelashvili N, Hetzer R. Strain and strain rate
imaging by echocardiography - basic concepts and clinical applicability. Current cardiology
reviews 2009;5:133-48.
323.
Somaio Neto F, Ikejiri AT, Bertoletto PR, et al. Gene expression related to oxidative
stress in the heart of mice after intestinal ischemia. Arquivos brasileiros de cardiologia
2014;102:165-73.
324.
Schmittgen TD, Livak KJ. Analyzing real-time PCR data by the comparative C(T)
method. Nature protocols 2008;3:1101-8.
325.
Shorvon SD. The treatment of epilepsy. 2nd ed. Malden, Mass. ; Oxford: Blackwell
Science; 2004.
326.
Otterstad JE, Erikssen J, Michelsen S, Nitter-Hauge S. Long-term follow-up in isolated
ventricular septal defect considered too small to warrant operation. Journal of internal medicine
1990;228:305-9.
327.
Lee Y, Song AJ, Baker R, Micales B, Conway SJ, Lyons GE. Jumonji, a nuclear protein
that is necessary for normal heart development. Circulation research 2000;86:932-8.
328.
Seok HY, Chen J, Kataoka M, et al. Loss of MicroRNA-155 protects the heart from
pathological cardiac hypertrophy. Circulation research 2014;114:1585-95.
329.
Oka T, Akazawa H, Naito AT, Komuro I. Angiogenesis and cardiac hypertrophy:
maintenance of cardiac function and causative roles in heart failure. Circulation research
2014;114:565-71.
330.
Sala C, Campise M, Ambroso G, Motta T, Zanchetti A, Morganti A. Atrial natriuretic
peptide and hemodynamic changes during normal human pregnancy. Hypertension 1995;25:6316.
331.
Borghi C, Esposti DD, Immordino V, et al. Relationship of systemic hemodynamics, left
ventricular structure and function, and plasma natriuretic peptide concentrations during
pregnancy complicated by preeclampsia. American journal of obstetrics and gynecology
2000;183:140-7.
332.
Lewandowski AJ, Leeson P. Preeclampsia, prematurity and cardiovascular health in adult
life. Early human development 2014;90:725-9.
333.
Barker DJ. Fetal origins of cardiovascular disease. Annals of medicine 1999;31 Suppl
1:3-6.
334.
Barker DJ. The fetal origins of type 2 diabetes mellitus. Annals of internal medicine
1999;130:322-4.
335.
Tang LC, Kwok AC, Wong AY, Lee YY, Sun KO, So AP. Critical care in obstetrical
patients: an eight-year review. Chinese medical journal 1997;110:936-41.
336.
Redman CW. Current topic: pre-eclampsia and the placenta. Placenta 1991;12:301-8.
337.
Saito S, Nakashima A. A review of the mechanism for poor placentation in early-onset
preeclampsia: the role of autophagy in trophoblast invasion and vascular remodeling. Journal of
reproductive immunology 2014;101-102:80-8.
338.
Groen B, Uuldriks GA, de Vos P, Visser JT, Links TP, Faas MM. Impaired trophoblast
invasion and increased numbers of immune cells at day 18 of pregnancy in the mesometrial
triangle of type 1 diabetic rats. Placenta 2015;36:142-9.
191
339.
Lyall F, Robson SC, Bulmer JN. Spiral artery remodeling and trophoblast invasion in
preeclampsia and fetal growth restriction: relationship to clinical outcome. Hypertension
2013;62:1046-54.
340.
Khong TY, De Wolf F, Robertson WB, Brosens I. Inadequate maternal vascular response
to placentation in pregnancies complicated by pre-eclampsia and by small-for-gestational age
infants. British journal of obstetrics and gynaecology 1986;93:1049-59.
341.
Xiao R, Sorensen TK, Williams MA, Luthy DA. Influence of pre-eclampsia on fetal
growth. The journal of maternal-fetal & neonatal medicine : the official journal of the European
Association of Perinatal Medicine, the Federation of Asia and Oceania Perinatal Societies, the
International Society of Perinatal Obstet 2003;13:157-62.
342.
Mitani M, Matsuda Y, Makino Y, Akizawa Y, Ohta H. Clinical features of fetal growth
restriction complicated later by preeclampsia. The journal of obstetrics and gynaecology research
2009;35:882-7.
343.
Duvekot JJ, Peeters LL. Maternal cardiovascular hemodynamic adaptation to pregnancy.
Obstetrical & gynecological survey 1994;49:S1-14.
344.
Merzouk H, Khan NA. Implication of lipids in macrosomia of diabetic pregnancy: can n3 polyunsaturated fatty acids exert beneficial effects? Clin Sci (Lond) 2003;105:519-29.
345.
Greiss FC, Jr., Anderson SG. Effect of ovarian hormones on the uterine vascular bed.
American journal of obstetrics and gynecology 1970;107:829-36.
346.
McGuane JT, Debrah JE, Debrah DO, et al. Role of relaxin in maternal systemic and
renal vascular adaptations during gestation. Annals of the New York Academy of Sciences
2009;1160:304-12.
347.
Podjarny E, Mandelbaum A, Bernheim J. Does nitric oxide play a role in normal
pregnancy and pregnancy-induced hypertension? Nephrology, dialysis, transplantation : official
publication of the European Dialysis and Transplant Association - European Renal Association
1994;9:1527-9.
348.
Lev-Sagie A, Bar-Oz B, Salpeter L, Hochner-Celnikier D, Arad I, Nir A. Plasma
concentrations of N-terminal Pro-B-Type natriuretic peptide in pregnant women near labor and
during early puerperium. Clinical chemistry 2005;51:1909-10.
349.
Ibrahim HS, Omar E, Froemming GR, Singh HJ. Leptin increases blood pressure and
markers of endothelial activation during pregnancy in rats. BioMed research international
2013;2013:298401.
350.
Thaete LG, Neerhof MG. Endothelin and blood pressure regulation in the female rat:
studies in normal pregnancy and with nitric oxide synthase inhibition-induced hypertension.
Hypertension in pregnancy : official journal of the International Society for the Study of
Hypertension in Pregnancy 2000;19:233-47.
351.
Ibrahim HS, Froemming GR, Omar E, Singh HJ. ACE2 activation by xanthenone
prevents leptin-induced increases in blood pressure and proteinuria during pregnancy in SpragueDawley rats. Reproductive toxicology 2014;49C:155-61.
352.
West CA, Han W, Li N, Masilamani SM. Renal epithelial sodium channel is critical for
blood pressure maintenance and sodium balance in the normal late pregnant rat. Experimental
physiology 2014;99:816-23.
353.
Brewer J, Liu R, Lu Y, et al. Endothelin-1, oxidative stress, and endogenous angiotensin
II: mechanisms of angiotensin II type I receptor autoantibody-enhanced renal and blood pressure
response during pregnancy. Hypertension 2013;62:886-92.
192
354.
Lumbers ER, Pringle KG. Roles of the circulating renin-angiotensin-aldosterone system
in human pregnancy. American journal of physiology Regulatory, integrative and comparative
physiology 2014;306:R91-101.
355.
Dorn GW, 2nd, Robbins J, Sugden PH. Phenotyping hypertrophy: eschew obfuscation.
Circulation research 2003;92:1171-5.
356.
Eghbali M, Deva R, Alioua A, et al. Molecular and functional signature of heart
hypertrophy during pregnancy. Circulation research 2005;96:1208-16.
357.
Jankowski M, Wang D, Mukaddam-Daher S, Gutkowska J. Pregnancy alters nitric oxide
synthase and natriuretic peptide systems in the rat left ventricle. The Journal of endocrinology
2005;184:209-17.
358.
Kim TG, Chen J, Sadoshima J, Lee Y. Jumonji represses atrial natriuretic factor gene
expression by inhibiting transcriptional activities of cardiac transcription factors. Molecular and
cellular biology 2004;24:10151-60.
359.
Umar S, Nadadur R, Iorga A, Amjedi M, Matori H, Eghbali M. Cardiac structural and
hemodynamic changes associated with physiological heart hypertrophy of pregnancy are reversed
postpartum. Journal of applied physiology 2012;113:1253-9.
360.
Lambert G, Brichant JF, Hartstein G, Bonhomme V, Dewandre PY. Preeclampsia: an
update. Acta anaesthesiologica Belgica 2014;65:137-49.
361.
Konje JC, Howarth ES, Kaufmann P, Taylor DJ. Longitudinal quantification of uterine
artery blood volume flow changes during gestation in pregnancies complicated by intrauterine
growth restriction. BJOG : an international journal of obstetrics and gynaecology 2003;110:3015.
362.
Kane SC, Costa Fda S, Brennecke S. First trimester biomarkers in the prediction of later
pregnancy complications. BioMed research international 2014;2014:807196.
363.
Gurgel Alves JA, Praciano de Sousa PC, Bezerra Maia EHMS, Kane SC, da Silva Costa
F. First-trimester maternal ophthalmic artery Doppler analysis for prediction of pre-eclampsia.
Ultrasound in obstetrics & gynecology : the official journal of the International Society of
Ultrasound in Obstetrics and Gynecology 2014;44:411-8.
364.
Osol G, Bernstein I. Preeclampsia and maternal cardiovascular disease: consequence or
predisposition? Journal of vascular research 2014;51:290-304.
365.
Powe CE, Levine RJ, Karumanchi SA. Preeclampsia, a disease of the maternal
endothelium: the role of antiangiogenic factors and implications for later cardiovascular disease.
Circulation 2011;123:2856-69.
366.
Chinnathambi V, Balakrishnan M, Ramadoss J, Yallampalli C, Sathishkumar K.
Testosterone alters maternal vascular adaptations: role of the endothelial NO system.
Hypertension 2013;61:647-54.
367.
Melchiorre K, Sutherland GR, Baltabaeva A, Liberati M, Thilaganathan B. Maternal
cardiac dysfunction and remodeling in women with preeclampsia at term. Hypertension
2011;57:85-93.
368.
Melchiorre K, Sutherland GR, Liberati M, Thilaganathan B. Maternal cardiovascular
impairment in pregnancies complicated by severe fetal growth restriction. Hypertension
2012;60:437-43.
369.
Dobson CC, Thevasundaram K, Mongillo DL, et al. Chronic prenatal ethanol exposure
alters expression of central and peripheral insulin signaling molecules in adult guinea pig
offspring. Alcohol 2014;48:687-93.
193
370.
Dobson CC, Mongillo DL, Brien DC, et al. Chronic prenatal ethanol exposure increases
adiposity and disrupts pancreatic morphology in adult guinea pig offspring. Nutrition & diabetes
2012;2:e57.
371.
ANDO S, OTANI H, TANAKA O, MORITAKE K. Morphological Analysis of Neural
Tube Defects in Non‐ obese Diabetic (NOD) Mouse Embryos. Congenital Anomalies
1991;31:23-32.
372.
Casson IF, Clarke CA, Howard CV, et al. Outcomes of pregnancy in insulin dependent
diabetic women: results of a five year population cohort study. BMJ 1997;315:275-8.
373.
Mathiesen ER, Ringholm L, Damm P. Stillbirth in diabetic pregnancies. Best practice &
research Clinical obstetrics & gynaecology 2011;25:105-11.
374.
Kiss AC, Lima PH, Sinzato YK, et al. Animal models for clinical and gestational
diabetes: maternal and fetal outcomes. Diabetology & metabolic syndrome 2009;1:21.
375.
Van Assche FA, Holemans K, Aerts L. Long-term consequences for offspring of diabetes
during pregnancy. British medical bulletin 2001;60:173-82.
376.
Lin CC, River J, River P, Blix PM, Moawad AH. Good diabetic control early in
pregnancy and favorable fetal outcome. Obstetrics and gynecology 1986;67:51-6.
377.
Rey E, Attie C, Bonin A. The effects of first-trimester diabetes control on the incidence
of macrosomia. American journal of obstetrics and gynecology 1999;181:202-6.
378.
Morgan SC, Relaix F, Sandell LL, Loeken MR. Oxidative stress during diabetic
pregnancy disrupts cardiac neural crest migration and causes outflow tract defects. Birth defects
research Part A, Clinical and molecular teratology 2008;82:453-63.
379.
Weiss U, Cervar M, Puerstner P, et al. Hyperglycaemia in vitro alters the proliferation
and mitochondrial activity of the choriocarcinoma cell lines BeWo, JAR and JEG-3 as models for
human first-trimester trophoblast. Diabetologia 2001;44:209-19.
380.
Zhou AY, Bai YJ, Zhao M, Yu WZ, Huang LZ, Li XX. Placental growth factor
expression is reversed by antivascular endothelial growth factor therapy under hypoxic
conditions. World journal of pediatrics : WJP 2014;10:262-70.
381.
Li J, LaMarca B, Reckelhoff JF. A model of preeclampsia in rats: the reduced uterine
perfusion pressure (RUPP) model. American journal of physiology Heart and circulatory
physiology 2012;303:H1-8.
382.
Pennington KA, Schlitt JM, Jackson DL, Schulz LC, Schust DJ. Preeclampsia: multiple
approaches for a multifactorial disease. Disease models & mechanisms 2012;5:9-18.
383.
Gilbert JS, Gilbert SA, Arany M, Granger JP. Hypertension produced by placental
ischemia in pregnant rats is associated with increased soluble endoglin expression. Hypertension
2009;53:399-403.
384.
Gilbert JS, Babcock SA, Granger JP. Hypertension produced by reduced uterine
perfusion in pregnant rats is associated with increased soluble fms-like tyrosine kinase-1
expression. Hypertension 2007;50:1142-7.
385.
Kumasawa K, Ikawa M, Kidoya H, et al. Pravastatin induces placental growth factor
(PGF) and ameliorates preeclampsia in a mouse model. Proceedings of the National Academy of
Sciences of the United States of America 2011;108:1451-5.
386.
Lefkou E, Mamopoulos A, Fragakis N, et al. Clinical improvement and successful
pregnancy in a preeclamptic patient with antiphospholipid syndrome treated with pravastatin.
Hypertension 2014;63:e118-9.
387.
Gruslin A, Lemyre B. Pre-eclampsia: fetal assessment and neonatal outcomes. Best
practice & research Clinical obstetrics & gynaecology 2011;25:491-507.
194
388.
Balta O, Boztosun A, Deveci K, et al. Reduced uterine perfusion pressure model is not
successful to mimic severe preeclampsia. Placenta 2011;32:675-80.
389.
Alexander BT. Placental insufficiency leads to development of hypertension in growthrestricted offspring. Hypertension 2003;41:457-62.
390.
Crispi F, Dominguez C, Llurba E, Martin-Gallan P, Cabero L, Gratacos E. Placental
angiogenic growth factors and uterine artery Doppler findings for characterization of different
subsets in preeclampsia and in isolated intrauterine growth restriction. American journal of
obstetrics and gynecology 2006;195:201-7.
391.
Tontodonati M, Fasdelli N, Repeto P, Dorigatti R. Characterisation of rodent dobutamine
echocardiography for preclinical safety pharmacology assessment. Journal of pharmacological
and toxicological methods 2011;64:129-33.
392.
Plante E, Lachance D, Drolet MC, Roussel E, Couet J, Arsenault M. Dobutamine stress
echocardiography in healthy adult male rats. Cardiovascular ultrasound 2005;3:34.
393.
deAlmeida AC, van Oort RJ, Wehrens XH. Transverse aortic constriction in mice.
Journal of visualized experiments : JoVE 2010.
394.
Nakamura T, Kuribayashi T, Shimoo K, Katsume H, Nakagawa M, Komeda T.
Echo/Doppler diagnosis of tetralogy of Fallot, ventricular septal defect, pulmonary valve
dysplasia, and hypertrophic cardiomyopathy in WKY/NCrj rats. Japanese circulation journal
1992;56:441-51.
195
Appendix A
CHAPTER 2 SUPPLEMENTAL DATA
196
Appendix A. 1. Fractional Shortening (FS) normalized to heart rate (HR).
Once normalized by heart rate (HR), FS was significantly increased in diabetic dams over
gestation (p=0.0057). Gestation day (gd) specific differences reached significance on gd14 and
gd16.
197
Appendix A. 2. Umbilical artery Resistance Index (RI).
Umbilical artery RI is decreased in d-NOD pregnancy versus c-NOD over the gestational timepoints measured (p=0.013).
198
Appendix A. 3. Left Ventricular (LV) lumen area.
LV lumen area (calculated by histological analysis) approached a significant increase in diabetic
versus control hearts over the gestational time-points measured (p=0.062).
199
Appendix B
CHAPTER 3 SUPPLEMENTAL DATA
200
Appendix B. 1 Mean Arterial Pressure (MAP) recordings using radiotelemetry in Pgf-/mice.
Tracings in black represent the only two 129/SvJ Pgf-/- that successfully recovered from unilateral
radiotransmitter (TA11PA-C10, Data Sciences International, St. Paul, Minnesota) common
carotid occlusion surgery. The mean of the two tracings is represented in blue. (A) Raw MAP
recordings (B) Change in MAP from baseline.
201
Appendix B. 2. High-frequency ultrasound images of cardiac scans from a gd16 B6 dam.
Representative B-Mode image, parasternal short axis (PAX) of left ventricle (LV) (A).
Representative M-Mode image used during cardiac scans (B).
PM – Papillary muscle, AW – Anterior wall, PW – Posterior wall.
202
Appendix B. 3. Primer Sequences.
Gene
Nppa
Nppb
Npra
Nprc
Gapdh
Nos3
Nos2
Vegfa
Vegfb
Vegfr1
Vegfr2
Pgf
Eng
Sense (S)
Primer sequence
Standard
Effect of
Effect of
Anti-
Curve
PGF (p-
Gestation (p-
sense (A)
Efficiency
value)
value)
0.43
0.038
0.8
0.74
0.35
0.34
0.16
0.51
0.99
0.15
0.049
0.036
0.093
0.13
0.59
0.99
0.04
0.008
0.67
0.09
0.37
0.28
0.0001
0.52
0.038
0.98
S
CAAGAACCTGCTAGACCACC
A
AGCTGTTGCAGCCTAGTCC
S
CCAGAGACAGCTCTTGAAGG
A
TCCGATCCGGTCTATCTTG
S
CCAGCATCCTTCCATGAC
A
GTTCCACATCCGCTGAGT
S
CAGCAGACTTGGAACAGGA
A
CCATTAGCAAGCCAGCAC
S
TGACTCCACTCACGGCAA
A
ACTCCACGACATACTCAGCAC
S
CCAGGCTGGAAGCTGTAAC
A
AGTGATGGCCGACCTGAT
S
TTGAGGATGTGGSTGTGTG
A
GAGTTAGGCTGCCTGAGATG
S
AACACAGACTCGCGTTGC
A
CGTGGTGGTGAGATGGTT
S
GTGCCATGGATAGACGTT
A
GGATCTGCATTCGCACTT
S
TGGTCCTATGGCGTGTTG
A
CTGTTGGACGTTGGCTTG
S
TAGCTGTCGCTCTGTGGTT
A
AATCACGCTGAGCATTGG
S
ACCTTGGCTCTGGATGTCT
A
AGGCACCACTTCCACTTCT
S
CACAACAGGTCTCGCAGAA
A
GTCGTAGGCCAAGTGCAA
203
2.008
2.079
2.068
2.066
2.023
1.897
1.913
1.975
2.078
2.155
2.054
1.973
1.964
-/-
B6
gd16
Virgin
Pgf
Appendix B. 4. Cardiac histology from virgin and gd16 Pgf-/- and B6 dams.
Heart section were paraffin-embedded, parasternal short axis sections were cut at 6μm, stained
with H&E and digitized. No significant morphological differences were observed between
groups. The graphs below show no significant difference between groups in left ventricular (LV)
chamber size or wall thickness at gd16.
Scale bar = 500μm
204
Appendix B. 5. Maternal Body Weight
Mean Pgf-/- maternal
body weight (g)
Pgf-/- (n)
Mean B6 maternal
body weight (g)
B6 (n)
p-value
Virgin
22.15
9
22.42
8
NS
gd8
25.33
5
25.35
6
NS
gd10
29.69
6
30.44
4
NS
gd12
28.38
4
25.40
3
NS
gd14
32.47
5
33.37
5
NS
gd16
34.80
3
37.28
3
NS
gd18
38.08
3
42.89
4
NS
pp12
25.70
4
27.66
3
NS
pp30
28.04
4
26.91
4
NS
205
Appendix C
CHAPTER 4 SUPPLEMENTAL DATA
206
Appendix C. 1. Raw heart rate (HR) at baseline.
Raw HR over the 33 day baseline period did not differ between DMO and CTL animals overall or
at any specific time-point.
207
Appendix D
CHAPTER 5 SUPPLEMENTAL DATA
208
Appendix D. 1. Raw 6hr. Night-time Telemetry Data.
Raw telemetry data obtained from 6hr night-time (7pm-7am) means. Horizontal dashed lines
represent 4-day baselines for each group. Differences within groups from baseline are indicated
by asterisks above (showing an increase) or below (showing a decrease) the gestational day for
which they are significant. Orange symbols represent differences in DMO animals; blue symbols
represent differences in control animals. Difference between groups in baseline values was seen
only in heart rate date (indicated by black asterisk). *p≤0.05, **p≤0.01, ***p≤0.001.
209
Appendix D. 2. PCR primer sequences and standard curve efficiencies.
Effect of previous
treatment with DMO
(p-value)
Gene
Primer Sequence
Melt Temp. Efficiency
(°C)
(%)
Nkx2.5
FWD: ACTTGAACACGGTGCAGAG
87
98.1
0.55
86
87
0.61
92.1
0.062
84.5
104
0.86
83
92.2
0.67
84
96
0.15
83
102.7
0.02
92.4
0.38
83
93.3
0.15
83.5
94.5
0.75
84
90.4
0.14
83.5
94.1
0.062
88
94.1
0.69
83
99.9
REV: GTCATCGCCCTTCTCCTAAAG
Tbx5
FWD: CCCTACCAGCACTTCTCTGC
REV: GACTGAAGGCCAGTCTGAGG
NPPA
FWD: TGAGCCGAGACAGCAAACATCAGA 84.5
REV: ATCTGTGTTGGACACCGCACTGTA
Gata4
FWD: TCTCACTATGGGCACAGCAG
REV: CGAGCAGGAATTTGAAGAGG
Serca2a
FWD: CGATGACAATGGCACTTTCTG
REV: AAGTGAAGGGACATGGACAAG
Cx40
FWD: TCCCTTCTGCATATGCCTTCCACT
REV: CCCAAGGAAACACAGGAGCATCT
Jarid2
FWD: ACTGGAGAAGGAGGTGCTGA
REV: GAAGCCATTCCTGGGTGTAA
Myh6
FWD: AGACAATCTACAGCGGGTGAAGCA 81
REV: TTTGCCTTGGCCTTGATGATCTGC
Myh7
FWD: CCTCGCAATATCAAGGGAAA
REV: TACAGGTGCATCAGCTCCAG
NPPB
FWD: GACGGGCTGAGGTTGTTTTA
REV: ACTGTGGCAAGTTTGTGCTG
VEGF
FWD: GCCCTGAGTCAAGAGGACAG
REV: CAGGCTCCTGATTCTTCCAG
VEGFR1 FWD: TTTATCAGCGTGAAGCATCG
REV: CCGAATAGCGAGCAGATTTC
Per2
FWD: AGGTACCTGGAGAGCTGCAA
REV: GGTGAGGGACACCACACTCT
GusB
FWD: GGTCGTGATGTGGTCTGTG
210
Appendix D. 3. F1 postnatal body weight (uncorrected) from PND2 to PND21.
Control body weight (g)
Treated body weight (g)
n= 29-42
n= 21-35
2
8.707 ± 0.96
8.214 ± 0.90
0.0238
4
11.83 ± 1.35
10.60 ± 0.97
< 0.0001
7
16.48 ± 1.86
14.91 ± 1.48
0.002
10
23.11 ± 2.80
20.64 ± 2.50
0.0002
13
29.50 ± 3.57
27.33 ± 3.21
0.0087
16
35.07 ± 4.07
34.87 ± 4.07
0.8345
21
56.50 ± 9.15
54.59 ± 4.18
0.3056
Postnatal Day
p-value
Data presented as mean ± standard deviation
211
Appendix D. 4. F1 postnatal viability.
Postnatal Day
Control viability
Treated viability
2
98%
100%
4
98%
92%
7
98%
89%
10
98%
86%
13
98%
86%
16
98%
86%
21
98%
86%
Based on sum of total litter sizes at birth, with 3 litters per group (n=43 control offspring, n=36
treated offspring). Calculated by dividing surviving offspring by total offspring at birth for each
group.
212
Appendix D. 5. F1 postnatal day 4 cardiac functional and structural echocardiographic data
(A-H).
Summary of p-values for all parameters can be found in Table 1. Different litters are represented
by differing symbols. *p≤0.05, **p≤0.01, ***p≤0.001.
213
Appendix D. 6. F1 postnatal day 21 cardiac functional and structural echocardiographic
data (A-I).
Summary of p-values for all parameters can be found in Table 1. Inter-litter variability is
demonstrated by differences in symbols. *p≤0.05, **p≤0.01, ***p≤0.001.
214
Appendix D. 7. 6hr Night-time Heart Rate (HR) Represented as Change From Baseline
(Delta).
Delta HR analyzed from night-time data only (7pm-7am) was significantly elevated in control
versus treated dams over gestation. Differences between groups at specific time-point reached
significance on gd14. ). *p≤0.05.
215
Appendix D. 8. 24hr. Activity Data Normalized to Baseline.
Change in activity level (delta activity) from baseline was significantly decreased during
gestation in treated dams versus controls. Gestation day (gd) specific differences in delta activity
between groups reached significance on gd18. *p≤0.05, **p≤0.01.
216