Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
An elusive expansion at the FRDA locus Claire Healey, Andrew Purvis, Mohammed Kiron Kibria, Kara Gaffing, Fiona Coyne & Roger Mountford Cheshire and Merseyside Regional Molecular Genetics Laboratory, Liverpool Women’s Hospital Presentation Overview Introduction: • Friedreich ataxia: Clinical symptoms; Molecular pathology Case 1: • Diagnostic referral; • CAG repeat expansion testing; • Unusual TP-PCR result Case 2: Diagnostic referral; • Premutation plus GAA repeat expansion within the disease-causing size range • Case 3: • Carrier testing; • GAA repeat expansion undetected using standard analysis Friedreich Ataxia (FRDA) • Autosomal recessive neurodegenerative disorder; • Affects the spinal column and cerebellum; • Slowly progressive ataxia of the gait & limbs; • Onset: 10 – 15 years of age • Associated with: Muscle weakness; Spasticity in the lower limbs; Absent lower limb reflexes; Dysarthria; Scoliosis; Pes cavus; Bladder dysfunction; Loss of position and vibration sense FRDA • Additional clinical symptoms: • ~ 30 %: Hypertrophic non-obstructive cardiomyopathy • ~ 10-25%: Optic atrophy; Deafness; Glucose intolerance or Diabetes mellitus • ~ 25%: Atypical presentation: Later age of onset; Retained tendon reflexes; or Unusually slow disease progression Genetics of FRDA • • Incidence of 2-4 per 100,000 – Europe, N. Africa, Middle East & S. Asia Carrier frequency of ~ 1:100 • FRDA gene (Frataxin or X25) indentified in 1996: 1. Expansion of GAA triplet repeat within intron 1 = 98% mutations 1 2 3 aaaaaaaaaaaaaaagaagaag aagaagaagaagaaaataaaga Normal alleles: 5-33 GAA repeats; Alleles > 27 repeats rare; Premutation alleles: 34-65 GAA repeats; Expanded alleles: > 66 GAA repeats Some alleles have interrupted sequences: GAAGGA or GAGGAA 4 5a Genetics of FRDA • • Incidence of 2-4 per 100,000 – Europe, N. Africa, Middle East & S. Asia Carrier frequency of 1:100 • FRDA gene (Frataxin or X25) indentified in 1996: 1. 98% mutations = expansion of GAA triplet repeat within intron 1 1 2 3 4 5a 1 106 165 182 2. 1-2% FRDA patients – GAA expansion plus inactivating mutation, (nonsense, splicing, frameshift or missense) Homozygous expansion & compound heterozygous patients: clinically indistinguishable; Patients with missense mutations near the carboxy-terminus have atypically mild FRDA; No patients have been described with two identified point mutations Molecular Genetic Testing Detection of GAA repeats: • Current testing strategy: a) F-PCR across repeat region with FAM-labelled primers Molecular Genetic Testing Detection of GAA repeats: • Current testing strategy: a) F-PCR across repeat region with FAM-labelled primers n/n (8/29 repeats) n/? Molecular Genetic Testing Detection of GAA repeats: • Current testing strategy: a) b) F-PCR across repeat region with FAM-labelled primers; Triplet-prime PCR n E Case 1 • • Diagnostic referral; Expansion & point mutation analysis requested: Institute of Neurology: • GAA repeat flanking PCR; TP-PCR Clinical details: 52 year old female; No further details avaliable Case 1 F-PCR: 8 repeats Patient 1. 31 rpt control 2. Expansion control 3. Hom & Het normal controls 4. & 5. Molecular Genetic Testing Triplet-prime PCR: gaagaagaagaagaagaagaa cttcttcttcttcttcttcttcttctt Molecular Genetic Testing Triplet-prime PCR: gaagaagaagaagaagaagaa cttcttcttcttcttcttcttcttctt Molecular Genetic Testing Triplet-prime PCR: gaagaagaagaagaagaagaa cttcttcttcttcttcttcttcttctt Molecular Genetic Testing gaagaagaagaagaagaagaa cttcttcttcttcttcttcttcttctt gaagaagaagaagaagaagaa gaagaagaagaagaagaagaa gaagaagaagaagaagaagaa Case 1 TP-PCR: Case 1 Modified TP-PCR: Primers: FATP-P3-F-FAM FATP-P1-R FATP-P4-F GAA Int + FATP-P4-F GAG Int Case 1 Southern Blot: EcoRV FA3PEx1 Patient Normal E/E n/E 1. 2. 3. 4. Case 1 ? Clinical Significance: • Long GAA repeats tracts form abnormal ‘sticky’ triplex DNA structures; Case 1 ? Clinical Significance: • • Long GAA repeats tracts form abnormal ‘sticky’ triplex DNA structures; Inhibit transcription = reduced Frataxin protein • Interrupted alleles: • Triplexes less likely to form; Not predicted to inhibit transcription of Frataxin to the same extent as pure GAA repeats; Shorter in length (equivalent to alleles of 100-300 triplets); May be associated with late on-set disease (GAGGAA)n & (GAAAGAA)n interruptions may stabilise premutation alleles; May prevent expansion into abnormal size range Clear guidelines regarding the implications of these interruptions and their clinical significance have not been established Case 1 ? Clinical Significance: • Patient: 1 normal allele; 1 interrupted allele; No further mutations identified on sequence analysis • • Unlikely to be affected with FA; ? chance finding unrelated to the patient’s symptoms • Further work: • Sequence interrupted allele Detection of interrupted: May be difficult using standard TP-PCR; Requires contiguous run of GAA repeats Case 2 • Diagnostic referral: 53 year old female: Progressive cerebellar degeneration • F-PCR analysis identified an allele within the premutation range (~38 rpts); • TP-PCR analysis detected the presence of an expansion Case 2 Southern blot analysis: • Confirmed presence of an allele in the premutation size range & an expanded allele in the affected size range EcoRV FA3PEx1 Patient Normal E/E n/E 1. 4. 2. 3. Case 2 ? Clinical Significance: • Patient: • Premutation alleles: • 1 allele within premutation size range; 1 allele within affected size range; Identified in peripheral lymphocytes Not thought to affect transcription of the Frataxin gene; Not thought to be pathogenic; May show somatic instability • ? if a significant proportion of such alleles expand into the affected size range in appropriate tissues, this may lead to atypical disease; Increases the likelihood of a diagnosis of FA • Further work: Testing of other tissue types; Family studies Case 3 • Diagnostic referral: 10 year old child: Progressive ataxia, weakness, deteriorating motor skills, cerebellar dysfunction; Two GAA repeat expansions Mother identified as a carrier using standard testing strategy; • Southern blot analysis: 23 Kb - 9.4 Kb - EcoRV FA3PEx1 6.5 Kb - 4.3 Kb - 1 7 8 Case 3 • Diagnostic referral: 10 year old child: Progressive ataxia, weakness, deteriorating motor skills, cerebellar dysfunction; Mother identified as a carrier using standard testing strategy; • Modified TP-PCR Assay: Different locus specific P1-primer; No expansion detected Standard TP-PCR Modified TP-PCR Mother Father Case 3 • • DNA sequencing: Primers flanking the standard P1 priming site 30bp deletion: Covering the whole of the standard TP-PCR P1 priming site in the patient’s father and the affected child; Deletion present on the same allele as the expansion; Explains Motherwhy the expansion in the patient’s father could not be detected using standard TP-PCR Summary: Samples harbouring such a deletion would give results consistent with homozygosity Fatherfor the same size normal allele using these assays; Deletion would not be detected - potentially an expansion could be missed 115 FA referrals with 1 allele in the normal range and no TP-PCR expansion were testedchild for the presence of this deletionBreak point Affected No further deletions were identified in this cohort Likely that such a deletion is either very uncommon or private to this family Acknowledgements All within the molecular genetics laboratory Andrew Purvis Mohammed Kiron Kibria Kara Gaffing Fiona Coyne Roger Mountford Thank-you for listening