* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download Opportunities with USDA-ARS Locations in South Central Texas Kevin Temeyer
Herd immunity wikipedia , lookup
Innate immune system wikipedia , lookup
Vaccination wikipedia , lookup
Immunocontraception wikipedia , lookup
Psychoneuroimmunology wikipedia , lookup
Myasthenia gravis wikipedia , lookup
Social immunity wikipedia , lookup
Transmission (medicine) wikipedia , lookup
Sociality and disease transmission wikipedia , lookup
Plant disease resistance wikipedia , lookup
Opportunities with USDA-ARS Locations in South Central Texas Kevin Temeyer Knipling-Bushland U.S. Livestock Insects Research Laboratory, Kerrville, TX 78028 USDA-ARS Locations in Texas Kerrville (Moore Field & Panama), Temple, College Station, Bushland, Lubbock Pathogenic Landscape River willows Arundo donax Infested hosts Cattle Cattle fever tick Deer 1. Arundo and Guineagrass enhance survival of tick 2. Transition back to native vegetation--better biological barrier to ticks Racelis, A.E., R. B. Davey, J. A. Goolsby, A. A. Pérez de León, K. Varner, and R. Duhaime. 2012. Facilitative ecological interactions between invasive species: Arundo donax (Poaceae) stands as favorable habitat for cattle ticks (Acari: Ixodidae) along the USMexico border. Journal of Medical Entomology 49: 410-417. Nilgai Deployed Warfighter Protection Program Joint program between Dept. of Defense and Dept. of Agriculture Agricultural Research Service Identical residues Sand fly AChE Non-identical residues Target of organophosphate insecticides Unaligned residues Catalytic triad: Ser336, Glu462, His576 of P. papatasi sequence • Constructed rPpAChE1G119S by targeted mutagenesis containing Gly→Ser OP-R substitution (G256S) for biochemical characterization Alignment of PpAChE sequence to Drosophila melanogaster AChE (MMDB 1QO9) Partial PpAChE1 cDNA sequence containing G119S codon identified as OP-R in An. gambiae and other insects Ser OP-insensitive TGGATCTTCGGTGGTAGCTTCTACTCAGGAACATCCAC TGGATCTTCGGTGGTGGCTTCTACTCAGGAACATCCAC Gly OP-sensitive rPpAChE1 containing G119S codon OP-R in An. gambiae and other insects Ser OP-insensitive ATCTTCGGTGGTAGCTTCTACTCAGGAACATCC ATCTTCGGTGGTGGCTTCTACTCAGGAACATCC Gly OP-sensitive (wt) Biochemical properties of rPpAChE1 Propertya rPpAChE1 (OP-sensitive) rPpAChE1-G256S (OP-insensitive) Km AcSChb (μM) 24 98 (4-fold) IC50 Paraoxon (10-7 M) 2.9 3800 (1300-fold) IC50 Malaoxon (10-8 M) 4.4 2000 (455-fold) IC50 Eserine (10-9 M) 4.8 120 (25-fold) Continuing need for new pest control technologies Genomics Pest physiology Vaccines New, targeted pesticides Strategies for control of pest populations Strategies to prevent pathogen transmission by vectors Host animal resistance to parasites & disease Tick AChE Phylogram Ixodes scapularis predicted AChEs R. microplus BmAChEs Acetylcholinesterase - Target Site Insensitivity in R. microplus Three AChEs expresses in synganglion: BmAChE1, Km ≈ 4-5 μM BmAChE2, Km ≈ 40-50 μM BmAChE3, Km ≈ 90-100 μM BmAChE1, BmAChE2 & BmAChE3 are functional complements BmAChE1, BmAChE2 & BmAChE3 are amplified, expressing more than two transcript alleles Multiple amino acid substitutions were associated with resistance for each of the three BmAChEs Individual ticks maintained & expressed multiple alleles for each of the three BmAChEs Acetylcholinesterase target site insensitivity is multigenic in R. microplus Current studies – probable additional BmAChEs • • • Fsg186 (salivary) Tc19987 (gut) possible vaccine candidates? • Noteworthy opportunity to investigate host-parasite interaction (nervous/immune integration) • External collaborations with Univ. Florida, Virginia Tech., Southwest Research Institute (San Antonio), Mayo Clinic, Iowa State University Ixodes scapularis AChE phylogram R. microplus AChEs: BmAChE2 BmAChE3 BmAChE1 Proposed Role of Tick Salivary AChE Tick Salivary AChE: Tick Gut AChE: Detoxifies Bloodmeal Host factors Hydrolyzes acetylcholine in host tissues Alters acetylcholine activation of nicotinic and muscarinic receptors Parasite factors Pathogen factors Modulates host inflammatory response Modulates host innate immunity Modulates host acquired immunity Acetylcholinesterase: The Target of Organophosphates • AChE function Key synaptic enzyme in CNS Hydrolyzes neurotransmitter AcCh Regulation of Inflammation & Immune Response via local acetylcholine Detoxification of bloodmeal • OPs bind to and inhibit AChE Blocking nerve impulse transmission Desensitizes AcCh receptors • Mutations in AChE may lead to OP resistance Thank you for your attention!