Download The role of bright light as a protective mechanism against the

The role of bright light as a protective
mechanism against the development of
form-deprivation myopia in chickens
Cindy Karouta
Bachelor of Applied Science in Human Biology
Centre for Research in Therapeutic Solutions (CReST)
University of Canberra ACT 2601
A thesis submitted in partial fulfilment of the requirements for
the degree of Bachelor of Applied Science (Honours) at the
University of Canberra
February 2014
ii
Abstract
In normal ocular development, the axial length of our eye is matched to the refractive power
of the cornea and lens in a process known as emmetropisation, so that light rays emanating
from objects viewed at a distance are focused clearly on the retina, rather than in front or
behind it, with the accommodative system at rest. However, in the ocular disorder myopia
(short-sightedness), a form of ametropia (refractive error), there is a mismatch between the
axial length of the eye and the refractive power of the cornea and lens, so that now objects
viewed at a distance are focused in front of the retina, instead of on it, causing the image to
appear blurred.
Myopia has become a major health concern due to the rapid increase in prevalence across the
world, most notably in urban East Asia, where in places up to 80% of children are now myopic.
Recent epidemiological studies have reported that children who spend greater amounts of
time outdoors are less likely to develop myopia. It has been postulated that the protective
effects of time outdoors could be driven by higher retinal levels of the light-driven
neurohormone dopamine in response to the higher light intensities experienced outside. In
agreement with this hypothesis, animal studies have shown that daily exposure to high light
intensities can inhibit the development of experimental myopia with work in chicks showing a
reduction in the development of form-deprivation myopia (FDM) by roughly 60% in those
animals exposed daily to  15,000 lux, compared to the myopic shift seen in animals reared
under 500 lux. Following on from these findings, this study examined three major questions:
1. Does a correlation exist between the intensity of light in which animals are reared and
the degree to which the development of FDM is prevented?
2. Can exposure to bright light prevent the progression of FDM, or can it only affect the
onset of experimental myopia?
3. What are the biochemical pathways that underlie the protective effects of high light?
The findings of aim one demonstrate a strong logarithmic correlation between light intensity
and the development of FDM (F= 4.96, df= 35, 290, p< 0.0005), with the higher the light
intensity to which diffuser-fitted chicks were exposed (500 lux, 10,000 lux, 20,000 lux, 30,000
lux or 40,000 lux), the less relative myopic shift in refraction that was observed and the shorter
the axial length of the eye. By 40,000 lux, FDM was abolished, with no statistically significant
difference in refraction or axial length seen between the high light group and those values
seen in contralateral control (p=0.09) or age-matched untreated eyes (p=0.09).
iii
The findings of aim 2 showed that exposure to elevated light intensities (40,000 lux), which
were shown in aim 1 to abolish the development of FDM, can halt the progression of myopia.
Specifically, animals in which FDM was initially induced by rearing chicks, with translucent
diffusers, under illumination levels of 500 lux for a period of 3 days (Δ 4.89 D over 3 days),
showed no further progression when switched to daily exposure to 40,000 lux for a following 7
days (Δ0.63 D over 7 days), with the animals showing an initial relative hyperopic shift before
stabilising at around emmetropia.
The findings of aim 3 indicate a possible role for immediate early gene Egr-1 in lights protective
effects, with the down-regulation in Egr-1 mRNA levels normally observed in response to
diffuser-wear under 500 lux abolished by exposure to 40,000 lux.
Exposure to elevated light levels has a significant effect on the development of FDM over time,
with the onset of FDM abolished by 40,000 lux. Moreover, exposure to 40,000 lux can halt
further progression of FDM. Finally, the down-regulation in the mRNA levels of Egr-1 are
abolished by daily exposure to 40,000 lux, giving further evidence that it may be directly
involved in growth modulation.
v
Acknowledgements
Firstly I would like to thank my supervisor Dr Regan Ashby, for convincing me to undergo
honours and for his support and guidance throughout the year as well as always staying
patient with my numerous questions. Furthermore, I would like thank him for all the time
spent with me in the lab, explaining different techniques and helping me analyse results. I am
grateful for the invaluable skills I have gained from you this year. I would also like to thank my
secondary supervisor Dr Tamsin Kelly, for providing insightful intellect and for her proof
reading throughout the year.
A special thank you also goes out to:
-
Professor Arthur Georges for his help with the regression analysis
-
Dr Nicole Beard for her overall support and guidance
-
Everyone in the biomedical laboratory
-
The animal technicians, Jacqui and Wendy, for looking after the chickens on the
weekend
To my family and friends, thank you for your support and understanding throughout the year.
Special thank you goes to my fellow honours students, Tara Boulding, Christopher Sutton and
Rebecca Madden, for the numerous long days in the office and chats. Your company, and
most importantly your friendship, made this challenging year much more enjoyable.
And last but not least, thank you to all the chickens as without them this work would not have
been possible.
vi
Table of Contents
Chapter 1: Introduction ................................................................................................................ 1
1.1 General overview ................................................................................................................ 1
1.2 Eye Anatomy ....................................................................................................................... 2
1.2.1 Fibrous layer ................................................................................................................. 2
1.2.2 Vascular layer ............................................................................................................... 2
1.2.3 Neural layer .................................................................................................................. 2
1.3 Emmetropisation ................................................................................................................ 5
1.4 Myopia ................................................................................................................................ 7
1.5 Experimental Paradigms of Eye Growth ............................................................................. 7
1.5.1 Form-deprivation myopia............................................................................................. 7
1.5.2 Recovery from form-deprivation myopia ..................................................................... 8
1.5.3 Negative lens-wear .................................................................................................... 10
1.5.4 Positive lens-wear ...................................................................................................... 10
1.6 Considerations related to experimental paradigms ......................................................... 12
1.6.1 Positive and negative lenses worn alternately........................................................... 12
1.6.2 Effect of normal vision during lens wear .................................................................... 12
1.7 Eye growth ........................................................................................................................ 13
1.7.1 Ocular growth is visually guided ................................................................................ 13
1.7.2 Local mechanisms ...................................................................................................... 13
1.8 Environmental influences on ocular growth – near work ................................................ 14
1.9 Environmental influences on ocular growth – time outdoors .......................................... 15
1.9.1 High light and the development of myopia................................................................ 16
1.10 Changes in gene expression during recovery from form-deprivation myopia ............... 19
1.10.1 Dopamine ................................................................................................................. 19
1.10.2 Retinoic acid ............................................................................................................. 20
1.10.3 Glucagon .................................................................................................................. 21
1.10.4 Early growth response 1 (Egr-1)............................................................................... 21
1.10.5 cFos .......................................................................................................................... 22
1.11 Aims of the study ............................................................................................................ 23
Chapter 2: Methods ................................................................................................................... 25
2.1 Animal housing.................................................................................................................. 25
2.2 Experimental conditions ................................................................................................... 25
2.2.1 Induction of form-deprivation myopia (FDM) ............................................................ 25
2.2.2 Lighting conditions ..................................................................................................... 25
vii
2.3 Measurement of ocular parameters ................................................................................. 30
2.4 Tissue preparation ............................................................................................................ 32
2.5 Preparation of total RNA and reverse transcription to cDNA ........................................... 32
2.6 Real time RT-PCR............................................................................................................... 33
2.7 Primer specificity............................................................................................................... 33
2.8 Statistical analysis ............................................................................................................. 39
Chapter 3: Results ...................................................................................................................... 40
3.1 Changes in refraction over time in response to exposure to different light intensities ... 40
3.1.1 Refractive changes in age-matched control eyes over seven days in response to
different light intensities ..................................................................................................... 40
3.1.2 Refractive changes in contralateral control eyes over seven days in response to
different light intensities ..................................................................................................... 40
3.1.3 Refractive changes in diffuser-treated eyes over seven days in response to different
light intensities .................................................................................................................... 41
3.2 Changes in axial length over time in response to different light intensities .................... 49
3.2.1 Axial length changes in age-matched control and contralateral control eyes over six
days in response to different light intensities ..................................................................... 49
3.2.2 Axial length changes in diffuser-treated eyes over six days in response to different
light intensities .................................................................................................................... 49
3.3 Changes in refraction over time in response to transfer to high light.............................. 53
3.3.1 Refractive changes in contralateral control eyes over ten days in response to transfer
to high light ......................................................................................................................... 53
3.3.2 Refractive changes in diffuser-treated eyes over ten days in response to transfer to
high light ............................................................................................................................. 53
3.4 Changes in axial length over time in response to transfer to high light ........................... 57
3.4.1 Axial length changes in contralateral control eyes over nine days in response to
transfer to high light ........................................................................................................... 57
3.4.2 Axial length changes in diffuser-treated eyes over nine days in response to transfer
to high light ......................................................................................................................... 57
3.5 Molecular changes following one day of form-deprivation myopia in 40,000 lux ........... 59
Chapter 4: Discussion ................................................................................................................. 61
4.1 Exposure to high light intensities and the development of deprivation-myopia ............. 61
4.1.1 The effect of high light on lens-compensation ........................................................... 64
4.1.2 Possible mechanisms underlying the protective effects of time outdoors ................. 65
4.1.3 What are the relevant light intensities required to prevent deprivation-myopia? .... 66
4.1.4 The role of light intensity in human myopia .............................................................. 67
4.2 Once myopic, can progression be halted by exposure to elevated light intensities? ...... 68
viii
4.3 What biochemical pathways underlie the protective effects of high light? ..................... 69
4.3.1 Dopamine and tyrosine hydroxylase (TH) .................................................................. 69
4.3.2 Early growth response 1 (Egr-1) ................................................................................. 70
4.3.3 FBJ osteosarcoma oncogene (cFos)............................................................................ 71
4.3.4 Glucagon .................................................................................................................... 71
4.3.5 Retinoic acid (RA) ....................................................................................................... 72
Conclusion ............................................................................................................................... 73
References ................................................................................................................................. 74
ix
List of Tables
Table 1. Primer information ........................................................................................................ 37
Table 2. Primer efficiency ........................................................................................................... 38
Table 3. Refraction data for age-matched untreated control eyes for all light intensities ........ 43
Table 4. Refraction data for diffuser-treated and contralateral control eyes for all light
intensities .................................................................................................................................... 43
Table 5. Axial length data for age-matched untreated control eyes for all light intensities ...... 50
Table 6. Axial length data for diffuser-treated and contralateral control eyes for all light
intensities .................................................................................................................................... 50
Table 7. Changes in refraction for form-deprived animals exposed to 500 lux, 40,000 lux or
500/40,000 lux ............................................................................................................................ 55
Table 8. Changes in axial length for form-deprived animals exposed to 500 lux, 40,000 lux or
500/40,000 lux ............................................................................................................................ 58
x
List of Figures
Figure 1. Morphology of a vertebrate retina ................................................................................ 4
Figure 2.Myopic and Hyperopic defocus ...................................................................................... 6
Figure 3. Growth paradigms of FDM and recovery from FDM ..................................................... 9
Figure 4. The effect of positive and negative lenses on ocular growth ...................................... 11
Figure 5. Daily treatment cycle ................................................................................................... 27
Figure 6. Experimental design for attachment of translucent diffusers and retinal tissue
collection ..................................................................................................................................... 29
Figure 7. Image obtained by A-scan ultrasonography ................................................................ 31
Figure 8. RT-PCR melt (dissociation) curves analysis for the primer pairs of TH, β-actin and
HPRT ............................................................................................................................................ 35
Figure 9. RT-PCR melt (dissociation) curves analysis for the primer pairs of RAR-β, PPG, Egr-1,
DRD2 and cFos ............................................................................................................................ 36
Figure 10. Gel electrophoresis for all amplified gene products .................................................. 37
Figure 11. Primer efficiencies for DRD2, Egr-1, RAR-β, cFos, PPG and TH .................................. 38
Figure 12. Change in refraction, over seven days, in age-matched untreated control eyes
reared under different light intensities ...................................................................................... 44
Figure 13. Change in refraction, over seven days, in contralateral control eyes reared under
different light intensities............................................................................................................. 45
Figure 14. Change in refraction, over seven days, in form-deprived eyes reared under different
light intensities ............................................................................................................................ 46
Figure 15. Combined refractive data, over seven days, from form-deprived eyes reared under
different light intensities............................................................................................................. 47
Figure 16. Logarithmic non-linear regression curve of light intensity versus absolute change in
refraction over seven days.......................................................................................................... 48
Figure 17. Changes in axial length for age-matched untreated (A) and contralateral control (B)
eyes over six days under different light intensities .................................................................... 51
Figure 18. Changes in axial length for diffuser-treated eyes over six days under different light
intensities .................................................................................................................................... 52
Figure 19. Changes in refraction, over time, for form-deprived animals exposed to 500 lux,
40,000 lux or 500/40,000 lux ...................................................................................................... 56
Figure 20. Changes in axial length, over time, for form-deprived animals exposed to 500 lux,
40,000 lux or 500/40,000 lux ...................................................................................................... 58
Figure 21. Mean normalised expressions in fold change in mRNA levels of primers ................. 60
1
Chapter 1: Introduction
1.1 General overview
Myopia, or short sightedness, is a visual disorder in which a mismatch between the optical
powers of the eye and its axial length, due most commonly to excessive elongation of the eye
during development, causes objects viewed at a distance to appear blurred as they are focused
in front of the retina rather than on it. A rapid increase in myopia prevalence has been
observed, most notably in urban East Asia, where in parts greater than 80% of children are
myopic (Goh and Lam 1994, Matsumura and Hirai 1999, Wu, Seet et al. 2001, Lin, Shih et al.
2004, Qian, Chu et al. 2009, Shih, Chiang et al. 2009, Morgan, Ohno-Matsui et al. 2012, Jung,
Lee et al. 2012 ). Recently, a number of critical epidemiological studies have reported a strong
negative correlation between time spent outdoors and the development of myopia, with those
children who spend greater amounts of time outdoors less likely to become myopic (Mutti,
Mitchell et al. 2002, Jones, Sinnott et al. 2007, Rose, Morgan et al. 2008, Rose, Morgan et al.
2008, Dirani, Tong et al. 2009, Jones-Jordan, Mitchell et al. 2011, French, Morgan et al. 2013).
Rose et al. (2008) have postulated that this protective effect may be driven by light-stimulated
dopamine release from the retina associated with the higher illumination levels experienced
outdoors. In support of this hypothesis, animal studies have shown that the development of
experimental myopia can be retarded by daily exposure to high illumination levels (>15,000
lux), with animals reared under high illumination levels showing a less myopic refraction and
shorter eyes compared to those animals reared under normal laboratory illumination levels
(500 lux) (Ashby, Ohlendorf et al. 2009, Ashby and Schaeffel 2010, Siegwart, Ward et al.
2012). Furthermore, the protective effects of bright light against the development of formdeprivation myopia (FDM) can be abolished by the administration of a dopamine D2 receptor
antagonist, spiperone, suggesting that the protective effects of bright light are, to some extent,
driven by retinal dopamine (Ashby and Schaeffel 2010).
In chickens, exposure to 15,000 lux for a period of five hours per-day retards the development
of FDM by roughly 60% (Ashby, Ohlendorf et al. 2009). This study will examine whether greater
protection is afforded with higher light intensities (ranging from 10,000 – 40,000 lux).
Furthermore, this study will determine whether high light levels are only effective at
preventing/retarding the onset of experimental myopia, or whether they can affect the
progression of FDM. Finally, this study will begin to elucidate the possible biochemical
pathways underlying the protective effects of bright light, by investigating the role of
2
candidate systems previously postulated to play a role in the regulation of ocular growth,
including: dopamine, Egr-1, cFos, glucagon, and retinoic acid.
1.2 Eye Anatomy
The eyeball sits within a bony socket (orbit) of the skull. The wall of the eye is composed of
three main layers: outer fibrous layer (sclera), intermediate vascular layer (choroid) and inner
neural layer (retina).
1.2.1 Fibrous layer
The fibrous layer is the outer-most layer of the eye and consists of the sclera and cornea. The
white opaque sclera is a fibrous shell of collagenous, fibroblast maintained connective tissue,
and is composed of different collagen fibrils, glycosaminoglycans (GAG) and matrix proteins
(McBrien 2003). The sclera provides protection to the delicate intraocular structures beneath,
and provides a stable attachment site for muscles involved in accommodation and eye
movement. In addition, the sclera facilitates vascular and neural access to underlying
intraocular structures, allowing the optic nerve to exit the eye and major vessels to enter
(Kandel, Schwartz et al. 2000, McBrien and Gentle 2003). In other species, such as chickens,
the sclera contains both a fibrous and cartilaginous layer (Kusakari, Sato et al. 1997).
Anteriorly, the sclera is attached with the cornea and forms a closed shell around the eye
(McBrien and Gentle 2003). The cornea is a transparent collagenous tissue that allows light to
enter the eye and forms its major refractive surface accounting for two thirds of the optical
power (Kandel, Schwartz et al. 2000).
1.2.2 Vascular layer
The choroid, together with the ciliary body and the iris forms the uvea, or the intermediate
vascular layer. The choroid contains an extensive vascular and lymphatic network that supplies
nourishment and oxygen for the retina and retinal pigment epithelium (RPE) (De Stefano and
Mugnaini 1997).
1.2.3 Neural layer
The neural layer is the inner-most layer of the eye and consists of the retina and a thin outer
pigment epithelium (Bear, Connors et al. 2007). The retina contains five major neuronal cell
types, the light-responsive rod and cone photoreceptors, bipolar cells, horizontal cells,
amacrine cells and ganglion cells. Cones are responsible for day vision, while rods mediate
night vision as they are extremely sensitive to light. Photoreceptors make direct contact with
bipolar cells that in turn directly contact ganglion cells (the most direct pathway through the
3
retina). Horizontal cells do not make direct contact with bipolar cells; instead, they synapse on
photoreceptors and are electrically coupled with one another through gap junctions, laterally
influencing bipolar cells (Bear, Connors et al. 2007). Amacrine cells are the most diverse
neuronal cell type of the retina based on morphology, size, retinal coverage and
neurochemical makeup, with between 30 to 40 distinct types postulated (Kandel, Schwartz et
al. 2000, Bear, Connors et al. 2007). Amacrine cells receive input from bipolar cells, as well as
other amacrine cells, and project laterally to influence surrounding ganglion, bipolar and
amacrine cells (Kandel, Schwartz et al. 2000, Bear, Connors et al. 2007) (figure 1.1). Ganglion
cells are the only source of output from the retina and fire action potentials in response to
light (Bear, Connors et al. 2007). Axons of ganglion cells form the optic nerve, which projects
towards the visual cortex within the brain, via the lateral geniculate nucleus (Bear, Connors et
al. 2007).
The RPE lies between the photoreceptors and vascular choroid, providing nutrients and
maintenance to the photoreceptors, while also acting as a barrier to ions and most molecules.
The RPE contains black pigment, composed of melanin, which absorbs stray light, therefore
preventing image degradation (Kandel, Schwartz et al. 2000, Bear, Connors et al. 2007).
The retina is composed of five distinct layers. Three of these layers contain the neural cell
bodies (the outer nuclear layer, inner nuclear layer and ganglion cell layer), while the
remaining two layers, the outer plexiform layer and the inner plexiform layer, contain the cell
processes and synapses that occur between the different neuronal cells (figure 1.1). The outer
most layer (outer nuclear layer), which abuts the RPE, contains the cell bodies of the
photoreceptor cells. The inner nuclear layer contains cell bodies of bipolar, horizontal and
amacrine cells, while the ganglion cell layer, as the name suggests, contains the ganglion cell
bodies. The retina contains two intermediate layers, the outer plexiform layer (positioned
between outer and inner nuclear layers) where photoreceptors make synaptic contact with the
bipolar and horizontal cells, and the inner plexiform layer (located between the inner nuclear
layer and ganglion cell layer), where synaptic contact is made between bipolar, amacrine and
ganglion cells (Bear, Connors et al. 2007).
The most direct pathway from the eye to the brain is from the photoreceptors to the ganglion
cells via bipolar cells. Light entering the neural tissue must first pass through all layers of the
retina before reaching the photoreceptors.
4
Figure 1. Morphology of a vertebrate retina
The outer nuclear layer, inner nuclear layer and ganglion cell layer, contain the neural cell bodies while
the outer plexiform layer and the inner plexiform layer, contain the cell processes and synapses that occur
between the different cell types. The pigment epithelium lies between the photoreceptors and the
choroid, providing nutrients to the photoreceptors. Light must pass through all layers of the retina before
reaching the photoreceptors. From there the most direct pathway from the eye to the brain is from the
photoreceptors to the ganglion cells, via the bipolar cells, where the signal is propagated along the optic
nerve towards the higher visual centres in the brain.
(Ashby 2007)
5
1.3 Emmetropisation
During development, the axial length of the eye is slowly matched to the optical power of the
cornea and lens in a process referred to as emmetropisation (Wallman, Adams et al. 1981). In
an emmetropic eye, light rays emanating from an object viewed at a distance are focused
clearly on the retina when the accommodative system is at rest, resulting in perfect vision (no
refractive error, figure 1.2 A), if one discounts optical aberrations. An eye in which the focal
plane and the retina are misaligned due to a mismatch between the axial length and optic
power is referred to as being ametropic, with the two most common forms being hyperopia
and myopia. Hyperopia (long-sightedness) refers to the refractive condition in which the axial
length of the eye is too short for the optical powers, causing the focal plane to fall behind the
retina. Most commonly, this is due to the rate of axial elongation being too slow, rather than
an excessive decrease in optical power (figure 1.2 C). Conversely, myopia (short-sightedness)
refers to a refractive condition in which the axial length of the eye is too long for the optical
powers, causing the focal plane to fall in front of the retina (figure 1.2 B). Again, this is
commonly associated with excessive axial elongation rather than alterations in the optical
power of the eye. Humans, like most other mammals, are, for the most part, born hyperopic.
However, during development, the eye slowly moves towards emmetropia (Morgan 2003,
Zadnik, Mutti et al. 2004, Cohen, Belkin et al. 2011).
During development, emmetropisation is actively regulated by vision-dependent processes, so
that the rate of eye growth is continuously adjusted to match the natural reduction in optical
power seen during development (Brown, Koretz et al. 1999, Morgan 2003) (figure 1.2 A).
Emmetropia is maintained by matching the rate of lens thinning and corneal flattening with
the rate of elongation of the eye during normal development (Brown, Koretz et al. 1999,
Zadnik, Mutti et al. 2004, Mutti, Mitchell et al. 2005). If however, the eye reaches a length to
which the lens cannot further thin, it will result in a mismatch between the axial length of the
eye and the optical powers of the eye (ametropia), therefore leading to the development of
myopia (Wildsoet and Wallman 1995) (figure 1.2 B).
6
Figure 2.Myopic and Hyperopic defocus
(A) Emmetropia. The axial length of the eye is matched to the focal length of its optical powers.
(B) Myopia. The axial length of the eye is too long compared to the optical powers and therefore
images of objects viewed at a distance fall in front of the retina, instead of on it.
(C) Hyperopia. The axial length of the eye is too short for its optical powers and therefore images of
objects viewed at a distance fall behind the retina, instead of on it.
(Figure adjusted from Ashby 2007)
7
1.4 Myopia
Myopia has emerged as a major public health concern due to the rapid increase in prevalence
rates across the world, most notably in urban East Asia (Morgan, Ohno-Matsui et al. 2012),
more specifically Singapore (Wu, Seet et al. 2001), China (He, Zeng et al. 2004, Qian, Chu et al.
2009), Hong-Kong (Goh and Lam 1994), Taiwan (Lin, Shih et al. 2004, Shih, Chiang et al. 2009),
Japan (Matsumura and Hirai 1999) and Korea (Jung, Lee et al. 2012 ), where between 80 and
90% of school-leavers are myopic (Morgan, Ohno-Matsui et al. 2012). This epidemic however,
is also emerging in other parts of the world, perhaps not at the same rate, including the United
States (Kempen, Mitchell et al. 2004, Vitale, Ellwein et al. 2008, Vitale, Sperduto et al. 2009)
and probably in Europe (Logan, Davies et al. 2005, Jobke, Kasten et al. 2008), where the
prevalence of myopia in young adults is now between 30 and 50%. Even though myopia can
be easily corrected by glasses, contact lenses and even refractive surgery, the rapid prevalence
of myopia around the world poses a major health concern as the World Health Organisation
(WHO) recognises if myopia is not fully corrected, it is a major cause of visual impairment
(Resnikoff, Pascolini et al. 2008). Moreover, roughly 10-20% of the myopic children can be
characterised as high myopes (≤ -6D), which increase their risk of developing chorio-retinal
diseases (Leske, Chylack et al. 1991, Vongphanit, Mitchell et al. 2002, Chou, Yang et al. 2007,
Resnikoff, Pascolini et al. 2008, Marcus, de Vries et al. 2011, Morgan, Ohno-Matsui et al. 2012)
such as an increased risk of retinal detachment (Chou, Yang et al. 2007) and other potentially
blinding pathologies that are not prevented by optical corrections (Saw, Gazzard et al. 2005).
1.5 Experimental Paradigms of Eye Growth
Four experimental paradigms have been extensively used to study eye growth in animal
models by altering their visual experience:
1- Form-deprivation myopia
2- Recovery from form-deprivation myopia
3- Negative lens-wear
4- Positive lens-wear
1.5.1 Form-deprivation myopia
Normal ocular development appears to be visually guided. If a clear visual image is obscured
(loss of form-vision) through the attachment of a translucent diffuser over the eye, or through
suturing the eye lids closed, excessive axial elongation, as well as thinning of the choroid, will
8
occur resulting in form-deprivation myopia (FDM) (figure 1.3 A) in all animals studied (For
review see Wallman and Winawer 2004). During the development of FDM, the eye appears to
go into a “default” mode of excessive growth (Nickla 2013), in what appears to be an attempt
to compensate for the visual blur by moving the retina backwards. This is achieved by rapid
thinning of the choroidal tissue and a slower, but more powerful response, of increasing the
rate of axial elongation. As the visual blur associated with the translucent diffusers is not
compensated for by increased axial growth (i.e. no end-point, creating an opened-looped
system), the eye will continue to elongate for as long as the loss of form-vision remains and/or
developmental plasticity remains (Wallman and Adams 1987). Choroid thinning is observed
within 1 hour of diffuser wear in chickens, while increased axial lengthening is measurable
within 24 hours (Kee, Marzani et al. 2001, Nickla 2013).
1.5.2 Recovery from form-deprivation myopia
Following the induction of FDM, if the diffusers are removed, myopic blur is experienced (the
image falls in front of the retina, figure 1.3 B). To regain sharp focus, the retina is displaced
forward to where the new image plane falls, by rapid thickening of the choroid and cessation
of axial elongation (Wallman and Winawer 2004) (figure 1.3 C). Such changes in the rate of
axial elongation, along with the continual loss of optical power during development, ultimately
corrects for the refractive errors experienced.
9
Figure 3. Growth paradigms of FDM and recovery from FDM
(A) Fitting of translucent diffuser results in loss of form-vision. The eye attempts to
compensate by increasing the rate of axial elongation and choroidal thinning.
(B) Removal of diffusers results in myopic blur due to the excessive axial elongation
associated with the previous diffuser-wear. The focal plane falls in front of the retina,
instead of on it.
(C) Recovery from FDM occurs through rapid choroidal expansion (dark blue region) and
through a reduction in the rate of axial elongation. These two processes, combined with
the natural loss of optical power over time, allows the image plane to once again fall on
the retina.
(Figure adjusted from Ashby 2007)
10
1.5.3 Negative lens-wear
The rate of eye growth can be modulated by fitting lenses over the eye of animals to create
either myopic or hyperopic defocus. Negative lenses push the focal plane of viewed images
behind the retina by reducing the optical power of the eye causing hyperopic defocus
(Schaeffel, Troilo et al. 1990, Smith and Hung 1999)(figure 1.4 A). This induces increased axial
growth and a rapid thinning of the choroid in attempt to pull the retina backwards towards the
new focal plane to regain emmetropia (Kee, Marzani et al. 2001, Morgan 2003) (figure 1.4 B).
This paradigm is also referred to as lens-induced myopia (LIM), and along with FDM, is used to
study biochemical changes that occur during periods of increased ocular growth, although
some differences exist between these two paradigms including the time course of axial length
changes and the biochemical markers involved (Wallman and Winawer 2004). LIM is referred
to as a closed-looped system, as a specific end-point (target refraction) exists. In contrast, FDM
is referred to as an open-looped system, as there is no set end-point (target refraction) to
achieve, therefore, the eye will continue to elongate for as long as the diffusers remain
attached and/or developmental plasticity remains (Kee, Marzani et al. 2001). LIM induces
faster changes in axial length, as well as the synthesis of proteoglycans needed for scleral
growth (Kee, Marzani et al. 2001).
1.5.4 Positive lens-wear
Fitting of positive lenses suppresses eye growth similar to that seen during recovery from FDM
(Wildsoet and Wallman 1995, Hung, Wallman et al. 2000), although in the positive lens
paradigm the eye starts off in a normal state. As with the recovery paradigm, positive lenses
cause the image plane to fall in front of the retina by increasing the optical power of the eye,
therefore causing myopic defocus (Schaeffel, Glasser et al. 1988, Irving, Sivak et al. 1992)
(figure 1.4 A). The eye compensates by reducing the rate of axial elongation and by pushing
the retina forward through rapid choroidal thickening. These processes, combined with the
natural reduction in the eyes optical power over time, allow the image plane to once again fall
on the retina (Wallman, Wildsoet et al. 1995, Wildsoet and Wallman 1995) (figure 1.4 B). This
paradigm is also referred to as lens-induced hyperopia (LIH) as hyperopic defocus would be
experienced if the lenses were to be removed.
11
Focal
point
Negative lens
Positive lens
A)
Negative lens
Positive lens
B)
Figure 4. The effect of positive and negative lenses on ocular growth
Negative lenses push the focal plane of viewed images behind the retina by reducing the
optical power of the eye causing hyperopic defocus (A). In attempt to compensate, increased
axial length and choroidal thinning occurs to push the retina back, therefore regaining sharp
focus (B). Positive lenses cause the image to fall in front of the retina by increasing the optical
power of the eye causing myopic defocus (A). In attempt to compensate, the rate of eye
growth is decreased and choroidal thickening occurs to move the retina forward, therefore
regaining sharp focus (B).
(Figure adjusted from Ashby 2007)
12
1.6 Considerations related to experimental paradigms
During lens-wear, the eye compensates for the imposed optical defocus. When removing the
lens following full compensation, the eye experiences a refractive error directly opposite to the
original defocus imposed on the eye (Kee, Marzani et al. 2001). As mentioned above, positive
lenses impose a myopic defocus, leading to the suppression of eye growth (“STOP” growth
signal) (Irving, Callender et al. 1991, Hung, Crawford et al. 1995, Irving, Callender et al. 1995,
Backhouse and Phillips 2010). However, when the lens is removed, the eye is functionally
hyperopic (Kee, Marzani et al. 2001). On the other hand, negative lenses impose a hyperopic
defocus leading to eye growth (“GO” growth signal) (Shaikh, Siegwart et al. 1999, Siegwart and
Norton 2001). When the lens is removed, the eye is myopic (Kee, Marzani et al. 2001). These
changes affect the rate of eye growth as well as choroidal thickening to allow the retina to be
moved to the new focal plane to correct the imposed defocus (Brown, Koretz et al. 1999).
1.6.1 Positive and negative lenses worn alternately
Wearing positive and negative lenses alternately do not cancel out the refractive errors
imposed by either of the lenses. Instead, positive lenses have a dominant effect when equal
amounts of positive and negative lenses are worn (Winawer and Wallman 2002). Even when
chicks are exposed to negative lenses for five times more than positive lenses, Winawer and
Wallman (2002) have shown that the responses were dominated by positive lenses. This
suggests that myopic defocus, imposed by positive lenses, results in a stronger growth
response than hyperopic defocus. This therefore implies that eye growth is more susceptible
to stimuli producing a “STOP” growth signal rather than to “GO” growth signals.
1.6.2 Effect of normal vision during lens wear
The development of FDM can be retarded by the removal of diffusers for short periods of time
(Wallman and Adams 1987, Napper, Brennan et al. 1995, Napper, Brennan et al. 1997, Ashby,
Ohlendorf et al. 2009). Napper et al. (1995, 1997) have shown that the daily removal of
diffusers, for as little as 15 minutes per day, significantly reduces the development of myopia.
This retardation is enhanced when diffusers are removed while the animals are exposed to
higher ambient illumination (Ashby, Ohlendorf et al. 2009). This suggests that eye growth is
affected by periods of normal vision as it can almost entirely block the stimulation of eye
growth induced by fitting of diffusers, therefore preventing the development of myopia.
13
1.7 Eye growth
1.7.1 Ocular growth is visually guided
As discussed above, animal studies have indicated that ocular growth is visually guided, as
imposed myopic or hyperopic defocus through the use of negative and positive lenses
respectively, induces changes in ocular growth that compensate the imposed refractive error
(Schaeffel, Glasser et al. 1988). The eye compensates for these refractive errors by rapid
alterations in the rate of axial elongation of the eye and choroidal thickness, as discussed
above. This suggests that the eye can detect visual defocus/blur, through an as yet unknown
mechanism, and adjusts the growth rate to achieve emmetropia accordingly. The fitting of
translucent diffusers, causing a loss of clear visual cues, leads to uncontrolled axial elongation
of the eye (Wallman and Adams 1987). Furthermore, the fitting of diffusers or lenses over only
one half of the eye, providing a defocus signal to only one half of the retina, induces
compensatory growth changes in only that half of the eye. This further demonstrates that the
eye is responding directly to the visual blur experienced in a very localised manner (Wallman,
Gottlieb et al. 1987, Wallman and Winawer 2004).
1.7.2 Local mechanisms
Eye growth does not appear to be centrally regulated by the higher visual cortices in the brain,
but rather locally driven by retinal pathways. Animal studies have demonstrated that gross
compensation for lens-wear and the responses to diffuser-wear are relatively unaffected if the
optic nerve is severed, action potentials of the ganglion cells are blocked, or if the EdingerWestphal nucleus (nucleus of the oculomotor nerve supplying the eye muscles) is destroyed
(Troilo, Gottlieb et al. 1987, Wildsoet and Wallman 1995, Schmid and Wildsoet 1996). This
suggests higher visual centres are not required, although compensation is not as precise,
indicating that accommodation and higher visual centres are required for fine tuning of the
process (Wildsoet 2003). Furthermore, as described earlier, if only the nasal or temporal
region of the eye is exposed to FDM or negative lens-wear, only that region shows
compensatory changes in ocular growth in chicks, guinea pigs and monkeys (Wallman, Gottlieb
et al. 1987, McFadden 2002, Smith, Huang et al. 2009, Smith, Hung et al. 2010, Zeng and
McFadden 2010), which is indicative of a very localised response that is not easily explained by
a centrally driven mechanism (Wallman, Gottlieb et al. 1987). In support of this conclusion,
localised changes in ocular growth, in response to nasal or temporal defocus, still occurs
following optic nerve sectioning (Wallman, Gottlieb et al. 1987). The compensation to positive
lenses still occurs after optic nerve section (Wildsoet and Wallman 1995) with choroidal
thickening, the initial stage of compensation, occurring in local retinal areas (Wallman,
14
Wildsoet et al. 1995), although the development of FDM is suppressed with lenses (Wildsoet
and Wallman 1995). Together these findings suggest that visually-induced changes in the rate
of ocular growth are mainly driven by local retinal mechanisms.
1.8 Environmental influences on ocular growth – near work
Epidemiological studies have reported a correlation between years of schooling, educational
achievement and the development of myopia (Shulkin and Bari 1986, Teasdale, Fuchs et al.
1988, Chow, Dhillon et al. 1990, Saw, Katz et al. 1996), is believed to be associated with the
accommodative demand associated with heavy levels of near-work tasks such as reading.
Supporting this hypothesis are two lines of evidence. Firstly, a number of studies have
demonstrated a correlation between educational achievement and myopia prevalence (Chow,
Dhillon et al. 1990, Lin, Shih et al. 1996, Woo, Lim et al. 2004), with young adult populations
that undertake intense study (e.g. medical school) showing a rapid increase in myopia
prevalence over their study period (Midelfart, Aamo et al. 1992, Lin, Shih et al. 1996, Fledelius
2000, Onal, Toker et al. 2007). Secondly, native populations that previously lived an outdoor
life style, such as the Inuit or native American Indians, have had a dramatic increase in the
prevalence of myopia after the introduction of compulsory education within one generation
(Bear 1991). It has been hypothesised that the high levels of near-work associated with
intensive study could either: place excessive strain on the accommodative system, as the
ciliary muscles must be continuously contracted during near-work tasks; or during near-work
tasks the eye will receive a level of hyperopic defocus that although reduced by the
accommodative system, is not abolished due to the negative feedback by which
accommodation is controlled (McCarty and Taylor 2000, Mutti, Mitchell et al. 2002, Saw, Chua
et al. 2002). However, such accommodative strain could be reduced through elongation of the
eye (myopia development), and therefore removing the accommodative strain. This excessive
accommodation theory has been supported by the finding that fitting negative lenses, which
induce continuous hyperopic defocus and a large accommodative load, results in elongation of
the eye (Schaeffel, Glasser et al. 1988, Irving, Callender et al. 1991, Irving, Sivak et al. 1992,
Irving, Callender et al. 1995, Wildsoet and Wallman 1995, Schmid and Wildsoet 1996).
However, a consistent correlation between near-work and the development of myopia has not
been seen in studies that have attempted to specifically quantify hours of near-work
undertaken (Rose, Morgan et al. 2008). Findings from animal studies have also suggested the
accommodative system is not required for visually-guided emmetropisation, as compensation
for lens-wear, or the increased growth associated with diffuser-wear, can still occur without an
active accommodative system (Wallman, Gottlieb et al. 1987, McFadden 2002, Smith, Huang
et al. 2009, Smith, Hung et al. 2010, Zeng and McFadden 2010). Secondly, atropine, which
15
initially was believed to block the development of myopia by manipulating the accommodative
system, has since been shown to work through a, as yet unknown, non-accommodative
mechanism (McBrien, Moghaddam et al. 1993). Furthermore, if diffusers or lenses are fitted
only on one half of the retina, only that half shows changes in growth rates (Wallman, Gottlieb
et al. 1987, McFadden 2002, Smith, Hung et al. 2010, Zeng and McFadden 2010), a response
difficult to explain via a system driven by accommodation.
1.9 Environmental influences on ocular growth – time outdoors
Evidence from both cross-sectional and longitudinal data suggests that children who spend
more time outdoors are less likely to develop myopia (Parssinen and Lyyra 1993, Mutti,
Mitchell et al. 2002, Khader, Batayha et al. 2006, Chou, Yang et al. 2007, Jones, Sinnott et al.
2007, Onal, Toker et al. 2007, Rose, Morgan et al. 2008, Rose, Morgan et al. 2008, JonesJordan, Mitchell et al. 2011, Marcus, de Vries et al. 2011, Guggenheim, Northstone et al. 2012,
Sherwin, Hewitt et al. 2012). It was first established in 1993 in a cohort of Finnish school
children that spending greater time outdoors was associated with less myopic refraction
(Parssinen and Lyyra 1993). This was confirmed by the Orinda Longitudinal Study of Myopia
(OLSM) in the United States, which reported that children that became myopic were
significantly less involved with outdoor activities compared to the children who remained
emmetropic (Mutti, Mitchell et al. 2002). A follow-up study by the authors examined two age
cohorts and found a higher rate of myopia development in those children that spent less time
outdoors. The authors suggested that this may be due to children who spend more time
outdoors are less involved in near-work activity. A later cross-sectional study (Sydney Myopia
Study, SMS), conducted in 2008, reported that total time spent outdoors, rather than time
engaged in sports per se, was negatively correlated with the development of myopia (Rose,
Morgan et al. 2008). Rose et al. (2008) reported that children who spent the most amount of
time outdoors combined with low levels of near-work had the most hyperopic mean
refraction, while those children that combined limited time outdoors with high levels of nearwork had the least mean hyperopic refraction. These studies were primarily based on
populations of European origin, although similar protective effects have been reported in a
sample of children of East Asian origin (Dirani, Tong et al. 2009, Guo, Liu et al. 2013, Xiang,
Zeng et al. 2013). In general, the negative correlation between time outdoors and the
development of myopia has now been confirmed by numerous studies from various
geographical locations (Parssinen and Lyyra 1993, Mutti, Mitchell et al. 2002, Khader, Batayha
et al. 2006, Jones, Sinnott et al. 2007, Onal, Toker et al. 2007, Jones-Jordan, Mitchell et al.
2011, Guggenheim, Northstone et al. 2012, Sherwin, Hewitt et al. 2012), although not always
(Saw, Wu et al. 2001, Saw, Shankar et al. 2006, Lu, Congdon et al. 2009, Low, Dirani et al.
16
2010). Clinical trials are currently underway in China (Yi and Li 2011) and Taiwan (Wu, Tsai et
al. 2013) associated with increasing the time spent outdoors by children during the school day,
with preliminary findings showing promising results.
Initially, it was suggested that the protective effects associated with time outdoors may simply
be a substitution effect, in which the more time children spend outdoors the less time they
spend on near-work tasks such as reading, which has previously been correlated with the
development of myopia. However, Rose and colleagues (2008) reported that a less myopic
refraction was still observed in children who engaged in significant amounts of near-work if
combined with greater amounts of time outdoors, suggesting this is not a substitution effect
(Rose, Morgan et al. 2008). Instead, the authors hypothesised that the reduced prevalence of
myopia seen in those children that spend greater amounts of time outdoors could be
associated with light-induced increases in retinal dopamine release, a neurohormone
previously postulated to be involved in the regulation of ocular growth, associated with the
higher illumination levels experienced outdoors. In support of this hypothesis, seasonal
differences in the progression rates of myopia have been found with higher rates in winter
compared to summer (Goss and Rainey 1998, Fulk, Cyert et al. 2002, Donovan, Sankaridurg et
al. 2012, Fujiwara, Hasebe et al. 2012, Cui, Trier et al. 2013, Gwiazda, Deng et al. 2014).
However, it is unclear if this seasonal affect is associated with high illumination levels seen
during summer, or due to more near-work being undertaken in the winter months (Rose,
Morgan et al. 2008, Gwiazda, Deng et al. 2014).
1.9.1 High light and the development of myopia
Although renewed interest has been generated in the role of light in ocular development,
based on the protective effects of time spent outdoors, considerable work has already
demonstrated that alterations in the lighting conditions (rhythmicity, intensity and spectral
composition) in which animals are reared, can significantly affect ocular development. Early
work by Lauber and colleagues (1979), amongst others (Stone, Lin et al. 1995, Li and Howland
2000, Li and Howland 2003), demonstrated that rearing chicks, although not primates (Smith,
Bradley et al. 2001), in continuous illumination produces vitreal chamber enlargement both in
the axial and equatorial direction. Conversely, it induces a hyperopic shift in refraction due to
thickening and flattening of the cornea, as well as shallowing of the anterior chamber (Stone,
Lin et al. 1995, Li and Howland 2000, Li and Howland 2003). Similar ocular changes have been
observed in response to constant dark-rearing, suggesting that circadian and diurnal rhythms
are critical to ocular development. More recently, the illumination levels to which chicks are
exposed during the light phase have been shown to be critical. For example, the unilateral
17
rearing of chicks under low illumination levels (<50 lux) during the light phase, using neutral
density filters, can induce a myopic shift due to excessive vitreal chamber elongation, although
the results are less consistent when the illumination of the entire room is dropped by a similar
amount (Gottlieb, Fugate-Wentzek et al. 1987). Finally, ocular development can be altered by
rearing animals under monochromatic light due to compensation for longitudinal chromatic
aberrations (a failure to focus all colours in a spectrum to the same convergence point due to
difference in their wavelengths) (Kroger and Wagner 1996, Seidemann and Schaeffel 2002).
Specifically, emmetropisation has been considered thus far with respect to a single focal plane;
however, in practice, polychromatic light is not focused as a single plane on the retina; rather,
it displays a point spread function created in part by chromatic aberrations (for review see
Rucker 2013). This inherent property of our optical system means that shorter wavelengths
(e.g. blue) are refracted (converged) to a greater extent than longer wavelengths (e.g. red),
creating multiple focal planes around the retina, with the eye focused to the midpoint within
that animals visible spectral range. Consequently, rearing chickens in monochromatic red
light, in which the focal plane falls normally behind the retina, induces a relative myopic shift in
refraction (increased axial elongation), compared to those chickens reared in monochromatic
blue light, in which the focal plane would naturally fall in front of the retina (Kroger and Binder
2000, Rucker and Wallman 2008).
In response to the reported protective effects provided by time outdoors against the
development of myopia, a number of animal studies have recently investigated the ability of
high light levels to alter normal ocular growth and to prevent the development of
experimental myopia (Cohen, Belkin et al. 2008, Ashby, Ohlendorf et al. 2009, Ashby and
Schaeffel 2010, Norton, Amedo et al. 2010, Cohen, Belkin et al. 2011, Cohen, Peleg et al. 2012,
Smith, Hung et al. 2013).
Ashby and colleagues (2009, 2010) have shown that exposure to elevated light levels of 15,000
lux for a period of 5 hours per day retards the development of FDM by roughly 60%, through a
reduction in the rate of axial elongation, compared to those animals fitted with translucent
diffusers and reared under normal laboratory lighting levels of 500 lux. Similar results have
since been reported in tree shrews (Norton, Amedo et al. 2010, Siegwart, Ward et al. 2012)
and rhesus monkeys (Smith, Hung et al. 2012), suggesting that this is a maintained mechanism.
As with chicks, following the fitting of translucent diffusers, tree shrews exposed to
illumination levels of 15,000 lux for 7.5 hours per day, over a period of 10 days, showed an
approximately 60% reduction in the development of FDM compared to those animals reared
with attached translucent diffusers under 500 lux (Siegwart, Ward et al. 2012). In rhesus
monkeys, the protective effect was greater than that observed in chicks, with eight of the ten
18
monkeys that were fitted with translucent diffusers and exposed to 18-28,000 lux for five
hours per day, developing no myopia and actually showing a small hyperopic shift which was
associated with shorter vitreal chambers (Smith, Hung et al. 2012). The enhanced protective
effects seen in the primates may be associated with the greater light intensities used,
therefore, one of the primary aims of this study is to determine if, in chicks, greater protection
comes with greater light intensities (e.g. do light intensities above 15,000 lux (the current
maximum intensity previously studied) have a greater protective effect?). Supporting the
hypothesis that the development of FDM may be retarded to a greater degree with higher
light intensities, Ashby et al. (2010) have shown that the protective effects of brief periods of
normal vision (15 minutes daily) against the development of FDM is more pronounced when
higher light intensities are used during this diffuser-free period (15 minutes of diffuser-free
vision: under 500 lux lead to a 40% reduction; under 15,000 lux resulted in 65% reduction; and
under 30,000 lux lead to 80% reduction in FDM development) (Ashby, Ohlendorf et al. 2009).
Furthermore, Cohen et al. (2011) have reported that the normal emmetropisation process in
chicks appears to be intensity dependent. In chicks, during normal refractive development, the
eye displays a postnatal hyperopic refraction which reduces significantly towards emmetropia
over the first eight weeks (Wallman, Adams et al. 1981). Cohen and colleagues (2011) have
reported, however, that this emmetropisation process is dependent, to some extent, on light
intensity. Over a period of 90 days, the refractive development of chicks was observed when
exposed to one of three light intensities (50 lux, 500 lux or 10,000 lux). Those chicks reared
under 50 lux showed a myopic refraction by day 90. Those chicks raised under the medium
light intensity of 500 lux were emmetropic by day 90, while those chicks reared under higher
light levels of 10,000 lux remained mildly hyperopic from 60 days onwards. This suggests that
light levels in which the animals are reared under can affect ocular development and
emmetropisation, such that lower illumination levels can induce a myopic shift, while high
levels actually hold the eye in a hyperopic state, at least over the first 90 days of life (Cohen,
Belkin et al. 2011).
Ashby and colleague (2010) have also shown that exposure to elevated light levels of 15,000
lux for a period of 5 hours per day reduced the rate of compensation for negative lenses and
enhances the rate of compensation for positive lenses, although in both cases full
compensation for the lenses is still achieved. Similar to that observed in chicks, exposure to
high light reduces the rate of compensation for negative lenses in tree shrews, with full
compensation to 5 D lenses taking 17.5 days in those animals exposed to 15,000 lux,
compared to 9 days for full compensation in those animals kept under 500 lux (Siegwart, Ward
et al. 2012). However, high light exposure would appear not to affect the rate of negative lens
19
compensation in primates (Smith, Hung et al. 2013), although a subsequent much smaller
study by Stell and colleagues (2013) has suggested that there may be a small effect.
1.10 Changes in gene expression during recovery from form-deprivation myopia
Animal models have significantly contributed to our understanding of the biochemical
pathways that underlie the visually-guided regulation of ocular growth. As discussed above,
ocular growth appears to be locally controlled by signals that originate in the retina. To begin
to elucidate the pathways underlying the protective effects of light, this study examines the
role of specific components of four of the major molecular pathways postulated to be critical
to ocular growth regulation, including: dopamine, retinoic acid, glucagon, and nuclear
transcription factors. Specifically, this study will examine possible changes in the retinal mRNA
expression, in response to high light, of the dopamine components; tyrosine hydroxylase (TH)
(rate-limiting enzyme) and dopamine D2 receptor (DRD2); the retinoic acid receptor isoform
beta (RAR-β); pre-pro-glucagon (PPG); and the nuclear transcription factors Egr-1 and cFos.
1.10.1 Dopamine
The seminal paper by Stone et al. (1989) reported a reduction in the levels of retinal dopamine
and its primary metabolite 3, 4 dihydroxyphenylacetic acid (DOPAC), with any form of visual
deprivation (lit suture, translucent and transparent goggles). A reduction in the activity of the
rate limiting enzyme of dopamine synthesis, TH, was observed indicating a decreased rate of
dopamine synthesis (Stone, Lin et al. 1989). This finding was confirmed by more direct
measures of dopamine release, that of vitreal DOPAC levels (Megaw, Morgan et al. 2001).
Administration of dopamine agonists, targeting the dopamine receptor families (D1 and D2),
have been shown to alter the rate of ocular growth, providing the strongest evidence for a role
for the dopaminergic system in the visually guided modulation of eye growth. Initial studies
demonstrated that administration of the non-selective dopamine receptor agonist,
apomorphine (APO), reduces axial elongation associated with lid-suturing (Stone, Lin et al.
1989, Iuvone, Tigges et al. 1991, Rohrer, Spira et al. 1993, Schmid and Wildsoet 2004, Nickla,
Totonelly et al. 2010, Dong, Zhi et al. 2011). This effect was abolished, however, by the coadministration of the dopamine antagonist haloperidol, suggesting the pharmacological effects
were driven specifically by the dopaminergic system, with similar finding reported in rhesus
monkeys (Iuvone, Tigges et al. 1991). Rohrer et al. (1993) demonstrated that the effects of
apomorphine were blocked by the co-administration of the dopamine D2 receptor antagonist
spiperone, but not by the dopamine D1 receptor antagonist SCH-23390, suggesting that
apomorphine acts to prevent FDM through the D2-family of receptors. The development of
both FDM and LIM can be retarded by the administration of a number of dopamine agonists
20
including 2-amino-6,7-dihydroxy-1,2,3,4-tetrahydronaphthalene hydrobromide (ADTN) (Ashby,
McCarthy et al. 2007, McCarthy, Megaw et al. 2007) and quinpirole (McCarthy, Megaw et al.
2007, Nickla, Totonelly et al. 2010) in chicks, and the development of FDM by administration of
synthetic dopamine (Gao, Liu et al. 2006, Lin, Chen et al. 2008), or its precursor levodopa (LDOPA) (Mao, Liu et al. 2010) in guinea pigs.
Importantly for this study, the daily administration of the dopamine D2 receptor antagonist
spiperone has been shown to abolish the protective effects of bright light against the
development of deprivation-myopia (Ashby and Schaeffel 2010), suggesting, as originally
hypothesised by Rose and colleagues (2008), exposure to high light levels may protect against
the development of myopia through light-induced increases in retinal dopamine release.
1.10.2 Retinoic acid
Retinoic acid (RA) is the metabolite of vitamin A and it plays a crucial role during early retinal
development, affecting the proliferation and differentiation of several types of ocular cells,
such as retinal pigment epithelial cells and corneal endothelial cells (Junquero, Modat et al.
1990, Kirschner, Ciaccia et al. 1990, Patek and Clayton 1990, Campochiaro, Hackett et al.
1991), as well as chondrocytes (Lewis, Pratt et al. 1978, Pacifici, Golden et al. 1991). In mice
lacking retinoic acid receptors, the eyes are small with gross morphological defects within the
choroid and sclera, and display retinal dysplasia (Grondona, Kastner et al. 1996). Furthermore,
in chickens and mice, RA appears to be important in dorsal-ventral patterning of the retina
(McCaffery, Lee et al. 1992, Mey, McCaffery et al. 1997). Inhibition of RA synthesis during
development, when only the ventral enzyme is present, results in eyes lacking ventral retinas
as well as other ocular malformations such as lens defects (Jung, Lee et al. 2012 ). RA acts
through a family of retinoic acid receptors (RAR) which consist of three isoforms (RAR-α, RAR-β
and RAR-γ) that act as ligand activated transcription factors (Marill, Idres et al. 2003).
Following the attachment of translucent diffusers, inducing deprivation-myopia, RA expression
within the retina has been shown to significantly increase in the chicken sclera (Seko,
Shimokawa et al. 1996, Seko, Shimizu et al. 1998, Bitzer, Feldkaemper et al. 2000).
Administration of RA to guinea pigs and chicks causes a rapid increase in axial elongation
(McFadden, Howlett et al. 2004, McFadden, Howlett et al. 2006) while it decreases scleral
glycosaminoglycan synthesis and increases vitreous chamber length in marmosets that are
monocularly form-deprived (Troilo, Nickla et al. 2006). Furthermore, the loss of form vision
through the attachment of translucent diffusers leads to a significant increase in retinal-RA
levels after 7 days in guinea pigs. This increase doubled after 14 days when compared to the
contralateral control values (Huang, Qu et al. 2011).
21
Retinoic acid receptor- β (RAR-β) mRNA levels have also been reported to be up-regulated in
the chicken sclera (Seko, Shimokawa et al. 1996, Seko, Shimizu et al. 1998, Bitzer, Feldkaemper
et al. 2000). Following 7 days of FDM, there was no significant difference in expression in the
mRNA levels or RAR-β in guinea pigs, although the difference was significant after 14 days for
both FDM and negative lens-wear compared to control values (Huang, Qu et al. 2011). RAR-α
has previously been shown to be strongly expressed in the retina (Mattei, Riviere et al. 1991,
Mori, Ghyselinck et al. 2001). However, Veerappan and colleagues (2009) observed no
association between RAR-α and myopia.
Animal models have therefore suggested a role for RA in the modulation of eye growth,
although human genome-wide association studies (GWAS) have not found an association to
date between components of the RA system and high myopia (Verhoeven, Hysi et al. 2013).
However, due to the limitations of human genetic studies, the lack of findings from GWAS by
no means precludes a role for RA in the regulation of ocular growth.
1.10.3 Glucagon
Glucagon is a neuropeptide, produced by the cleavage of its precursor molecule pre-pro
glucagon (PPG), that is synthesised and released from a subset of retinal amacrine cells
(glucagoneric amacrine cells) (Hasegawa, Terazono et al. 1990). The precise role of this
neuropeptide is unclear, however, evidence has suggested that it plays a significant role in the
regulation of ocular growth. Firstly, like Egr-1, glucagon mRNA levels show a bi-directional
response to opposing growth stimuli, with transcript levels down-regulated during periods of
increased ocular growth induced by translucent diffusers, and increased transcript levels are
seen during periods of decreased ocular growth induced by the removal of translucent
diffusers or the fitting of positive lenses (Feldkaemper, Burkhardt et al. 2002, Buck, Schaeffel
et al. 2004, Feldkaemper, Burkhardt et al. 2004, Ashby, Kozulin et al. 2010). Secondly, injection
of the glucagon agonist Lys 17, 18, Glu 21- glucagon can retard the development of FDM or LIM in
a dose dependent manner (Feldkaemper and Schaeffel 2002, Vessey, Lencses et al. 2005),
while the glucagon antagonist [des-His1, Glu9]-glucagon-NH2, was found to prevent LIH (Vessey,
Lencses et al. 2005), suggesting that endogenous glucagon may act as a “STOP” growth signal.
It should be noted, however, that glucagon expression has not been detected within the
mammalian retina.
1.10.4 Early growth response 1 (Egr-1)
Egr-1, known as ZENK (ZIF268, Egr-1, NGFI-A, or Krox-24) in the chicken, is an immediate-early
gene that codes for a short-lived nuclear transcription factor (Fischer, McGuire et al. 1999).
22
Egr-1 has been implicated in the modulation of ocular growth due to its bi-directional response
to opposing growth stimuli, and is the earliest known molecular change. At the peptide level,
Fischer et al. (1999) have demonstrated that Egr-1 levels within glucagonergic amacrine cells
show a bi-directional response to opposing growth stimuli. That is, during periods of increased
ocular growth, stimulated by the fitting of either translucent diffusers or negative lenses, costaining for Egr-1 within glucagoneric amacrine cells is significantly reduced within one hour.
Conversely, in response to the removal of diffusers, co-staining for Egr-1 within glucagoneric
amacrine cells is significantly elevated, again within as little as one hour. Similar changes are
seen at the mRNA level, with Ashby et al. (2007, 2010), demonstrating that Egr-1 transcript
levels are rapidly down-regulated (within 30-60 minutes) during periods of increased ocular
growth, and remain down-regulated as long as growth rates are elevated above control values.
Once growth rates return to normal, such as when the animal has compensated for the
imposed hyperopic defocus associated with negative lens-wear, Egr-1 mRNA levels also return
to normal control values. Conversely, during recovery from FDM, Egr-1 mRNA levels are
rapidly, but transiently, up-regulated, confirming the bi-directional response of Egr-1 to
opposing growth stimuli (Fischer, McGuire et al. 1999, Ashby, McCarthy et al. 2007). Similar bidirectional changes in Egr-1 mRNA levels have been seen within guinea pigs in response to
negative lens-wear (increase ocular growth), and the removal of negative lenses (recovery,
reduced ocular growth) (Ashby, Zeng et al. 2011). Further, Egr-1 mRNA levels have been
reported to be down-regulated in the mouse retina in response to diffuser-wear (Schippert,
Burkhardt et al. 2007), and appear to display a bi-directional response at the peptide level in
primate retina to opposing growth stimuli (Zhong, Ge et al. 2004), although, due to the limited
animal number the results are not clear. More direct evidence for a role for Egr-1 in regulation
of ocular growth comes from two studies. Firstly, Egr-1 knockout mice show a relative myopic
shift compared to wild-type control animals (Schippert, Burkhardt et al. 2007). Secondly,
pharmacological agents which block the development of experimental myopia, such as the
dopamine D2 receptor agonist 2-amino-6,7-dihydroxy-1,2,3,4-tetrahydronaphthalene
hydrobromide (ADTN) and the muscarinic-cholinergic antagonists atropine and prinzepine,
prevent the down-regulation in Egr-1 mRNA levels normally seen after one hour in response to
diffuser-wear (Ashby, McCarthy et al. 2007) or negative lenses (Ashby, Kozulin et al. 2010) in
chicks. Together, these results suggest that a down-regulation in Egr-1 expression is associated
with an increase in the rate of ocular growth and the development of myopia.
1.10.5 cFos
FBJ osteosarcoma oncogene (cFos) is a light-driven immediate early gene that belongs to the
family of nuclear transcription factors to which Egr-1 also belongs. It has been suggested that
23
cFos is involved in the regulation of diurnal transcriptional changes that occur during normal
light/dark cycles in retinal cells (Yoshida, Kawamura et al. 1993). The expression of cFos has
been found to be transiently expressed in the rat retina in the inner nuclear layer (INL) and
ganglion cell layer (GCL) after the onset of light, while it was expressed in the outer nuclear
layer (ONL) during the dark (Yoshida, Kawamura et al. 1993). Ohki et al. (2013) showed that
the diurnal variations in cFos expression are not detected in rats in the first 10 days, but were
observed at 15 days post birth. Another indication that cFos is light-induced is due to the
finding that photosensitive retinal ganglion cells express cFos following light stimulation in
mice lacking the photopigment melanopsin (Dong, Zhi et al. 2011).
Although the retinal expression of cFos has been found to be light-induced, and was therefore
used within this study primarily as a marker of light-induced activity, evidence exists for a role
for cFos in the regulation of ocular growth. Fischer and colleagues (1999) have reported that
cFos peptide levels, within the chicken retina, appear to be unaffected by the onset of FDM.
However, staining for cFos is rapidly enhanced during recovery from FDM within a specific
subset of retinal amacrine cells not positive for glucagon, vaso intestinal peptide (VIP), tyrosine
hydroxylase (TH), choline acetyltransferase or somatostatin. The authors noted that when
diffusers were removed but immediately replaced with neutral density filters to match the
change in luminance experienced, cFos expression was still elevated, but to a lesser extent
compared to diffuser-wear, suggesting that cFos, unlike Egr-1, may be responding to a change
in illumination levels rather than to a specific blur signal. Furthermore, the authors reported
no change in cFos immunostaining in response to positive-lens wear. However, three later
independent microarray studies have reported a significant down-regulation in cFos mRNA
levels in response to both the fitting of translucent diffusers and negative lenses, suggesting
that cFos may respond to defocus cues (Brand, Schaeffel et al. 2007, Schippert, Schaeffel et al.
2008, Ashby and Feldkaemper 2010).
1.11 Aims of the study
As mentioned earlier, the development of myopia can be retarded by exposing animals to
elevated light levels. The development of FDM in chicks is retarded by roughly 60% when
animals are exposed to 15,000 lux for 5 hours per day (Ashby and Schaeffel 2010). Current
treatments of human and animal myopia can only prevent or retard the onset of myopia but
do not affect the progression. Therefore this study aimed to investigate whether bright light
can halt the progression of FDM in myopic animals. Moreover, molecular analysis has indicated
key pathways implicated in the development of myopia and the role of this study was to
24
further investigate the molecular pathways that underpin the protective effects of high light.
Therefore the three aims of the study were:
1. Is there a correlation between the light intensities in which animals are raised and the
severity of deprivation-myopia which develops?
2. Can exposure to bright light (40,000 lux) prevent the progression of deprivationmyopia?
3. What biochemical pathways are associated with the protective effects of high light?
25
Chapter 2: Methods
2.1 Animal housing
One day-old male White Cockerels were obtained from Barter & Sons Hatchery (Luddenham,
NSW, Australia). On arrival, chickens were housed in temperature-controlled rooms under a
12:12 hour light/dark cycle with lights on at 7 am and off at 7 pm. Chickens had access to
unlimited amounts of food and water, and were given four days to become accustomed to
their environment before experiments started. Authorisation to conduct experiments using
animals was approved by the University of Canberra Animal Ethics Committee under the ACT
Animal Welfare Act 1992 (Project Number: CEAE 13-03) and conformed to the ARVO
Resolution on the Use of Animals in Ophthalmic and Vision Research.
2.2 Experimental conditions
2.2.1 Induction of form-deprivation myopia (FDM)
Myopia was induced monocularly by fitting translucent diffusers over the left eye, with the
right eye left untreated and serving as a contralateral internal control. Velcro mounts were
fitted around the left eye with Loctite® super glue (Henkel, Düsseldorf, Germany) on the day
prior to the commencement of the experiment. On the following day, the translucent
diffusers, fitted to matching Velcro rings, were placed onto the mounts.
2.2.2 Lighting conditions
Aim 1: Is there a correlation between light intensity and the development of formdeprivation myopia over time?
To investigate the correlation between light levels, and the development of FDM, chicks were
raised for a period of 7 days with translucent diffusers, under one of the following five lighting
conditions (figure 5):
1) 40,000 lux (n=12, group 1)
2) 30,000 lux (n=12, group 2)
3) 20,000 lux (n=12, group 3)
4) 10,000 lux (n=12, group 4)
5) 500 lux (n=12, normal indoor light, group 5)
Changes in ocular parameters were compared to contralateral control values, as well as an
untreated age-matched control group (n=12, group 6) that were raised with no diffusers under
26
normal laboratory illumination levels (500 lux) as a reference for normal ocular development
(figure 5 A). Chicks in the high light groups (groups 1-4), were exposed to these intensities for a
period of six hours per day (11 am- 5 pm, figure 5 B), while being kept under normal laboratory
lighting levels for the remainder of the light period (7 am-11 am and 5 pm-7 pm).
Illumination of the cages was produced by a custom-made bank of 10 LED lamps, with an
illumination angle of 60˚, that were adjusted by a dimmer system on a linear scale between 045,000 lux (Electronics Department, Research School of Biology, Australian National
University). Each of the 10 LED lamp banks were composed of an equal mix of cool (400-650
nm, peaking at 450 nm) and warm (430-700 nm, peaking at 630 nm) LED modules, generating
minimal to no heat load, even at maximum intensity, and giving a final spectral composition
similar to that produced by quartz-halogen bulbs, which were previously used to generate high
light levels (Ashby, Ohlendorf et al. 2009, Ashby and Schaeffel 2010) but which suffered from
generating a significant heat load. The lighting system did not emit in either the infra-red (IR)
or ultraviolet (UV) spectrum. Illumination levels were uniform across the cage area, as
measured by an IL1700 Research Radiometer (International Light, Inc., Chula Vista, CA, USA),
with the lighting system sitting 1.5 metres above the cage roof. Cages were placed against the
wall, allowing the chicks a viewing distance of 5 metres in three directions. All reported
luminance used in this study were measured at the level of the cage floor, with lighting levels
continuously monitored within the cages by an automated system using HOBO data loggers
(HOBO ® Data Loggers, Bourne, MA, USA).
27
Groups 5 and 6
Groups 1-4
Figure 5. Daily treatment cycle
(A) Experimental design for those chickens fitted with translucent diffusers (group 5), or agematched untreated control animals (group 6), and reared under 500 lux.
(B) Experimental design for those chickens fitted with translucent diffusers (groups 1-4) and
reared under one of four higher illumination levels (40,000 lux (group 1), 30,000 lux
(group 2), 20,000 lux (group 3), 10,000 lux (group 4)).
Translucent diffusers were fitted to all animals at 7 am on day 1.
28
Aim 2: Can high light prevent the progression of form-deprivation myopia?
To investigate whether the progression of FDM, through excessive axial elongation, could be
prevented, chickens were raised under normal laboratory lighting levels (500 lux) for a period
of three days to induce myopic refractions. Following myopia induction, chicks were switched
to daily high light exposure (40,000 lux for six hours per day) for the remainder of the
experimental period (7 days). More specifically, chickens were split into five groups and
treated for a total of 10 days:
1) Chickens were raised under 500 lux without diffusers (control group 1, n= 12)
2) Chickens were exposed to 40,000 lux for six hours per day, without diffusers (control
group 2, n=12)
3) Chickens were fitted with translucent diffusers and raised under 500 lux (FDM group,
n=12)
4) Chickens were fitted with translucent diffusers and exposed to 40,000 lux for six hours
per day (high light group, n=12)
5) Chickens were fitted with translucent diffusers and raised under 500 lux for three days,
after which chicks were switched to daily exposure of 40,000 lux for six hours per day,
for a further 7 days (FDM progression group, n=12)
Aim 3: To elucidate the biochemical pathways associated with the ability of bright light to
retard the development of form-deprivation myopia
To begin elucidating the biochemical pathways underlying the ability of bright light to retard
the development of FDM, chickens were split into two groups:
1) Chickens were fitted with translucent diffusers and raised under 500 lux (group A, n=5)
2) Chickens were fitted with translucent diffusers and exposed to 40,000 lux for six hours
per day (group B, n=5)
Translucent diffusers were fitted at 7 am on day 1 for both groups, with all animals sacrificed
at 1 pm on day 2, 2 hours into the second high light phase, with retinal samples collected from
both the treated (left) eye and the contralateral control (right) eye (figure 6).
29
Experimental design
Figure 6. Experimental design for attachment of translucent diffusers and retinal tissue collection
(A) For chickens fitted with translucent diffusers (7 am, day 1) and reared under 500 lux (group A).
(B) For chickens fitted with translucent diffusers (7 am, day 1) and reared under 40,000 lux for six hours
per day (group B).
Animals from both groups were sacrificed at 1 pm on day 2, 2 hours into the second high light phase,
with retinal tissue collected from both the treated (left) eye and the contralateral control (right) eye.
30
2.3 Measurement of ocular parameters
Refraction was measured daily at 9 am by automated infrared photoretinoscopy (system
provided courtesy of Professor Frank Schaeffel, University of Tuebingen, Germany).
Measurements were taken from both the experimental (left eye), contralateral control (right
eye), and age-matched untreated control eyes (both left and right). Refraction represents the
mean spherical equivalent of 10 measurements per eye. For a myopic eye, the camera only
detects light rays emerging from the lower part of the pupil, while for a hyperopic eye it
detects light rays emerging from the upper part of the pupil. The amount of defocus of the eye
can be calculated by the height of the light crescent in the pupil (Schaeffel, Hagel et al. 1994).
For a correct refractive value to be obtained, the Purkinje image must be centred within the
pupil (correct refractive axis), with the illumination levels within the room kept to less than 5
lux to prevent light reflections in the pupil from aberrant sources, which would cause the
software to erroneously estimate the Purkinje image and therefore calculate an incorrect
refractive value. To account for possible accommodation, the most consistent hyperopic value
was recorded (Schaeffel, Hagel et al. 1994).
Axial length was measured on day 0, serving as a baseline, and on the second last day (day 6
(aim 1) or 9 (aim 2)) of the experimental period by A-scan ultrasonography (Biometer AL-100,
Tomey Corporation, Nagoya, Japan). An immersion attachment probe (Tomey Corporation,
Nagoya, Japan), filled with medical grade ultrasound gel (Conductive gel, Medical Equipment
Services, Keilor Park, VIC, Australia), was used to allow optimal contact to be made with the
eye. Ocular parameters measured included: anterior chamber depth (anterior surface of the
cornea to the anterior surface of the lens), lens thickness (anterior to posterior surface of the
lens), vitreal chamber depth (posterior surface of the lens to vitreal surface of the retina), axial
length (anterior surface of the cornea to the vitreal surface of the retina), for treated,
contralateral control and age-matched untreated eyes for Aims 1 and 2. Before commencing
ultrasound recordings, chickens were anaesthetised using isoflurane (5% in 1L of medical grade
oxygen per minute, Veterinary Companies of Australia, Kings Park, NSW, Australia), with
Allergan Tears Plus eye drops placed on the eye following the completion of all measurements
to prevent the eyes from drying out. Ten measurements were made from each eye which was
averaged to determine the ocular parameters listed above. An example output from A-scan
ultrasonography is shown in figure 7.
31
12 3
4
Figure 7. Image obtained by A-scan ultrasonography
Showing axial length (AXIAL), anterior chamber depth (ACD) and lens thickness
(LENS)
1) Anterior surface of the cornea
2) Anterior surface of the lens
3) Posterior surface of the lens
4) Vitreal surface of the retina
32
2.4 Tissue preparation
At the end of the experimental period, chicks were anaesthetised using isoflurane (5% in 1 L of
medical grade oxygen per minute) and sacrificed by decapitation. Each eye was rapidly
removed and hemisected equatorially, with the anterior portion of the eye discarded. The
posterior eye cup was floated in chilled phosphate-buffered saline (NaCl, 137mM; KCl, 2.7mM;
Na2HPO4, 11.3mM; KH2PO4, 1.5mM; pH 7.4) (Sigma-Aldrich, Castle Hill, NSW, Australia),
allowing removal and collection of retinal tissue, free of retinal pigment epithelium (RPE),
scleral and choroidal tissue. The tissue was immediately frozen on dry ice upon collection and
stored at -80˚C until use. Vitreous bodies were collected in 100 μL of 0.1% ascorbic acid
(Sigma-Aldrich, Castle Hill, NSW, Australia) and immediately frozen on dry ice and stored at 80˚C until use. Five retinal and vitreal samples were collected for each light group (n=5
experimental (left) eyes, and n=5 contralateral control (right) eyes. Five control samples, from
chickens that had no treatment, were also collected for each light group as described above.
Vitreal samples were collected to allow for the analysis of DOPAC levels, the strongest
measure of retinal dopamine release. However, the liquid chromatography-mass spectrometry
(LC-MS) system at the University required for undertaking such an analysis suffered numerous
catastrophic failures over the course of the study and therefore DOPAC levels could not be
measured in time for the printing of this thesis. However, the analysis of DOPAC in the vitreal
samples will occur in the near-future.
2.5 Preparation of total RNA and reverse transcription to cDNA
Total RNA was extracted from retinal tissue using a Trizol® / chloroform protocol following the
manufacturer’s instructions (Invitrogen (Life Technologies), Mulgrave, VIC, Australia). Briefly,
retinal tissue was homogenised in 400 µL of Trizol® reagent and left at room temperature for 5
minutes. Chloroform (100 µL) was gently added and mixed, with the samples incubated at
room temperature for a further 3 minutes before centrifugation at 12,000g at 4˚C for 10
minutes, using a CT 15 RT Versatile Refrigerated Centrifuge (Techcomp, Inc., Chesapeake, VA,
USA). The supernatant was collected into new Eppendorf© tubes to which equal volumes of
100% chilled isopropanol was added (roughly 400 µL), briefly mixed by pipetting, and left at
room temperature for 5 minutes. The samples were centrifuged under the same conditions as
described above for 10 minutes, after which the supernatant was removed, leaving a fine
pellet containing the total RNA. The pellet was washed with 200 µL of 75% ethanol and
immediately removed leaving the pellet to briefly air dry, before being dissolved in 50 µL of
nuclease free water (Qiagen, Venlo, The Netherlands) on a heat block at 70˚C for 1 minute.
33
Total RNA purity was quantified using a Nano drop spectrophotometer (BioLab, Mulgrave, VIC,
Australia). Total RNA was reverse-transcribed to first strand cDNA in a 20µL reaction using 4µL
5X VILO™ reaction mix, 2µL 10X SuperScript® Enzyme mix (Invitrogen by Life Technologies,
Carlsbad, CA, USA), and 1.5 µg of total RNA, with the final volume made to 20 µL using
nuclease free water (Qiagen). Reverse transcription to cDNA was undertaken with the
following conditions on a Mastercycler 5333 (Eppendorf, Hamburg, Germany) PCR machine: 10
minutes at 25˚C, 60 minutes at 55˚C, and 5 minutes at 85˚C. Samples were immediately frozen
at -20˚C until use.
2.6 Real time RT-PCR
Real-time reverse transcription PCR was undertaken using Fast SYBR green kit in a reaction
volume of 15 µL following the manufacturer’s protocol (Invitrogen (Life Technologies),
Mulgrave, VIC, Australia). Each reaction contained 1 µL of both the forward (0.5 µM) and
reverse (0.5 µM) primers, 1 µL of prepared cDNA ( 20 ng), 7.5 µL of 2X Fast SYBR Master Mix
(Life Technologies, Applied Biosystems, Mulgrave, VIC, Australia) and 5 µL of nuclease free
water (Qiagen). All reactions were run on a Stratagene Mx 3005P (Agilent Technologies,
Mulgrave, VIC, Australia). The PCR thermo cycling conditions included an initial denaturing
phase at 95˚C for 10 minutes, followed by 35 cycles of denaturation at 95˚C for 20 seconds,
annealing at 60˚C for 1 minute and finished with an extension phase at 95˚C for 1 minute.
2.7 Primer specificity
All primers used for the detection of specific gene products by RT-PCR were validated by meltcurve analysis (figure 8 and 9) and gel electrophoresis (figure 10). All primers produced a single
PCR product of expected size (figure 10 and table 1).
Gel electrophoresis was carried out using a 1% agarose gel (1 g of agarose was dissolved in a
final volume of 100 mL of 1x Tris-Acetate- EDTA (TAE) buffer, pH= 8). For each gene (primer
pair), 4 µL of amplified PCR product was added to a lane, with the control lane containing 5 µL
of Hyperladder I (200-10,000 base pairs) (Bioline, Alexandria, NSW, Australia) for size
determination. The gel ran at 100V for 30 minutes. Of the initial 17 genes that were prepared
for screening (figure 10), 6 were chosen for the subsequent use (table 1), which specifically
included: dopamine D2 receptor (DRD2), tyrosine hydroxylase (TH), Egr-1, cFos, glucagon and
retinoic acid receptor Beta (RAR-β), as well as the control genes β-Actin and hypoxanthine
phosphoribosyltransferase 1 (HPRT) (figures 8, 9 and table 1). The other eleven primers were
not used for the analysis due to time constraints and availability of cDNA and therefore,
34
priority was given to those genes that have previously shown a distinct change in expression
during the development of, or recovery from, FDM.
Primer efficiency (E) was determined from the slope of the curve generated through cDNA
dilution series (cDNA dilutions: 79.4 ng, 7.94 ng, 0.79 ng and 0.079 ng) (figure 11), using the
formula
(Pfaffl 2001) (table 2).
For determination of changes in transcript (mRNA) levels for each of the six target genes, the
Mean Normalised Expression (MNE) of each target gene was calculated separately for each
condition (treated and contralateral control) as previously described (Simon 2003, Ashby,
Kozulin et al. 2010). The MNE was calculated from the efficiency (E) of the target gene to the
power of its average threshold cycle (Ct) value (ECt, target), divided by the efficiency (E) of the
reference gene (β-Actin and HPRT) to the power of its average Ct value (ECt, reference) (Simon
2003), with the MNE converted into a fold change value for ease of representation (e.g. no
change in gene expression is represented by a fold change of 1, a 100% increase in gene
expression is represented by a fold change of 2 etc.).
35
HPRT
β-Actin
TH
Figure 8. RT-PCR melt (dissociation) curves analysis for the primer pairs of TH, β-actin and HPRT
Analysis of tyrosine hydroxylase (TH), beta actin (β-actin) and hypoxanthine phosphoribosyltransferase 1
(HPRT), indicating a single product was obtained
36
Egr-1
PPG
DRD2
RAR-β
cFos
Figure 9. RT-PCR melt (dissociation) curves analysis for the primer pairs of RAR-β, PPG, Egr-1,
DRD2 and cFos
Analysis of retinoic acid receptor beta (RAR-β), pre-pro glucagon (PPG), early growth response 1 (Egr-1),
dopamine D2 receptor (DRD2) and FBJ osteosarcoma oncogene (cFos), indicating a single product was
obtained
37
Table 1. Primer information
Information regarding each primer pair, including: GeneBank accession number, forward and reverse primer
sequences, as well as product size (bp). Both β-Actin and Hypoxanthine Phosphoribosyltransferase 1 (HPRT)
were used initially as control genes.
Gene
GenBank Acc.
Forward primer (5’-3’)
Reverse primer (5’-3’)
product
Product
size (bp)
TH
NM_204805.1
CAGAATGGGATAGTCAAAGC
TGTAGGGCTCGTATTTCACT
247
DRD2
NM_001113290.1
GTGGTCTATCTGGAGGTGGT
CTGTGTACCTGTCAATGCTG
133
RAR-β
NM_205326.1
GAAACTCAGAGCACCAGTTC
CACAAGCACTGACACCATAG
133
Egr-1
AF026082
ACTAACTCGTCACATTCGCA
TGCTGAGACCGAAGCTGCCT
241
PPG
NM_205260.1
AGCGTCATTCACAAGGCA
TCAGAATGACGCTTGGAAAT
184
cFos
NM_205508.1
AGGAGGAGGAAAAGAGGAG
CTTCAGCAGGTTGGCTATC
161
β –Actin
NM_205518.1
TAAGGATCTGTATGCCAACACAGT
GACAATGGAGGGTCCGGATTCATC
241
HPRT
NM_204848.1
TTACGACCTGGACTTGTTCT
GGGATTGACTTGTCACTGTT
234
Hyperladder I
(bp)
Hyperladder I
(bp)
TH
DRD1 DRD2 RARα RARβ GABA GABA GABA GAD iNOS nNOS eNOS CRABP Egr-1 cJun cFos PPG Β1
1
2
3
65
Actin
600 bp
400 bp
200 bp
Figure 10. Gel electrophoresis for all amplified gene products
A single product was obtained for each primer of expected band size(247, 133, 133, 241, 184, 161 and 241
bp for Tyrosine Hydroxylase (TH), Dopamine D2 receptor (DRD2), Retinoic acid receptor β (RAR-β), Early
growth response 1 (Egr-1), Preproglucagon (PPG), FBJ osteosarcoma oncogene (cFos)and β-Actin
respectively)
38
40.00
35.00
30.00
DRD2
Egr-1
Average Ct
25.00
RAR-B
20.00
cFos
PPG
15.00
TH
10.00
B-Actin
HPRT
5.00
-3.0
-2.0
0.00
-1.0
0.0
1.0
Log concentration (ng)
2.0
3.0
Figure 11. Primer efficiencies for DRD2, Egr-1, RAR-β, cFos, PPG and TH
Primers were run on RT-PCR with different cDNA concentrations (79.4 ng, 7.9 ng, 0.79 ng and 0.079
ng). The average Ct values were taken and plotted against the log concentration (ng) of cDNA to
obtain their slope to determine the efficiency shown in table 2
Table 2. Primer efficiency
Determined slope and efficiency (E) for each primer pair calculated from the formula
Gene product
Slope
Efficiency (E)
TH
-3.763
1.84
DRD2
-1.163
2.00
RAR-β
-3.493
1.93
Egr-1
-3.121
2.00
PPG
-3.450
1.95
cFos
-3.409
1.96
β Actin
-3.070
2.00
HPRT
-3.058
2.00
39
2.8 Statistical analysis
All results are presented as the mean ± the standard error of the mean. For the analysis of
changes in ocular parameters, a multivariate analysis of variance (MANOVA), with repeat
measures design, was used to compare between conditions (experimental, contralateral and
age-matched control) over time. A one-way ANOVA, followed by a student’s unpaired t-test,
with Bonferroni correction for multiple testing, was used to analyse between group values at
specific treatment times. Similarly, for analysis of changes in gene expression between
experimental, contralateral control and age-matched untreated control samples, a one-way
ANOVA, followed by a student’s unpaired t-test, with Bonferroni correction for multiple
testing, was used. All analyses were undertaken in SPSS (IBM, Armonk, NY, USA).
40
Chapter 3: Results
Aim 1: Correlation between light intensity and the development of form-deprivation myopia
over time
To assess whether there is a correlation between light intensity and the protective effects
afforded against the development of form deprivation-myopia, chicks were fitted with
translucent diffusers for a period of 7 days and exposed to one of five light intensities (500 lux
(group 5, mimicking the intensity experienced indoors), 10,000 lux (group 4), 20,000 lux (group
3), 30,000 lux (group 2) and 40,000 lux (group 1)). Refraction was measured daily for both
treated and untreated age-matched control animals. Axial length measurements were taken at
the start of the experimental period (day 0) as well as on the second last day (day 6) for both
treated and untreated age-matched control animals.
3.1 Changes in refraction over time in response to exposure to different light intensities
3.1.1 Refractive changes in age-matched control eyes over seven days in response to different
light intensities
Figure 12 and table 3 illustrate the data for refraction in age-matched control eyes. There was
no significant difference in the refractive development of chicks that were exposed daily, for
seven days, to one of four high-light intensities for six hours per day (10,000 lux (group 4),
20,000 lux (group 3), 30,000 lux (group 2) or 40,000 lux (group1)), or when compared to those
animals reared continuously under 500 lux (F= 2.18, df= 4, 0.51, p= 0.089).
3.1.2 Refractive changes in contralateral control eyes over seven days in response to different
light intensities
Figure 13 and table 4 show the data for refraction in contralateral control eyes. There was no
significant change in the contralateral control eyes of chicks fitted with translucent diffusers
and exposed daily, for seven days, to one of four high-light intensities for six hours per day
(10,000 lux, 20,000 lux, 30,000 lux or 40,000 lux) when comparing between the different highlight groups (F= 1.53, df= 4, 152, p= 0.066), or when compared to those animals reared
continuously under 500 lux (p= 0.32). Refractive development in contralateral control eyes also
did not significantly change over time compared to age-matched untreated control animals
under any light intensity (F= 1.406, df= 4, 0.47, p= 0.24).
41
3.1.3 Refractive changes in diffuser-treated eyes over seven days in response to different light
intensities
Figure 15 shows that, over time, light had a significant effect on myopic refractive
development in chicks fitted with translucent diffusers (F= 4.96, df= 35, 290, p< 0.0001).
Changes in refraction over time, in response to diffuser-wear, regressed strongly with light
intensity and were best modelled by a logarithmic relationship (figure 16) (y= -3.59 log10(x) +
17.52; r2= 0.95). The percentage variation explained by the regression was 95.0%. From this
analysis it can be seen that chickens raised in normal indoor light (500 lux) developed FDM to
the greatest extent (8.08 D over 7 days, final refraction 4.21  0.17 D), while those chickens
fitted with diffusers and exposed to 40,000 lux, for 6 hours per day, displayed a hyperopic
refraction value (0.78 D over 7 days, final refraction +3.97 0.11 D).
Consistent with previous studies, chicks with translucent diffusers reared continuously under
500 lux developed significant amounts of myopia (Δ8.08 D over 7 days), compared to either
their contralateral control eye (Δ0.09 D over 7 days; F= 596, df= 1, 729, p<0.0001) or agematched untreated values (Δ0.08 D over 7 days; F= 559, df= 1, 641, p<0.0001). Diffuser treated
eyes displayed a final refraction of 4.21 ± 0.17 D (figure 15 table 4), on day 7, which was
significantly different to that seen for the contralateral control eye (figure 13 E) (+3.78 ± 0.06
D; p<0.0001), or for age-matched untreated eyes (table 3) (+3.63 ± 0.21 D; p<0.0001).
Daily exposure to 40,000 lux for a period of 7 days, abolished the development of FDM, with
the refractive change seen in the 40,000 lux diffuser-treated group (Δ 0.78 D) showing no
statistical difference to the refractive changes seen in either contralateral control eyes (Δ0.05
D; F= 2.14, df= 1, 0.91, p= 0.09), or age-matched untreated eyes (Δ0.08 D; F= 2.74, df= 1, 0.61,
p= 0.11). In contrast, there was a significant difference in the refractive development of
diffuser treated eyes of chicks raised under 40,000 lux (Δ0.78 D) compared to myopic
refraction that developed in the treated eye of chicks raised under 500 lux (Δ8.08 D; F= 529,
df= 1, 591, p<0.0001). The diffuser treated eyes of chicks exposed to 40,000 lux daily displayed
a hyperopic refraction at the end of the experimental period (+2.97 ± 0.11 D) (figure 14 A) that
was not statistically dissimilar to the final refractive values seen in the contralateral control eye
(+3.70 ± 0.04 D, p=0.09) (figure 4) or age-matched untreated eyes (+3.48 ± 0.09 D, p=0.11)
(figure 12 A), but that was significantly different from the myopic refraction seen in the treated
eyes of birds kept under 500 lux (4.21 ± 0.17 D, p<0.0001).
Chickens raised under 30,000 lux showed the second highest reduction in the development of
FDM over 7 days (Δ 1.82 D), showing a final mean hyperopic refractive value of +2.06 ± 0.18 D
(figure 14 B) that was significantly different from the final myopic refraction of 4.21 ± 0.17 D
42
in the 500 lux treated group (p<0.0005). The final refractive values for chickens exposed to
30,000 lux were significantly different to age matched untreated animals (figure 12 B; +3.63 ±
0.14 D, p<0.0001) as well as to contralateral control values (figure 13 B) (+3.83 ± 0.06 D,
p<0.0001) as well as to chickens raised in 40,000 lux (+2.97 ± 0.11 D, p<0.02). The final
refraction of the 30,000 lux group was, however, not significantly different to those chickens
kept under 20,000 lux (+2.06 ± 0.18 D vs +1.60 ± 0.08 D, p= 0.26) (tables 3 and 4).
Daily exposure to 20,000 lux for 6 hours per day, was also protective against the development
of FDM (Δ2.38 D) compared to the refractive changes seen in the 500 lux group (8.08 D over
7 days; F= 124, df= 1, 188, p<0.0001). The protective effect of 20,000 lux over time (Δ2.38 D),
was not as powerful as that seen under either 40,000 lux or 30,000 lux, with a greater relative
myopic shift seen when compared to the refractive changes seen in either the contralateral
control eye ( Δ0.06 D; F= 338, df= 1, 64, p<0.001) or age-matched untreated eyes (Δ0.08 D; F=
316, df= 1, 60, p<0.001). Diffuser treated eyes, exposed to 20,000lux, displayed a final
refraction of +1.60 ± 0.08 D, on day 7 (figure 14 C), compared to +3.90 ± 0.12 D for the
contralateral control eye (figure 13 C), and +3.73 ± 0.32 D for age-matched untreated eyes
(figure 12 C) (tables 3 and 4).
Chickens exposed to 10,000 lux for a period of 6 hours per day, also showed significant
reduction in the development of FDM over time (Δ 3.41 D) compared to those animals reared
under 500 lux (Δ 0.08 D; F= 84.9, df= 1, 107, p<0.001).The protective effect of 10,000 lux over
time, however, was not as protective against the development of FDM as that of the other
high light intensities. Diffuser treated eyes displayed a final refraction of +0.43 ± 0.05 D, on day
7 (figure 14 D), compared to +3.87 ± 0.04 D for the contralateral control eye (figure 13 D)
(p<0.001), and +3.88 ± 0.06 D for age-matched untreated eyes (figure 12 D) (tables 3 and 4,
p<0.001).
43
Table 3. Refraction data for age-matched untreated control eyes for all light intensities
Refraction (RE, n=12) for age-matched untreated control animals for all light intensities
Treatment
Control
Control
Control
Control
Control
LI
(lux)
40,000
30,000
20,000
10,000
500
RE
Day 0
3.73
3.61
3.97
3.87
3.71
RE
Day 1
3.72
3.56
3.97
3.86
3.59
RE
Day 2
3.66
3.65
4.05
3.82
3.66
RE
Day 3
3.64
3.67
3.78
3.87
3.60
RE
Day 4
3.70
3.64
3.78
3.88
3.73
RE
Day 5
3.59
3.61
3.68
3.88
3.65
RE
Day 6
3.61
3.68
3.45
3.88
3.73
RE
Day 7
3.48
3.65
3.73
3.88
3.63
Change RE
0.25
0.04
0.24
0.01
0.08
Table 4. Refraction data for diffuser-treated and contralateral control eyes for all light intensities
Refraction (RE, n=12) for diffuser-treated and contralateral control eyes for all light intensities
Treatment
Constant Diff.
Contralateral
Constant Diff.
Contralateral
Constant Diff.
Contralateral
Constant Diff.
Contralateral
Constant Diff.
Contralateral
Untreated
LI
(lux)
40,000
40,000
30,000
30,000
20,000
20,000
10,000
10,000
500
500
500
RE
Day 0
3.75
3.75
3.88
3.88
3.98
3.96
3.83
3.84
3.87
3.87
3.71
RE
Day 1
3.56
3.76
2.98
3.84
2.40
3.79
2.28
3.83
2.00
3.94
3.59
RE
Day 2
3.38
3.76
2.61
3.81
1.95
3.77
1.40
3.86
1.28
3.95
3.66
RE
Day 3
3.05
3.76
2.42
3.87
1.99
3.69
1.09
3.85
-0.44
3.88
3.6
RE
Day 4
3.00
3.82
2.14
3.88
1.76
3.76
0.52
3.85
-1.73
3.94
3.73
RE
Day 5
3.05
3.83
2.34
3.88
1.80
3.92
0.26
3.85
-2.85
3.97
3.65
RE
Day 6
3.05
3.89
2.33
3.86
1.86
3.98
0.29
3.86
-3.86
3.88
3.73
RE
Day 7
2.97
3.70
2.06
3.83
1.60
3.90
0.43
3.87
-4.21
3.78
3.63
Change RE
0.78
0.05
1.82
0.05
2.38
0.06
3.41
0.03
8.08
0.09
0.08
44
Figure 12. Change in refraction, over seven days, in age-matched untreated control eyes
reared under different light intensities
Untreated age-matched controls (A) under 40,000 lux, (B) under 30,000 lux, (C) under
20,000 lux, (D) under 10,000 lux, and (E) for all light intensities
45
Figure 13. Change in refraction, over seven days, in contralateral control eyes reared under
different light intensities
Contralateral controls (A) under 40,000 lux, (B) under 30,000 lux, (C) under 20,000 lux, (D)
under 10,000 lux, (E) under 500 lux, and (F) for all light intensities
46
Figure 14. Change in refraction, over seven days, in form-deprived eyes reared under different
light intensities
Form-deprived chicks (A) under 40,000 lux, (B) under 30,000 lux, (C) under 20,000 lux, and (D) under
10,000 lux
47
Figure 15. Combined refractive data, over seven days, from form-deprived eyes reared under
different light intensities
Significant myopia was developed in chickens with translucent diffusers raised in 500 lux (normal
indoor light levels) with increased protection seen with increased light intensities compared to
untreated chickens raised in 500 lux.
48
y= -3.59 log10(x) + 17.521
2
R = 0.9501
Figure 16. Logarithmic non-linear regression curve of light intensity versus absolute change
in refraction over seven days
Overall changes in refraction regressed strongly with light intensity, and are best
modelled by a logarithmic relationship.
The percentage variation explained by the regression was 95.0%
49
3.2 Changes in axial length over time in response to different light intensities
3.2.1 Axial length changes in age-matched control and contralateral control eyes over six days
in response to different light intensities
Figure 17 A and table 5 illustrate the data for age-matched untreated control eyes. There was
no significant difference in the axial length for age-matched untreated control chicks that were
exposed daily, for seven days, for six hours per day to one of four high-light intensities (10,000
lux (group 4), 20,000 lux (group 3), 30,000 lux (group 2) or 40,000 lux (group 1)), when
comparing between the different high-light groups, or when compared to those animals
reared continuously under 500 lux (group 5)(F=3.923 , df=4 , 0.038 p= 0.016 )).
Similarly, as seen in figure 17 B and table 6, there was to significant difference in the axial
length for the contralateral control eyes of chicks that were exposed daily, for seven days, to
one of four high-light intensities for six hours per day (10,000 lux (group 4), 20,000 lux (group
3), 30,000 lux (group 2) or 40,000 lux (group 1)), when comparing between the different highlight groups, or when compared to those animals reared continuously under 500 lux (group 5),
as well as comparing to age-matched untreated control values (F=1.988, df= 4, 0.021,
p=0.134).
3.2.2 Axial length changes in diffuser-treated eyes over six days in response to different light
intensities
Figure 18 shows that, over time, light intensity had a significant effect on axial length for
diffuser-treated animals (F= 4.832, df= 10, 76, p<0.0001), with chicks kept under 500 lux
displaying the largest changes in axial length (Δ0.85 mm over 7 days), while those exposed to
40,000 lux displayed the smallest change (Δ0.17 mm over 7 days). Following six days of
diffuser-wear, chicks kept under 40,000 lux displayed the shortest eyes (8.77 ± 0.03 mm)
(table 6), followed by the 30,000 lux group (9.05 ± 0.07 mm), 20,000 lux (9.19 ± 0.12 mm),
10,000 lux group (9.26 ± 0.11 mm) and finally the 500 lux group (9.35 ± 0.07 mm). Only the
treated eyes of animals exposed to 40,000 lux showed an axial length that was statistically
similar in length to contralateral control values (p=0.87), or age-matched untreated values
(p=0.78).
Table 5. Axial length data for age-matched untreated control eyes for all light intensities
50
Axial length (AL, n=12) for age-matched untreated control animals for all light intensities
Treatment
Control
Control
Control
Control
Control
LI
(lux)
40,000
30,000
20,000
10,000
500
AL
Day 0
8.61
8.58
8.56
8.58
8.50
AL
Day 6
8.65
8.74
8.91
8.87
8.62
Change AL
0.04
0.16
0.35
0.29
0.12
Table 6. Axial length data for diffuser-treated and contralateral control eyes for all light intensities
Axial length (AL, n=12) for diffuser-treated and contralateral control eyes for all light intensities
Treatment
Constant Diff.
Contralateral
Constant Diff.
Contralateral
Constant Diff.
Contralateral
Constant Diff.
Contralateral
Constant Diff.
Contralateral
Untreated
LI
(lux)
40,000
40,000
30,000
30,000
20,000
20,000
10,000
10,000
500
500
500
AL
Day 0
8.61
8.61
8.58
8.58
8.56
8.56
8.58
8.58
8.50
8.50
8.50
AL
Day 6
8.77
8.69
9.05
8.74
9.19
8.91
9.26
8.79
9.35
8.67
8.62
Change AL
0.16
0.08
0.47
0.16
0.63
0.35
0.68
0.21
0.85
0.17
0.12
51
Figure 17. Changes in axial length for age-matched untreated (A) and contralateral
control (B) eyes over six days under different light intensities
52
Figure 18. Changes in axial length for diffuser-treated eyes over six days under
different light intensities
53
Aim 2: Can exposure to bright light prevent the progression of deprivation-myopia?
To investigate whether the progression of deprivation-myopia, through axial elongation, could
be prevented, chicks were fitted with translucent diffusers for a period of 10 days and were
split into one of three conditions: 1. fitted with translucent diffusers and raised under 500 lux
(FDM group), 2. fitted with translucent diffusers and exposed to 40,000 lux for 6 hours per day
(high light group), 3. fitted with translucent diffusers and initially kept in 500 lux for the first
three days, before being switched to daily exposure to 40,000 lux for the remaining seven days
(FDM progression group). Refraction was measured daily for both treated and untreated agematched control animals. Axial length measurements were taken at the start of the
experimental period (day 0) as well as on the second last day (day 9) for both treated and
untreated age-matched control animals.
3.3 Changes in refraction over time in response to transfer to high light
3.3.1 Refractive changes in contralateral control eyes over ten days in response to transfer to
high light
Over time, there was no significant difference in the refractive development for chicks that
were exposed daily, for ten days, to either 500 lux (FDM group), 40,000 lux (high light group)
or 500/40,000 lux (FDM progression group) in either the contralateral control eyes or when
compared to age-matched untreated eyes (F= 0.003, df= 1, 0.002, p= 0.95) (table 7).
3.3.2 Refractive changes in diffuser-treated eyes over ten days in response to transfer to high
light
Chicks reared continuously under 500 lux, with the attachment of translucent diffusers,
developed significant amounts of myopia (Δ8.16 D over 10 days), compared to refractive
changes in contralateral control (Δ0.08 D over 10 days; F= 1601, df= 1, 1644, p<0.0001) or agematched untreated animals (Δ0.32 D; F= 1472, df= 1, 1600, p<0.0001). Diffuser treated eyes
displayed a final refraction of 4.47 ± 0.21 D (figure 19 and table 7), on day 10, compared to
+3.69 ± 0.03 D contralateral control eyes (table 7) and +3.39 ± 0.01 D for age-matched
untreated eyes (figure 19).
As in aim 1, the development of deprivation-myopia was abolished in chickens raised under
40,000 lux for 6 hours per day during the light period (Δ0.89 D), and was statistically different
compared to contralateral control values (Δ 0.09 D over 10 days; F= 89, df= 1, 39, p<0.0001) or
age-matched untreated values (F= 83, df= 1, 38, p<0.0001). Diffuser treated eyes displayed a
final refraction of +2.86 ± 0.10 D (figure 19 and table 7), on day 10, which was not statistically
54
different from refractive values seen in contralateral control eyes (+3.69 ± 0.03 D, p<0.0001) or
age-matched untreated controls (+3.39 ± 0.01 D, p<0.0001).
The progression group, as illustrated in figure 19 and table 7, showed a significant relative
myopic shift over the initial three days of diffuser-wear under 500 lux (Δ4.89 D over three
days, refraction of 1.17 ± 0.21 D on day 3). Following transfer to 40,000 lux, these animals
showed an initial hyperopic shift over the first two days (Δ1.17 D, 0.00 ± 0.03 D), before
refractive changes stabilized (plateaued) around emmetropia for the following five days (Δ0.16
D, final refraction of +0.16 ± 0.21 D). Chickens switched to 40,000 lux (FDM progression group)
did not show as large a refractive change (Δ 3.56 D) as those kept continuously under 500 lux
(Δ 8.16 D), but a larger refractive change compared to those exposed to 40,000 lux (Δ 0.89 D)
for the entire experimental period.
40,000
40,000
Constant Diff.
Contralateral
500
500
500
Constant Diff.
Contralateral
Untreated
Contralateral Progression
Constant Diff. Progression
LI
(lux)
Treatment
RE
Day 0
3.75
3.60
3.71
3.84
3.69
3.90
3.71
RE
Day 1
3.56
3.61
2.44
3.86
2.07
3.97
3.59
RE
Day 2
3.38
3.61
0.63
3.84
1.23
3.93
3.66
RE
Day 3
3.05
3.61
-1.17
3.84
-1.01
3.97
3.6
RE
Day 4
3.00
3.60
-0.47
3.91
-1.90
3.93
3.73
RE
Day 5
3.05
3.60
0.00
3.86
-2.59
3.99
3.65
RE
Day 6
3.05
3.64
-0.01
3.94
-2.44
4.06
3.73
RE
Day 7
2.97
3.70
-0.11
3.96
-2.94
4.03
3.63
RE
Day 8
2.90
3.71
-0.01
3.93
-3.46
3.99
3.37
RE
Day 9
2.91
3.69
0.19
3.92
-4.00
3.94
3.44
RE
Change RE
Day 10
2.86
0.89
3.69
0.09
0.16
3.56
3.92
0.08
-4.47
8.16
3.91
0.01
3.39
0.32
55
Table 7. Changes in refraction for form-deprived animals exposed to 500 lux, 40,000 lux or
500/40,000 lux
Changes in refraction (RE) for form-deprived animals exposed to 500 lux, 40,000 lux or 500/40,000 lux
56
Figure 19. Changes in refraction, over time, for form-deprived animals exposed to 500 lux, 40,000
lux or 500/40,000 lux
The progression group (orange) showed a slight hyperopic shift following transfer to 40,000 lux before
stabilising
57
3.4 Changes in axial length over time in response to transfer to high light
3.4.1 Axial length changes in contralateral control eyes over nine days in response to transfer
to high light
Table 8 illustrate the data for axial length in contralateral control eyes. There was no significant
difference in axial length for chicks that were exposed daily, for ten days, to either 500 lux
(FDM group), 40,000 lux (high light group) or 500/40,000 lux (FDM progression group)
compared to age-matched untreated eyes (F= 0.122, df= 2, 0.002, p= 0.887).
3.4.2 Axial length changes in diffuser-treated eyes over nine days in response to transfer to
high light
Consistent with aim 1, chicks exposed to 500 lux, displayed the longest eyes of any of the
treatment groups (Δ 0.99 mm over 9 days) and was significantly different compared to
contralateral control (Δ 0.32 mm over 9 days, F= 38.89, df= 1, 0.429, p<0.0001) and agematched untreated values ( Δ 0.34 mm over 9 days, F= 19.847, df= 1, 0.580, p<0.0001).
Diffuser treated eyes displayed a final axial length of 9.54 ± 0.13 mm (figure 20 and table 8), on
day 9, compared to 8.90 ± 0.04 mm for contralateral control eyes and 8.93 ± 0.07 mm for the
age-matched untreated eyes.
Chickens exposed daily to 40,000 lux displayed the smallest change in axial length of the
treated groups (Δ 0.47 mm over 9 days) and was not significantly different compared to
contralateral control eyes (Δ 0.31 mm over 9 days, F= 0.983, df= 1, 0.035, p= 0.351) or agematched untreated eyes (Δ 0.34 mm over 9 days, F= 0.592, df= 1, 0.026, p= 0.456). Diffuser
treated eyes displayed a final axial length of 9.05 ± 0.15 mm (figure 20 and table 8), on day 9,
compared to 8.89 ± 0.09 mm for contralateral control eyes and 8.93 ± 0.07 mm for agematched untreated eyes.
The progression group, illustrated in figure 20 and table 8, showed a smaller change in axial
length (Δ 0.74 mm), although not statistically different, compared to chicks kept under 500 lux
(Δ 0.99 mm, p=0.06), but a larger change compared to those animals kept under 40,000 lux (Δ
0.47 mm, p= 0.003). Chicks in the progression group displayed a final axial length of 9.35 ±
0.13, on day 9, compared to 8.97 ± 0.12 mm for their contralateral control eyes.
58
Table 8. Changes in axial length for form-deprived animals exposed to 500 lux, 40,000 lux or
500/40,000 lux
Changes in axial length (AL) for form-deprived animals exposed to 500 lux, 40,000 lux or 500/40,000 lux
Treatment
LI
(lux)
Constant Diff.
40,000
Contralateral
40,000
Constant Diff. Progression
Contralateral Progression
Constant Diff.
500
Contralateral
Untreated
500
500
AL
Day 0
8.58
8.58
8.61
8.59
8.55
8.58
8.58
AL
Day 9
9.05
8.89
9.35
8.97
9.54
8.90
8.93
Change AL
0.47
0.31
0.74
0.38
0.99
0.32
0.35
Figure 20. Changes in axial length, over time, for form-deprived animals exposed to
500 lux, 40,000 lux or 500/40,000 lux
59
Aim 3: What are the biochemical pathways that are associated with the protective effects of
high light?
To begin to assess which biochemical pathways are associated with the ability of bright light to
retard the development of deprivation-myopia, chicks were fitted with translucent diffusers
for a period of one day and placed under either 500 lux (mimicking the intensity experienced
indoors) or 40,000 lux. Retinal samples were collected on day 2 (after one full light period) to
observe early changes in genes expression.
3.5 Molecular changes following one day of form-deprivation myopia in 40,000 lux
One day of diffuser-wear induced a significant down-regulation in Egr-1 (p<0.01), glucagon
(p<0.01) and cFos (p<0.001) mRNA levels compared to contralateral control values in animals
reared under 500 lux (figure 21 A, B and E respectively). This down-regulation in mRNA levels,
in response to diffuser-wear, was abolished by exposure to high light (40,000 lux) for Egr-1
(p=0.42), but was not abolished for either glucagon (p<0.01) or cFos (p<0.001) (figure 3.10 A, B
and E respectively). High light exposure had a significant effect on Egr-1 expression in
contralateral control eyes compared to those values seen in the control eyes of 500 lux treated
animals (p<0.05). In contrast, high light exposure did not alter the retinal expression of
glucagon, cFos, dopamine D2 receptor, tyrosine hydroxylase or retinoic acid receptor beta in
control eyes compared to those values seen at 500 lux. There was no significant change in
expression in response to diffuser-wear or high light treatments for dopamine D2 receptor (p=
0.23 and p= 0.89 respectively), tyrosine hydroxylase (p= 0.54 and p= 0.15 respectively) and
retinoic acid receptor beta (p= 0.59 and p= 0.29 respectively).
60
Figure 21. Mean normalised expressions in fold change in mRNA levels of primers
Mean normalised expression in fold change in mRNA levels following one day of form-deprivation
myopia (FDM) under normal laboratory light (500 lux) and 40,000 lux, with contralateral internal
controls for Egr-1 (A), Glucagon (B), Dopamine D2 Receptor (DRD2) (C), Tyrosine Hydroxylase (D), cFos
(E) and RAR-β (F). Significant down-regulation in Egr-1 following FDM in 500 lux, while 40,000 lux
retards this down-regulation. Glucagon, DRD2 and cFos are also down-regulated through FDM in 500
lux.
61
Chapter 4: Discussion
During development, ocular growth is regulated through visually-guided homeostatic
mechanisms to maintain a match between the axial length of the eye and its optical power, so
that the light rays from objects viewed at a distance are focused clearly on the retina. Myopia
occurs through a mismatch between the optical powers of the eye and the axial length, due,
for the most part, to excessive elongation of the eye during development. This causes light
rays to be focused in front of the retina instead of on it, leading to images appearing blurred.
In a promising finding, recent epidemiological studies have indicated that children spending
greater time outdoors are less likely to develop myopia. It has been postulated that the
protective effects of time outdoors may be driven by light-stimulated dopamine release
associated with the higher illumination levels experienced outside. In support of this
hypothesis, animal studies have shown that exposure to high light levels ( 15,000 lux), for 5
hours per day, can retard the development of experimental myopia by roughly 60% (Ashby and
Schaeffel 2010). This study examined whether greater protection against the development of
FDM could be achieved by exposing animals to even higher light intensities (>15,000 lux). The
results of this study show that there is indeed a significant correlation between the light
intensity to which animals are exposed and the degree to which FDM is prevented, with full
protection achievable under 40,000 lux (figure 15). This study was also concerned with
whether exposure to bright light could prevent the progression of FDM, or whether light was
only capable of modulating the onset of myopia. The results indicate that exposure to bright
light (40,000 lux) can halt further progression of FDM (figure 19), although a longer timecourse is required to determine the full extent of this effect. Finally, this thesis provided a first
look at the possible molecular pathways that underlie the protective effects of high light and
observed that the down-regulation in the mRNA levels of the immediate early gene Egr-1,
during development of FDM under 500 lux, is abolished by daily exposure to bright light
(40,000 lux) (figure 21).
4.1 Exposure to high light intensities and the development of deprivation-myopia
Due to the rapid increase in the prevalence of myopia, especially in urban East Asia (Morgan,
Ohno-Matsui et al. 2012), and the chorio-retinal pathologies associated with excessive axial
elongation seen in high myopes (Leske, Chylack et al. 1991, Vongphanit, Mitchell et al. 2002,
Chou, Yang et al. 2007, Resnikoff, Pascolini et al. 2008, Marcus, de Vries et al. 2011, Morgan,
Ohno-Matsui et al. 2012), it is crucial that treatment options are found to prevent this
refractive disorder. Recent epidemiological studies have suggested that spending more time
outdoors has a protective effect against the development of myopia (Mutti, Mitchell et al.
62
2002, Jones, Sinnott et al. 2007, Rose, Morgan et al. 2008, Dirani, Tong et al. 2009, Deng,
Gwiazda et al. 2010, Guggenheim, Northstone et al. 2012), with children who spend the least
amount of time on near-work activities and the greatest amount of time outdoors displaying
the most mean hyperopic refraction (Rose, Morgan et al. 2008). As previously discussed, it was
initially suggested that time outdoors may simply provide protection through a substitution
effect, in which the more time children spend outdoors, the less time they spend on near-work
tasks such as reading, which has previously been correlated with the development of myopia
(Mutti, Mitchell et al. 2002, Jones, Sinnott et al. 2007). However, a later study by Rose et al.
(2008) reported that a less myopic refraction was still observed in children who spent
considerable time outdoors even if they also engaged in significant amounts of near-work.
Instead, the authors hypothesised that rather than a substitution effect, the protective effects
of time outdoors may be driven by light-stimulated dopamine release associated with the
higher illumination levels experienced outside. As has been discussed, supporting this
hypothesis, animal models have shown that the development of experimental myopia can be
retarded by exposure to high light levels (Ashby, Ohlendorf et al. 2009, Ashby and Schaeffel
2010, Cohen, Belkin et al. 2011, Siegwart, Ward et al. 2012, Smith, Hung et al. 2012), with this
protective effect abolished in chickens by the injection of the dopamine D2 receptor
antagonist spiperone (Ashby and Schaeffel 2010). In chicks, the development of deprivationmyopia can be retarded by approximately 60% through daily exposure to 15,000 lux,
compared to those animals reared under 500 lux (Ashby, Ohlendorf et al. 2009). The aim of
this study was to determine if greater protection could be achieved with higher light intensities
(>15,000 lux). Supporting this hypothesis, the protective effects afforded by brief periods of
normal vision (15 minutes), against the development of FDM (Napper, Brennan et al. 1995,
Napper, Brennan et al. 1997), are enhanced proportionally to the light intensity in which the
animals are exposed to during the diffuser free period ( 48% reduction in deprivation-myopia
under 500 lux,  62% reduction in deprivation-myopia under 15,000 lux,  79% reduction in
deprivation-myopia under 30,000 lux) (Ashby, Ohlendorf et al. 2009). Further, Cohen and
colleagues (2011) have reported that the normal emmetropisation process in chicks appears to
be, at least in part, intensity dependent. Specifically, the authors observed that chicks reared
for 90 days under an illumination level of 50 lux, during the light phase, show a slight mean
myopic refraction by the end of the experimental period (2.41 D). In contrast, chicks reared
under 500 lux were emmetropic by day 90 (+0.03 D), but were possibly heading myopic, while
those reared under 10,000 lux remained hyperopic (+1.1 D). Therefore, this study investigated
whether deprivation-myopia could be further retarded, above that previously reported by
Ashby and colleagues (2010), by exposing chickens to higher light intensities (up to 40,000 lux).
The results of this study indicate that a negative correlation existed between the development
63
of deprivation-myopia and the intensity of light to which the animals were exposed. The
refractive changes induced by the fitment of translucent diffusers regressed strongly with the
intensity of light to which the animals were exposed and was best described by a logarithmic
non-linear relationship (r2 = 0.95). Specifically, the development of deprivation-myopia was
retarded to a greater extent with each increasing light intensity ( 60% reduction in
deprivation-myopia under 10,000 lux,  70% reduction in deprivation-myopia under 20,000
lux,  80% reduction in deprivation-myopia under 30,000 lux), to the point that the
development of deprivation-myopia was abolished in chickens exposed to 40,000 lux when
compared to the ocular development observed in either contralateral control eyes or agematched untreated animals. In contrast to that reported recently in tree shrews (Siegwart,
Ward et al. 2012) and rhesus monkeys (Smith, Hung et al. 2012), contralateral control and agematched untreated eyes did not show a relative hyperopic shift in refraction in response to
exposure to higher illumination levels. Instead, refractive changes in control eyes were
relatively stable, with a mild reduction in the hyperopic values seen over time that were not
dissimilar to that observed under 500 lux. This lack of a relative hyperopic shift in refraction
may be due to longer time courses used in the analysis of refractive changes in tree shrews
and rhesus monkeys. However, Cohen and colleagues (2011) have reported that although
rearing animals under 10,000 lux for 90 days holds them in a mild hyperopic state, they show a
relative myopic shift over time, as the animals head towards emmetropia, rather than a
relative hyperopic shift in response to high illumination levels. This may therefore represent a
mechanistic difference between chicks and that of tree shrews and rhesus monkeys.
Consistent with the changes observed in refraction, chicks fitted with translucent diffusers,
and reared under 500 lux, developed the longest eyes compared to control values. The
excessive axial elongation associated with deprivation-myopia was, however, retarded, to
increasing degrees, relative to the light intensity to which animals were exposed, so that by
40,000 lux, axial length changes were not statistically different from control values. It should
be noted, however, that although changes in axial length correlated strongly with the relative
direction of refractive changes, the absolute values obtained for axial length consistently
underestimated the refractive values that should be observed. This may suggest that high light
exposure also induced corneal flattening and hence reduce optical power, accounting for this
mismatch. However, this seems unlikely as Ashby et al. (2009) found no change in the corneal
radius of curvature in chicks raised for 4 days under 15,000 lux compared to those that were
raised under normal laboratory light, which would appear to exclude this hypothesis.
64
4.1.1 The effect of high light on lens-compensation
Exposure to elevated light intensities also affects the rate at which eyes compensate to image
defocus, imposed by lenses. Fitment of negative lenses (lens-induced myopia (LIM)), similar to
FDM, enhances ocular growth, leading to the development of myopia (Schaeffel, Glasser et al.
1988, Hung, Crawford et al. 1995, Shaikh, Siegwart et al. 1999, Ashby and Schaeffel 2010,
Siegwart, Ward et al. 2012). In chickens, the rate of compensation for negative lenses (10 D),
and hence the rate of axial elongation, is significantly reduced under high light levels (15,000
lux), when compared to animals reared with lenses under 500 lux, although in both cases full
compensation still occurs (Ashby and Schaeffel 2010). Similarly, in tree shrews, the rate of
compensation is significantly reduced under high light, with the average time to full
compensation to 5 D lenses being 17.5 days under 15,000 lux compared to 9 days under 500
lux, although, like with chicks, full compensation still occurs (Siegwart, Ward et al. 2012). In
contrast, exposure to high light appears not to affect the rate of compensation to negative
lenses in rhesus monkeys (Smith 2013, Smith, Hung et al. 2013). This result is somewhat
surprising as the ability of light to retard the development of FDM appears to be highly
conserved between chicks (avian model), tree shrews (mammalian model) and rhesus
monkeys (primate model). Therefore, one might assume that as light retards the rate of
compensation for negative lenses in chicks and tree shrews, that this response may also be
conserved within the primate model, as it was for FDM. It seems strange that such a
system/response is conserved between an avian (chicken) and mammalian (tree shrew) model,
yet not a primate (rhesus monkey) model, as phylogenetically the tree shrew is much closer to
the rhesus monkey than to the chicken. Interestingly, preliminary results from a small study
presented recently at the International Myopia Conference by Stell and colleagues (2013) has
suggested that 3 hours daily exposure to high light may actually be able to retard the rate of
compensation for negative lenses in rhesus monkeys, while also inducing a small hyperopic
shift in the untreated eyes of high light reared animals. However, at present, it is difficult to
draw strong conclusions from this study, as light levels were not controlled, with animals
placed outside for the high light group, where the intensity recorded ranged from 10,00030,000 lux, while the number of animals used was quite small (n= 4 for each high and low light
group).
The effect of high light on plus-lens compensation has only been analysed in chicks, with
15,000 lux reducing the rate of compensation for +10D lenses compared to those animals
reared under 500 lux (Ashby and Schaeffel 2010). Therefore, high light was able to enhance
the “STOP” growth signal associated with plus lens-wear, further reducing the rate of ocular
growth. However, as with negative lenses, although high light treatment reduced the rate of
65
compensation, full compensation was still achieved. Overall, studies across three species
(chickens, tree shrews and rhesus monkeys) have shown that daily exposure to high light is
capable of reducing the rate of axial elongation in response to visual defocus, with the obvious
exception of the effect of high light on negative lens compensation in the rhesus monkey,
which requires further investigation.
4.1.2 Possible mechanisms underlying the protective effects of time outdoors
A number of possible factors have been proposed to explain the protective effects of bright
light. For example, bright light will lead to pupil constriction and hence greater depth of focus,
bringing about reduced image blur. However, this theory does not explain the ability of high
light to retard the development of FDM, as pupil constriction will be unable to alter the image
blur associated with the attached diffusers. Another possible hypothesis is increased optical
flow rates, previously shown to retard the development of FDM (Schwahn and Schaeffel 1997),
which could be achieved through increased movement/activity outdoors. However, chickens
were found not to change their rate of activity (movement) under high lights. A role for
ultraviolet (UV) light and vitamin D levels has also been proposed. However, a number of
points argue against the role for UV light and vitamin D levels. Firstly, the lighting systems used
by a number of groups to retard the development of experimental myopia in chickens (Ashby,
Ohlendorf et al. 2009), tree shrews (Siegwart, Ward et al. 2012) and rhesus monkeys (Smith,
Hung et al. 2013) did not produce light in the UV spectrum. These findings exclude the
requirement of UV exposure for the inhibition of myopia development. Secondly, tree shrews
fed with vitamin D3 supplements are not protected against the development of FDM or LIM
(Siegwart, Herman et al. 2011). Finally, a small cohort study found no differences in vitamin D
levels between myopic and non-myopic cohorts (Mutti and Marks 2011). Instead, as
hypothesised by Rose and colleagues (2008), evidence from animal studies, strongly suggests
that the protective effects of bright light are driven, in part, by increased retinal dopamine
levels. Dopamine is a light-driven neurohormone released by amacrine and/or interplexiform
cells (Djamgoz and Wagner 1992, Megaw, Morgan et al. 2001, Megaw, Boelen et al. 2006,
Cohen, Peleg et al. 2012), with work in chickens indicating that retinal dopamine release
increases in a log-linear fashion over the light ranges normally seen during the day (100100,000 lux) (Morgan and Boelen 1996, Cohen, Peleg et al. 2012). Three points of evidence
from animal studies supports a role for dopamine in the protective effects of bright light.
Firstly, retinal dopamine levels are reduced during the development of experimental myopia,
with dopamine D2 receptor agonists capable of retarding the development of experimental
myopia induced by either negative lens-wear or translucent diffusers (Stone, Lin et al. 1989,
Iuvone, Tigges et al. 1991, Ashby, McCarthy et al. 2007, McCarthy, Megaw et al. 2007, Mao, Liu
66
et al. 2010). Secondly, the ability of brief periods of normal vision (diffuser removal) (Nickla,
Panos et al. 1989, Napper, Brennan et al. 1995, Napper, Brennan et al. 1997, Ashby, Ohlendorf
et al. 2009) to retard the development of FDM, a process which is enhanced under bright light
(Ashby, Ohlendorf et al. 2009), is abolished by the administration of the dopamine D2 receptor
antagonist spiperone. Finally, and most importantly, daily injections of spiperone are capable
of abolishing the protective effects afforded by 5 hours of daily exposure to 15,000 lux against
the development of deprivation-myopia in chicks (Ashby and Schaeffel 2010), strongly
supporting a role for the dopaminergic system.
4.1.3 What are the relevant light intensities required to prevent deprivation-myopia?
The results of this study show that chickens already had a roughly 80% retardation in the
development of FDM by 30,000 lux, while near-complete protection ( 95%) was achieved by
exposure to 40,000 lux. Similar to chicks (Ashby, Ohlendorf et al. 2009), tree shrews show a
roughly 60% reduction in FDM in response to 15,000 lux (Siegwart, Ward et al. 2012). Based on
the similarity of these results, this may suggest, although not shown, that FDM could also be
abolished in tree shrews if also exposed to 40,000 lux. Conversely, daily exposure to 28,000
lux, for 6 hours per day, abolish the development of FDM in rhesus monkeys (Smith, Hung et
al. 2012), while in chicks, similar light levels (30,000 lux) were only able to retard the
development of FDM by roughly 80%. This may represent a mechanistic difference between
these two species, or more likely, represent slight variations in the protocols used. For
example, differences in the diffuser construct used will lead to differences in the degree to
which light is attenuated. The differences, however, are not due to exposure time as both
rhesus monkeys and chickens were exposed to bright light for 6 hours per day. What is unclear
from the results to date is what the relationship is between the intensity of light used and the
length of exposure time, e.g. do short times under bright lights produce similar effects as
longer times under less bright lighting. Also, what is the minimum and maximum time of
exposure required for full protection (e.g. would exposure to 40,000 lux for periods of less
than 6 hours per day have the same effect, and would any greater effect be gained from
extending the exposure time to greater than 6 hours)? Recent work in chickens had indicated
that increased exposure time to bright light of 15,000 lux, from 5 hours to 10 hours per day,
does not enhance the protective effects against FDM (Backhouse, Collins et al. 2012, Lan,
Feldkaemper et al. 2013). However, the protective effect of light appear to be enhanced with
shorter periods of intermittent exposure (Lan, Feldkaemper et al. 2013), although further
analysis is required. Finally, future studies will need to determine if animals must be exposed
to high light daily to receive full protection, or whether treatment can be reduced to every
second day etcetera.
67
4.1.4 The role of light intensity in human myopia
The fact that exposure to elevated light intensities can abolish the development of
deprivation-myopia in chickens may well be promising for humans. A number of
epidemiological studies (For review see French, Ashby et al. 2013) have already showed a
negative correlation between spending more time outdoors and the development of myopia.
Furthermore, preliminary data from current trials in China, have reported that the inclusion of
an extra 40 minutes of time outdoors significantly reduced myopia progression in grade 1
children (Xiang, Zeng et al. 2013). If light is the relevant factor underlying the protective effects
of time outdoors, and if findings from experimental models of myopia are directly translatable
to human myopia, the findings from this current study would suggest that daily exposure to
light intensities between 30,000 and 40,000 lux could significantly retard the onset and
progression of myopia in children. Such light intensities are highly achievable outdoors, with
light levels of around 30,000 lux seen on winter days, or in the shade, in many parts of the
world, while levels up to 80,000 lux can be seen in summer, or in direct sunlight, in most part
of Asia and Europe, and can exceed 120,000 lux in Australia. However, although the current
findings are promising, the protective effects of time spent outdoors may be multifactorial or
may not even be related to light levels. For example, the larger viewing distances afforded
outside would allow for greater depth of focus, and hence a sharper image due to pupil
constriction, reduced peripheral hyperopic defocus, and less accommodative demand. Taken
together, this would create a more uniformed dioptric space, which has been hypothesised to
remove the stimulus for myopia growth (for review see Flitcroft 2012). Although plausible, this
hypothesis has not been tested in any great detail. Also, this model assumes that while
outdoors, one does not interact with objects in the near vicinity; however, this is unlikely as
humans will continuously engage with their friends, personal electronic devices and nearby
objects. Also, although laboratory animals, housed in cages, are surrounded by nearby stimuli
within a 3-5 meter radius, they do not develop myopia, and under these same conditions high
light still prevents the development of experimental myopia, and even induce a hyperopic shift
in untreated eyes of both tree shrews and rhesus monkeys (Siegwart, Ward et al. 2012, Smith,
Hung et al. 2012). Furthermore, elevated light intensities can slow the response to induced
hyperopic defocus (Ashby and Schaeffel 2010, Siegwart, Ward et al. 2012), therefore
suggesting that increased viewing distances and uniformed dioptric space cannot explain, at
least, the protective effect against the development of deprivation-myopia. Another possible
protective mechanism is spectral composition, as the emmetropisation process has been
shown to be sensitive to chromatic aberrations (Kroger and Wagner 1996, Seidemann and
Schaeffel 2002, Rucker and Wallman 2008). In animal models, rearing under monochromatic
68
red light, in which the focal plane falls behind the retina, induces a relative myopic shift
compared to animals raised in monochromatic blue light, in which the focal plane falls in front
of the retina (Kroger and Binder 2000, Rucker and Wallman 2008, Qian, Liu et al. 2013). As
sunlight is blue heavy compared to lighting sources experienced indoors, which are
predominantly red heavy, it is plausible that differences in spectral composition could explain
the protective effects of time outdoors. However, such spectral differences are unlikely to
explain the protective effects of high light against the development of experimental myopia, as
the same light source is used to generate 500 lux as that used to generate 40,000 lux.
4.2 Once myopic, can progression be halted by exposure to elevated light intensities?
Although it has been shown that high light is capable of retarding, or even abolishing the onset
of experimental myopia, a crucial question, especially for human application, is whether
exposure to high light can prevent further progression in already myopic animals. To test this,
FDM was initially induced for three days under 500 lux. Once a myopic refraction was
established, the animals were transferred to a high light regime, in which the chicks were
exposed daily to 40,000 lux for a 6 hour period. The progress of FDM was halted on switching
the animals to high light, with an initial hyperopic shift observed over the first two days, before
refractive values plateaued around emmetropia. Based on the size and rapid rate of the initial
hyperopic shift, this most likely represents a choroidal response.
Although this is a promising finding, a longer time-course is required to determine the
longevity of this halt in progression. For example, will light maintain the diffuser treated eye at
this stabilised refractive value indefinitely, which in this case was around zero, or will the
“GROW” signal associated with diffuser-wear eventually overpower the protective effects of
bright light? Alternatively, could exposure to high light gradually push the eye back into a
hyperopic state, similar to the hyperopic shift reported in untreated eyes of both tree shrews
and rhesus monkeys (Siegwart, Ward et al. 2012, Smith, Hung et al. 2013). Furthermore, it
needs to be determined if it was simply luck that further progression was halted with a mean
average refraction around emmetropia, or whether emmetropia was a defined end-point. To
answer this, a range of initial myopic refractive values will need to be induced to determine if
all animals are stabilised at, or near, emmetropia, independent of their starting refraction,
once switched to high light exposure. However, the fact that the progression of deprivationmyopia could be halted by exposure to high light is already a promising finding, especially as it
is crucial that further progression in children is halted as soon as possible to prevent the
chorio-retinal pathologies associated with excessive axial elongation.
69
4.3 What biochemical pathways underlie the protective effects of high light?
As discussed earlier, ocular growth is regulated, in response to visual stimuli, by local retinal
pathways that ultimately modulate the rate of scleral growth. Our understanding of these
retinal pathways has been significantly enhanced by the study of animal models of
experimental myopia. Using this knowledge, this thesis began to elucidate the pathways
underlying lights protective effects, by examining changes in specific retinal components of
four of the major molecular pathways postulated to be critical to ocular growth regulation,
that of; dopamine, nuclear transcription factors, glucagon and retinoic acid.
4.3.1 Dopamine and tyrosine hydroxylase (TH)
As previously discussed (page 16 and 19 of the introduction), work in chicks has already
suggested that the dopaminergic system plays a key role in the protective effects of bright light
against the development of FDM, as such affects can be abolished by the daily administration
of the dopamine D2 receptor antagonist spiperone (Ashby and Schaeffel 2010). Furthermore,
earlier work has demonstrated that retinal dopamine release (Stone, Lin et al. 1989), as best
measured by vitreal DOPAC levels (Megaw, Morgan et al. 2001), is significantly down-regulated
during the development of experimental myopia. Similarly, mRNA levels of the rate limiting
enzyme in the synthesis of dopamine, that of tyrosine hydroxylase (TH), are also downregulated during the development of deprivation-myopia (Stone, Lin et al. 1989), while the
administration of dopamine D2 receptor (DRD2) agonists have been shown to retard the
development of experimental myopia (Stone, Lin et al. 1989, Iuvone, Tigges et al. 1991, Rohrer,
Spira et al. 1993, Schmid and Wildsoet 2004, Nickla, Totonelly et al. 2010, Dong, Zhi et al.
2011). Based on the critical role both TH and DRD2 appear to play in dopamine’s effects on
ocular growth, this current study investigated whether changes in the mRNA levels of both
molecules could be involved in the retinal pathways underling the effects of bright light.
The current findings indicate that no significant changes in the mRNA levels of DRD2 or TH are
seen in diffuser-treated chicks exposed to either 500 lux or 40,000 lux compared to those
levels seen in contralateral control eyes after 1 day of treatment. This may not be surprising, as
the literature would suggest that TH is regulated, for the most part, at the post-translation
level, although also regulated, to some extent at the post-transcriptional level (Ribeiro, Wang
et al. 1992, Kumer and Vrana 1996, Witkovsky, Gabriel et al. 2000). Therefore, the lack of
change observed in TH mRNA levels may not represent retinal peptide levels or the rate of
activity of this enzyme. Similarly, the lack of change observed in DRD2 mRNA levels, does not
preclude changes in the number of receptors inserted within the cell membrane, or
70
modulation of receptor affinity, both of which would bring about a significant change in the
cellular response to dopamine.
4.3.2 Early growth response 1 (Egr-1)
As discussed earlier, Egr-1 expression shows a bidirectional response to opposing stimuli, with
both mRNA and peptide levels down-regulated during periods of increased ocular growth and
up-regulated during decreased ocular growth (Fischer, McGuire et al. 1999, Ashby, McCarthy
et al. 2007, Ashby, Kozulin et al. 2010). Consistent with this, Egr-1 mRNA levels were downregulated in response to 1 day of diffuser-wear under 500 lux in this current study. However,
this down-regulation was abolished if diffuser-wearing chicks were exposed to high light levels
(40,000 lux), with Egr-1 expression returning to those values seen in the contralateral control
eyes of the 500 lux treated animals. Interestingly, Egr-1 mRNA levels were also up-regulated in
the contralateral control eye of chicks exposed to 40,000 lux compared to contralateral control
values seen under 500 lux. Therefore, Egr-1 mRNA levels were still down-regulated in the
diffuser treated eye of chicks exposed to 40,000 lux when compared to their own contralateral
control values, but not when compared to the contralateral control values seen in the 500 lux
group. This suggests that Egr-1 is responding to an interplay between signals associated with
defocus and light intensity. If purely responding to light levels, Egr-1 mRNA expression in the
diffuser treated group under 40,000 lux should have been higher than that seen in the 500 lux
contralateral control group. Conversely, if Egr-1 was responding purely to defocus, mRNA
levels should not have been different between the contralateral control groups, which was not
the case.
The current results fit well with the literature. Egr-1 mRNA levels have been consistently
observed to be down-regulated, within 1 hour, during periods of increased ocular growth
associated with both lens- or diffuser-wear. This rapid down-regulation, however, can be
abolished by the administration of pharmacological agents which are known to block the
development of experimental myopia, such as the dopamine D2 receptor agonist ADTN and
the muscarinic-cholinergic antagonists atropine and prinzepine, in chicks (Ashby, McCarthy et
al. 2007, Ashby, Kozulin et al. 2010). Similarly, this study has shown that treatment with high
light, which also prevents the development of FDM, abolishes the down-regulation in Egr-1
expression, giving further evidence to the hypothesis that Egr-1 is a marker for the direction of
ocular growth, and, more importantly, may be directly involved in growth modulation.
71
4.3.3 FBJ osteosarcoma oncogene (cFos)
The immediately early gene cFos, is a light-induced member of the nuclear transcription factor
family to which Egr-1 also belongs to. Initial studies reported that cFos peptide levels, as
measured by immunostaining, were unaffected by the development of FDM, but were upregulated following diffuser removal, a response that was believed to be light driven (Fischer,
McGuire et al. 1999). However, later microarray studies have observed a significant downregulation in cFos mRNA levels in response to 24 hours of diffuser-wear (Brand, Schaeffel et al.
2007, Schippert, Schaeffel et al. 2008, Ashby and Feldkaemper 2010), which appears not to be
associated with changes in retinal illumination, as these changes are still observed when light
levels striking the control eye are attenuated by similar amounts to that caused by diffuserwear (Brand, Schaeffel et al. 2007). Consistent with these findings, the current results
demonstrate that cFos mRNA levels are down-regulated in response to 1 day of diffuser-wear
under 500 lux. Surprisingly, as cFos is a light-induced transcription factor, this down-regulation
was not abolished if diffuser-wearing chicks were exposed to 40,000 lux. Furthermore, there
was no significant difference in cFos mRNA levels between the 500 lux and 40,000 lux
contralateral control groups, even though there is an 80 fold difference in the light levels
experienced. This would suggest that the down-regulation in cFos mRNA levels was in
response to the defocus signal associated with diffuser-wear, rather than to changes in retinal
illumination. This is consistent with the findings of Brand and colleagues (2007).
The inability of high light levels to prevent the down-regulation in cFos mRNA levels suggests
that; a) cFos expression may be up-stream of the molecular targets of light, although, one
would expect cFos to behave in a similar fashion to that of Egr-1, b) cFos is not involved in the
regulation of ocular growth, or, that the protective effects of bright light do not target this
pathways, or finally c) retinal samples were collected at a time point which was too late/early
to observe changes in cFos, although, again one would expect cFos to behave in a similar
fashion to that of Egr-1. A more rigorous time-course of changes in cFos mRNA and peptide
levels must be undertaken to answer this question.
4.3.4 Glucagon
As was detailed within the introduction, glucagon has previously been implicated in growth
regulation due to its bi-directional response to opposing growth stimuli, while administration
of glucagon agonists can retard the development of experimental myopia (Fischer, McGuire et
al. 1999, Bitzer and Schaeffel 2002, Buck, Schaeffel et al. 2004, Ashby, Kozulin et al. 2010).
Consistent with previous studies (Ashby, Kozulin et al. 2010), increased rates of ocular growth,
associated with the development of FDM under 500 lux, induced a significant down-regulation
72
in glucagon mRNA levels after 1 day of diffuser-wear in this current study. However, this
down-regulation was not abolished if diffuser-wearing chicks were exposed to 40,000 lux. This
is surprising for two reasons; firstly, administration of glucagon receptor agonists inhibit axial
elongation (Feldkaemper, Burkhardt et al. 2002, Vessey, Lencses et al. 2005), while
administration of glucagon receptor antagonist prevents compensation to positive-lenses
(Vessey, Lencses et al. 2005). Therefore, the pharmacological evidence would suggest that
retinal glucagon levels should remain at control levels during periods in which increased ocular
growth is prevented, such as that achieved by exposure to 40,000 lux. Secondly, glucagonergic
amacrine cells in the chick express Egr-1, with changes in glucagon levels normally mirroring
those changes seen in Egr-1 expression, although with a time-shift of roughly 24 hours (Ashby,
Kozulin et al. 2010). Therefore, as high light is able to abolish the down-regulation in Egr-1, one
might have assumed it would therefore abolish the down-regulation in PPG mRNA levels.
The inability of light to alter glucagon levels may be for a number of reasons. Firstly, it could be
that glucagon is not part of the pathway regulating ocular growth. This however seems
somewhat unlikely based on the pharmacological evidence. Secondly, changes in PPG mRNA
levels may be up-stream of the molecular targets associated with high light, although unlikely
based on the changes observed in Egr-1 expression. Alterations in mRNA levels may not
represent changes at the peptide level under high light; however, normally changes at the
peptide level mirror those changes seen at the transcript level (Feldkaemper and Schaeffel
2002). Finally, changes in retinal glucagon mRNA levels take approximately 24 hours to appear
in response to alterations in the visual environment (e.g. lens- or diffuser-wear) (Ashby,
Kozulin et al. 2010). Therefore, this current study may have sampled too early to see a reversal
in PPG mRNA levels, which may be more likely to be observed on day 2.
4.3.5 Retinoic acid (RA)
RA appears to be an important signalling molecule in the developing eye (Mertz and Wallman
2000, Mao, Liu et al. 2012). Retinal-RA levels, as well as mRNA levels of retinoic acid receptorβ (RAR-β) in the sclera and retina, have been shown to be up-regulated during periods of
increased ocular growth, while retinal-RA levels are down-regulated during periods of
decreased ocular growth (Seko, Shimokawa et al. 1996, Seko, Shimizu et al. 1998, Bitzer,
Feldkaemper et al. 2000, Huang, Qu et al. 2011). Similar bi-directional changes in RA levels to
opposing growth stimuli are seen within the chick choroid, although these changes are inverse
to those seen in the retina (Mertz and Wallman 2000). Moreover, administration of RA causes
a rapid increase in axial elongation in chicks and guinea pigs (McFadden, Howlett et al. 2004,
McFadden, Howlett et al. 2006). The current results, however, indicate no significant change in
73
retinal mRNA levels for RAR-β after 1 day of diffuser-wear. This appears contradictory to the
findings reported by Huang and colleagues (2011), in which mRNA levels for RAR-β were
observed to be up-regulated in the guinea pig retina, however, this was seen after 14 days, a
considerably longer time-course than that undertaken presently. Therefore, possible changes
in RAR-β mRNA levels need to be examined over a longer time-course in chicks, a process that
needs to be undertaken for all genes investigated within this study to truly elucidate the role
of post-transcriptional regulation of these candidate molecules in the modulation of ocular
growth by high light exposure. Also, as with DRD2, studying possible changes in the transcript
level of RAR- β will not provide insight into any possible post-translational modifications that
could alter receptor affinity and cellular localisation.
Conclusion
In summary, exposure to elevated light levels has a significant effect on the development of
FDM over time. Specifically, the results of this study have shown that there is a negative
correlation between the light intensity to which animals are exposed and the degree to which
deprivation-myopia develops, with the onset of FDM abolished by 40,000 lux. Further, the
current results suggest that exposure to bright light (40,000 lux) can halt further progression of
deprivation-myopia, although a longer time-course is required to determine the full extent of
this effect. Finally, this thesis provided a first look at the possible molecular pathways that
underlie the protective effects of high light and observed that the down-regulation in the
mRNA levels of the immediate early gene Egr-1, during the development of deprivationmyopia under 500 lux, are abolished by daily exposure to bright light (40,000 lux).
74
References
Ashby, R. (2007). Molecular Control of Eye Growth: a Candidate Gene Approach. PhD,
Australian National University.
Ashby, R., P. Kozulin, P. L. Megaw and I. G. Morgan (2010). "Alterations in ZENK and glucagon
RNA transcript expression during increased ocular growth in chickens." Molecular
Vision 16: 639-649.
Ashby, R., C. S. McCarthy, R. Maleszka, P. Megaw and I. G. Morgan (2007). "A muscarinic
cholinergic antagonist and a dopamine agonist rapidly increase ZENK mRNA expression
in the form-deprived chicken retina." Experimental Eye Research 85(1): 15-22.
Ashby, R., A. Ohlendorf and F. Schaeffel (2009). "The effect of ambient illuminance on the
development of deprivation myopia in chicks." Investigative Ophthalmology and Visual
Science 50(11): 5348-5354.
Ashby, R. S. and M. P. Feldkaemper (2010). "Gene expression within the amacrine cell layer of
chicks after myopic and hyperopic defocus." Investigative ophthalmology & visual
science 51(7): 3726-3735.
Ashby, R. S. and F. Schaeffel (2010). "The effect of bright light on lens compensation in chicks."
Investigative Ophthalmology and Visual Science 51(10): 5247-5253.
Ashby, R. S., G. Zeng, A. Leotta and S. A. McFadden (2011). "Changes in Egr-1 Expression in the
Guinea Pig Retina in Response to Negative Lens-wear." Investigative Ophthalmology
and Visual Science E-Abstract 3925.
Backhouse, S., A. V. Collins and J. R. Philips (2012). "Influence of periodic vs continuous daily
bright light exposure on development of experimental myopia in the chick." Opthalmic
& Physiological optics 33(5): 563-572.
Backhouse, S. and J. R. Phillips (2010). "Effect of induced myopia on scleral myofibroblasts and
in vivo ocular biomechanical compliance in the guinea pig." Investigative
Ophthalmology and Visual Science 51(12): 6162-6171.
Bear, J. C. (1991). Epidemiology and genetics of refractive anomalies. In refractive anomalies:
Research and clinical applications. Boston, Butterworth-Heinemann.
Bear, M. F., B. W. Connors and M. A. Paradiso (2007). Neuroscinece- Exploring the Brain,
Lippincott Williams & Wilkins.
Bitzer, M., M. Feldkaemper and F. Schaeffel (2000). "Visually induced changes in components
of the retinoic acid system in fundal layers of the chick." Experimental Eye Research
70(1): 97-106.
Bitzer, M. and F. Schaeffel (2002). "Defocus-induced changes in ZENK expression in the chicken
retina." Investigative Ophthalmology and Visual Science 43(1): 246-252.
75
Brand, C., F. Schaeffel and M. P. Feldkaemper (2007). "A microarray analysis of retinal
transcripts that are controlled by image contrast in mice." Molecular Vision 13: 920932.
Brown, N. P., J. F. Koretz and A. J. Bron (1999). "The development and maintenance of
emmetropia." Eye (London) 13 ( Pt 1): 83-92.
Buck, C., F. Schaeffel, P. Simon and M. Feldkaemper (2004). "Effects of positive and negative
lens treatment on retinal and choroidal glucagon and glucagon receptor mRNA levels
in the chicken." Investigative Ophthalmology and Visual Science 45(2): 402-409.
Campochiaro, P. A., S. F. Hackett and B. P. Conway (1991). "Retinoic acid promotes densitydependent growth arrest in human retinal pigment epithelial cells." Investigative
Ophthalmology and Visual Science 32(1): 65-72.
Chou, S. C., C. H. Yang, C. H. Lee, C. M. Yang, T. C. Ho, J. S. Huang, C. P. Lin, M. S. Chen and Y. F.
Shih (2007). "Characteristics of primary rhegmatogenous retinal detachment in
Taiwan." Eye (London) 21(8): 1056-1061.
Chow, Y. C., B. Dhillon, P. T. Chew and S. J. Chew (1990). "Refractive errors in Singapore
medical students." Singapore Medical Journal 31(5): 472-473.
Cohen, Y., M. Belkin, O. Yehezkel, I. Avni and U. Polat (2008). "Light intensity modulates
corneal power and refraction in the chick eye exposed to continuous light." Vision
Research 48(21): 2329-2335.
Cohen, Y., M. Belkin, O. Yehezkel, A. S. Solomon and U. Polat (2011). "Dependency between
light intensity and refractive development under light-dark cycles." Experimental Eye
Research 92(1): 40-46.
Cohen, Y., E. Peleg, M. Belkin, U. Polat and A. S. Solomon (2012). "Ambient illuminance, retinal
dopamine release and refractive development in chicks." Experimental eye research
103: 33-40.
Cui, D., K. Trier and S. Munk Ribel-Madsen (2013). "Effect of day length on eye growth, myopia
progression, and change of corneal power in myopic children." Ophtalmology 120(5):
1074-1079.
De Stefano, M. E. and E. Mugnaini (1997). "Fine structure of the choroidal coat of the avian
eye. Lymphatic vessels." Investigative Ophthalmology and Visual Science 38(6): 12411260.
Deng, L., J. Gwiazda and F. Thorn (2010). "Children's refractions and visual activities in the
school year and summer." Optometry and Vision Science 87: 406-413.
Dirani, M., L. Tong, G. Gazzard, X. Zhang, A. Chia, T. L. Young, K. A. Rose, P. Mitchell and S. M.
Saw (2009). "Outdoor activity and myopia in Singapore teenage children." British
Journal of Ophthalmology 93(8): 997-1000.
76
Djamgoz, M. B. and H. J. Wagner (1992). "Localization and function of dopamine in the adult
vertebrate retina." Neurochemistry International 20(2): 139-191.
Dong, F., Z. Zhi, M. Pan, R. Xie, X. Qin, R. Lu, X. Mao, J. F. Chen, M. D. Willcox, J. Qu and X. Zhou
(2011). "Inhibition of experimental myopia by a dopamine agonist: different
effectiveness between form deprivation and hyperopic defocus in guinea pigs."
Molecular Vision 17: 2824-2834.
Donovan, L., P. Sankaridurg, A. Ho, X. Chen, Z. Lin, V. Thomas, E. L. Smith, 3rd, J. Ge and B.
Holden (2012). "Myopia progression in Chinese children is slower in summer than in
winter." Optometry and Vision Science 89(8): 1196-1202.
Feldkaemper, M., E. Burkhardt and F. Schaeffel (2002). "Expression Patterns of the Glucagon
Receptor in the Chick Retina, With and Without Intravitreal Application of a Glucagon
Agonist." Investigative Ophthalmology and Visual Science 43(12): 205-.
Feldkaemper, M. P., E. Burkhardt and F. Schaeffel (2004). "Localization and regulation of
glucagon receptors in the chick eye and preproglucagon and glucagon receptor
expression in the mouse eye." Experimental Eye Research 79(3): 321-329.
Feldkaemper, M. P. and F. Schaeffel (2002). "Evidence for a potential role of glucagon during
eye growth regulation in chicks." Visual Neuroscience 19(6): 755-766.
Fischer, A. J., J. J. McGuire, F. Schaeffel and W. K. Stell (1999). "Light- and focus-dependent
expression of the transcription factor ZENK in the chick retina." Nature Neuroscience
2(8): 706-712.
Fledelius, H. C. (2000). "Myopia profile in Copenhagen medical students 1996–98. Refractive
stability over a century is suggested." Acta Ophthalmologica Scandinavica 78(5): 501505.
Flitcroft, D. I. (2012). "The complex interactions of retina, optical and environmental factors in
myopia aetiology " Progress in retinal and eye research 31(6): 622-660.
French, A., N., R. Ashby, S., I. Morgan, G. and K. Rose, A. (2013). "Time outdoors and the
prevention of myopia." Experimental Eye Research: 1-11.
French, A. N., I. G. Morgan, P. M. Mitchell and K. A. Rose (2013). "Risk Factors for Incident
Myopia in Australian Schoolchildren : The Sydney Adolescent Vascular and Eye Study."
Ophthalmology 120(10): 2100-2108.
Fujiwara, M., S. Hasebe, R. Nakanishi, K. Tanigawa and H. Ohtsuki (2012). "Seasonal variation
in myopia progression and axial elongation: an evaluation of Japanese children
participating in a myopia control trial." Japanese Journal of Ophthalmology 56(4): 401406.
Fulk, G. W., L. A. Cyert and D. A. Parker (2002). "Seasonal variations in myopia progression and
ocular elongation." Optometry and Vision Science 79(1): 46-51.
77
Gao, Q., Q. Liu, P. Ma, X. Zhong, J. Wu and J. Ge (2006). "Effects of direct intravitreal dopamine
injections on the development of lid-suture induced myopia in rabbits." Graefes
Archive for Clinical and Experimental Ophthalmology 244(10): 1329-1335.
Goh, W. S. and C. S. Lam (1994). "Changes in refractive trends and optical components of Hong
Kong Chinese aged 19-39 years." Opthalmic & Physiological optics 14: 378-382.
Goss, D. A. and B. B. Rainey (1998). "Relation of childhood myopia progression rates to time of
year." Journal of the American Optometric Association 69(4): 262-266.
Gottlieb, M. D., L. A. Fugate-Wentzek and J. Wallman (1987). "Different visual deprivations
produce different ametropias and different eye shapes." Investigative Ophthalmology
and Visual Science 28(8): 1225-1235.
Grondona, J. M., P. Kastner, A. Gansmuller, D. Decimo, P. Chambon and M. Mark (1996).
"Retinal dysplasia and degeneration in RARbeta2/RARgamma2 compound mutant
mice." Development 122(7): 2173-2188.
Guggenheim, J. A., K. Northstone, D. G. McMahon, A. R. Ness, K. Deere, C. Mattocks, B. S.
Pourcain and C. Williams (2012). "Time outdoors and physical activity as predictors of
incident myopia in childhood: a prospective cohort study." Investigative
Ophthalmology and Visual Science 53: 2856-2865.
Guo, Y., L. J. Liu, L. Xu, Y. Y. Lv, P. Tang, Y. Feng, M. Meng and J. B. Jonas (2013). "Outdoor
activity and myopia among primary students in rural and urban regions of Beijing."
Ophthalmology 120: 277-283.
Gwiazda, J. E., L. Deng, R. E. Manny and T. T. Norton (2014). "Seasonal variations in the
progression of myopia in children enrolled in the Correction of Myopia Evaluation
Trial." Investigative Ophthalmology and Visual Science E-pub ahead of print.
Hasegawa, S., K. Terazono, K. Nata, T. Takada, H. Yamamoto and H. Okamoto (1990).
"Nucleotide sequence determination of chicken glucagon precursor cDNA. Chicken
preproglucagon does not contain glucagon-like peptide II." FEBS Letters 264(1): 117120.
He, M., J. Zeng, Y. Liu, J. Xu, G. P. Pokharel and L. B. Ellwein (2004). "Refractive error and visual
impairment in urban children in southern china." Investigative Ophthalmology and
Visual Science 45(3): 793-799.
Huang, J., X.-M. Qu and C. R-Y. (2011). "Expressions of cellular retinoic acid binding proteins I
and retinoic acid receptor-β in the guinea pig eyes with experimental myopia."
International journal of Opthalmology 4(2): 131-136.
Hung, L. F., M. L. Crawford and E. L. Smith (1995). "Spectacle lenses alter eye growth and the
refractive status of young monkeys." Nature Medicine 1(8): 761-765.
78
Hung, L. F., J. Wallman and E. L. Smith, 3rd (2000). "Vision-dependent changes in the choroidal
thickness of macaque monkeys." Investigative Ophthalmology and Visual Science
41(6): 1259-1269.
Irving, E. L., M. G. Callender and J. G. Sivak (1991). "Inducing myopia, hyperopia, and
astigmatism in chicks." Optometry and Vision Science 68(5): 364-368.
Irving, E. L., M. G. Callender and J. G. Sivak (1995). "Inducing ametropias in hatchling chicks by
defocus--aperture effects and cylindrical lenses." Vision Research 35(9): 1165-1174.
Irving, E. L., J. G. Sivak and M. G. Callender (1992). "Refractive plasticity of the developing chick
eye." Ophthalmic and Physiological Optics 12(4): 448-456.
Iuvone, P. M., M. Tigges, R. A. Stone, S. Lambert and A. M. Laties (1991). "Effects of
apomorphine, a dopamine receptor agonist, on ocular refraction and axial elongation
in a primate model of myopia." Investigative Ophthalmology and Visual Science 32(5):
1674-1677.
Jobke, S., E. Kasten and C. Vorwerk (2008). "The prevalence rates of refractive errors among
children, adolescents, and adults in Germany." Clinical Ophthalmology 2(3): 601-607.
Jones-Jordan, L. A., G. L. Mitchell, S. A. Cotter, R. N. Kleinstein, R. E. Manny, D. O. Mutti, J. D.
Twelker, J. R. Sims, K. Zadnik and C. S. Group (2011). "Visual activity before and after
the onset of juvenile myopia." Investigative Ophthalmology and Visual Science 52(3):
1841-1850.
Jones, L. A., L. T. Sinnott, D. O. Mutti, G. L. Mitchell, M. L. Moeschberger and K. Zadnik (2007).
"Parental history of myopia, sports and outdoor activities, and future myopia."
Investigative Ophthalmology and Visual Science 48(8): 3524-3532.
Jung, S. K., J. H. Lee, H. Kakizaki and D. Jee (2012 ). "Prevalence of myopia and its association
with body stature and educational level in 19-year-old male conscripts in Seoul, South
Korea." Investigative Ophthalmology and Visual Science 53(5579-5583).
Junquero, D., G. Modat, C. Coquelet and C. Bonne (1990). "Retinoids enhance the number of
EGF receptors in corneal endothelial cells." Experimental Eye Research 51(1): 49-53.
Kandel, E. R., J. H. Schwartz and T. M. Jessell (2000). Principles of Neural Science, McGraw-Hill.
Kee, C. S., D. Marzani and J. Wallman (2001). "Differences in time course and visual
requirements of ocular responses to lenses and diffusers." Investigative
Ophthalmology and Visual Science 42(3): 575-583.
Kempen, J. H., P. Mitchell, K. E. Lee, J. M. Tielsch, A. T. Broman, H. R. Taylor, M. K. Ikram, N. G.
Congdon and B. J. O'Colmain (2004). "The prevalence of refractive errors among adults
in the United States, Western Europe, and Australia." Archives of Ophthalmology
122(4): 495-505.
79
Khader, Y. S., W. Q. Batayha, S. M. Abdul-Aziz and M. I. Al-Shiekh-Khalil (2006). "Prevalence
and risk indicators of myopia among schoolchildren in Amman, Jordan." Eastern
Mediterranean Health Journal 12(3-4): 434-439.
Kirschner, S. E., A. Ciaccia and J. L. Ubels (1990). "The effect of retinoic acid on thymidine
incorporation and morphology of corneal stromal broblast." Current Eye Research
9(11): 1121-1125.
Kroger, R. H. and S. Binder (2000). "Use of paper selectively absorbing long wavelengths to
reduce the impact of educational near work on human refractive development."
British Journal of Ophthalmology 84(8): 890-893.
Kroger, R. H. and H. J. Wagner (1996). "The eye of the blue acara (Aequidens pulcher,
Cichlidae) grows to compensate for defocus due to chromatic aberration." Journal of
Comparative Physiology 179(6): 837-842.
Kumer, S. C. and K. E. Vrana (1996). "Intricate regulation of tyrosine hydroxylase activity and
gene expression." Journal of Neurochemistry 67(2): 443-462.
Kusakari, T., T. Sato and T. Tokoro (1997). "Regional scleral changes in form-deprivation
myopia in chicks." Experimental Eye Research 64(3): 465-476.
Lan, W., M. Feldkaemper and F. Schaeffel (2013). "Intermittent episodes of bright light
enhance the protective effect against myopia." E-Abstract, 2013 Bi-annual
International Myopia Conference, California, USA.
Lauber, J. K. and A. Kinnear (1979). "Eye enlargement in birds induced by dim light." Canadian
Journal of Ophthalmology 14(4): 265-269.
Leske, M. C., L. T. Chylack and S. Y. Wu (1991). "The lens opacities case-control study. Risk
factors for cataract." Archives of Ophthalmology 109(2): 244-251.
Lewis, C. A., R. M. Pratt, J. P. Pennypacker and J. R. Hassel (1978). "Inhibition of limb
chondrogenesis in vitro by Vitamin A." Developmental Biology 64(1): 31-47.
Li, T. and H. C. Howland (2000). "Modulation of constant light effects on the eye by ciliary
ganglionectomy and optic nerve section." Vision Research 40(17): 2249-2256.
Li, T. and H. C. Howland (2003). "The effects of constant and diurnal illumination of the pineal
gland and the eyes on ocular growth in chicks." Investigative Ophthalmology and
Visual Science 44(8): 3692-3697.
Lin, L. L., Y. F. Shih, C. K. Hsiao and C. J. Chen (2004). "Prevalence of myopia in Taiwanese
schoolchildren: 1983 to 2000." Annals of the Academy of Medicine, Singapore 33(1):
27-33.
Lin, L. L., Y. F. Shih, Y. C. Lee, P. T. Hung and P. K. Hou (1996). "Changes in ocular refraction and
its components among medical students—a 5-year longitudinal study." Optometry and
Vision Science 73(7): 495-498.
80
Lin, Z., X. Chen, J. Ge, D. Cui, J. Wu, F. Tang, J. Tan, X. Zhong and Q. Gao (2008). "Effects of
direct intravitreal dopamine injection on sclera and retina in form-deprived myopic
rabbits." Journal of Ocular Pharmacology and Therapeutics 24(6): 543-550.
Logan, N. S., I. N. Davies, E. A. Mallen and B. Gilmartin (2005). "Ametropia and ocular biometry
in a U.K. university student population." Optometry and Vision Science 82(4): 261-266.
Low, W., M. Dirani, G. Gazzard, Y. H. Chan, H. J. Zhou, P. Selvaraj, K. G. Au Eong, T. L. Young, P.
Mitchell, T. Y. Wong and S. M. Saw (2010). "Family history, near work, outdoor activity,
and myopia in Singapore Chinese preschool children." British Journal of
Ophthalmology 94(8): 1012-1016.
Lu, B., N. Congdon, X. Liu, K. Choi, D. S. Lam, M. Zhang, M. Zheng, Z. Zhou, L. Li, X. Liu, A.
Sharma and Y. Song (2009). "Associations between near work, outdoor activity, and
myopia among adolescent students in rural China: the Xichang pediatric refractive
error study report no. 2." Archives of Ophthalmology 127(6): 769-775.
Mao, J., S. Liu and X. Dou (2012). "Retinoic acid metabolic change in retina and choroid of the
guinea pig with lens-induced myopia." International journal of Opthalmology 5(6):
670-764.
Mao, J., S. Liu, W. Qin, F. Li, X. Wu and Q. Tan (2010). "Levodopa inhibits the development of
form-deprivation myopia in guinea pigs." Optometry and Vision Science 87(1): 53-60.
Marcus, M. W., M. M. de Vries, F. G. Junoy Montolio and N. M. Jansonius (2011). "Myopia as a
risk factor for open-angle glaucoma: a systematic review and meta-analysis."
Ophthalmology 118(10): 1989-1994.
Marill, J., N. Idres, C. C. Capron, E. Nguyen and G. G. Chabot (2003). "Retinoic acid metabolism
and mechanism of action: a review." Current Drug Metabolism 4: 1-10.
Matsumura, H. and H. Hirai (1999). "Prevalence of myopia and refractive changes in students
from 3 to 17 years of age." Survey of Ophthalmology 44 Suppl 1: S109-115.
Mattei, M. G., M. Riviere, A. Krust, S. Ingvarsson, B. Vennstrom, M. Q. Islam, G. Levan, P.
Kautner, A. Zelent, P. Chambon, J. Szpirer and C. Szpirer (1991). "Chromosomal
assignment of retinoic acid receptor (RAR) genes in the human, moise, and rat
genomes." Genomics 10(4): 1061-1069.
McBrien, N. A. (2003). "Collagen gene expression and the altered accumulation of scleral
collagen during the development of high myopia." The American Society for
Biochemistry and Molecular Biology.
McBrien, N. A. and A. Gentle (2003). "Role of the sclera in the development and pathological
complications of myopia." Progress in retinal and eye research 22(3): 307-338.
81
McBrien, N. A., H. O. Moghaddam and A. P. Reeder (1993). "Atropine reduces experimental
myopia and eye enlargement via a nonaccommodative mechanism." Investigative
Ophthalmology and Visual Science 34(1): 205-215.
McCaffery, P., M. O. Lee, M. A. Wagner, N. E. Sladek and U. C. Drager (1992). "Asymmetrical
retinoic acid synthesis in the dorsoventral axis of the retina." Development 115(2):
371-382.
McCarthy, C. S., P. Megaw, M. Devadas and I. G. Morgan (2007). "Dopaminergic agents affect
the ability of brief periods of normal vision to prevent form-deprivation myopia."
Experimental Eye Research 84(1): 100-107.
McCarty, C. A. and H. R. Taylor (2000). "Myopia and vision 2020." American Journal of
Ophthalmology 129(4): 525-527.
McFadden, S. A. (2002). "Partial occlusion produces local form deprivation myopia in the
guinea pig eye." Investigative Ophthalmology and Visual Science 43: ARVO Meeting
Abstracts 189.
McFadden, S. A., M. H. Howlett, J. R. Mertz and J. Wallman (2006). "Acute effects of dietary
retinoic acid on ocular components in the growing chick." Experimental Eye Research.
McFadden, S. A., M. H. C. Howlett and J. R. Mertz (2004). "Retinoic acid signals the direction of
ocular elongation in the guinea pig eye." Vision Research 44(7): 643-653.
Megaw, P., I. G. Morgan and M. K. Boelen (2001). "Vitreal dihydroxyphenylacetic acid (DOPAC)
as an index of retinal dopamine release." Journal of Neurochemistry 76: 1636-1644.
Megaw, P. L., M. G. Boelen, I. G. Morgan and M. K. Boelen (2006). "Diurnal patterns of
dopamine release in chicken retina." Neurochemistry International 48(1): 17-23.
Mertz, J. R. and J. Wallman (2000). "Choroidal retinoic acid synthesis: a possible mediator
between refractive error and compensatory eye growth." Experimental Eye Research
70(4): 519-527.
Mey, J., P. McCaffery and U. C. Drager (1997). "Retinoic acid synthesis in the developing chick
retina." The Journal of Neuroscience 17(19): 7441-7449.
Midelfart, A., B. Aamo, K. A. Sjohaug and B. E. Dysthe (1992). "Myopia among medical students
in Norway." Acta Ophthalmologica (Copenhagen) 70(3): 317-322.
Morgan, I. G. (2003). "The biological basis of myopic refractive error." Clinical and
Experimental Optometry 86(5): 276-288.
Morgan, I. G. and M. K. Boelen (1996). "Complexity of dopaminergic function in the retinal
dark-light switch." Australian and New Zealand Journal of Ophthalmology 24(2): 56-58.
Morgan, I. G., K. Ohno-Matsui and S. M. Saw (2012). "Myopia." Lancet 379(9827): 1739-1748.
82
Mori, M., N. B. Ghyselinck, P. Chambon and M. Mark (2001). "Systematic immunolocalization
of retinoid receptors in developing and adult mouse eyes." Investigative
Ophthalmology and Visual Science 42(6): 1312-1318.
Mutti, D. O. and A. R. Marks (2011). "Blood Levels of Vitamin D in Teens and Young Adults with
Myopia." Optometry and Vision Science 88(3): 377-382.
Mutti, D. O., G. L. Mitchell, L. A. Jones, N. E. Friedman, S. L. Frane, W. K. Lin, M. L.
Moeschberger and K. Zadnik (2005). "Axial growth and changes in lenticular and
corneal power during emmetropization in infants." Investigative Ophthalmology and
Visual Science 46(9): 3074-3080.
Mutti, D. O., G. L. Mitchell, M. L. Moeschberger, L. A. Jones and K. Zadnik (2002). "Parental
myopia, near work, school achievement, and children's refractive error." Investigative
Ophthalmology and Visual Science 43(12): 3633-3640.
Napper, G. A., N. A. Brennan, M. Barrington, M. A. Squires, G. A. Vessey and A. J. Vingrys
(1995). "The duration of normal visual exposure necessary to prevent form deprivation
myopia in chicks." Vision Research 35(9): 1337-1344.
Napper, G. A., N. A. Brennan, M. Barrington, M. A. Squires, G. A. Vessey and A. J. Vingrys
(1997). "The effect of an interrupted daily period of normal visual stimulation on form
deprivation myopia in chicks." Vision Research 37(12): 1557-1564.
Nickla, D. L. (2013). "Ocular diurnal rhythms and eye growth regulation: Where we are 50
years after Lauber." Experimental Eye Research.
Nickla, D. L., S. N. Panos, L. A. Fugate-Wentzek, M. D. Gottlieb and J. Wallman (1989). "What
attributes of visual stimulation determine whether chick eyes develop deprivation
myopia?" Investigative Ophthalmology and Visual Science 30(1): 31.
Nickla, D. L., K. Totonelly and B. Dhillon (2010). "Dopaminergic agonists that result in ocular
growth inhibition also elicit transient increases in choroidal thickness in chicks."
Experimental Eye Research 91(5): 715-720.
Norton, T. T., A. O. Amedo and J. T. Siegwart (2010). "The effect of age on compensation for a
negative lens and recovery from lens-induced myopia in tree shrews (Tupaia glis
belangeri)." Vision Research 50: 564-576.
Onal, S., E. Toker, Z. Akingol, G. Arslan, S. Ertan, C. Turan and O. Kaplan (2007). "Refractive
errors of medical students in Turkey: one year follow-up of refraction and biometry."
Optometry and Vision Science 84(3): 175-180.
Pacifici, M., E. B. Golden, M. Iwamoto and S. L. Adams (1991). "Retinoic acid treatment induces
type X collagen gene expression in cultured chick chondrocytes." Experimental Cell
Research 195(1): 38-46.
83
Parssinen, O. and A. L. Lyyra (1993). "Myopia and myopic progression among schoolchildren: a
three-year follow-up study." Investigative Ophthalmology and Visual Science 34(9):
2794-2802.
Patek, C. E. and R. M. Clayton (1990). "Age-related changes in the response of chick lens cells
during long-term culture to insulin, cyclic AMP, retinoic acid and a bovine retinal
extract." Experimental Eye Research 50: 345-354.
Pfaffl, M. W. (2001). "A new mathematical model for relative quantification in real-time RTPCR." Nucleic Acids Research 29(9): e45.
Qian, Y.-F., R. Liu, J.-H. Dai, M.-J. Chen, Z.-T. Zhou and R.-Y. Chu (2013). "Transfer from blue
light or green light to white light partially reverses changes in ocular refraction and
anatomy of developing guinea pigs." Journal of Vision 13(11): 1-9.
Qian, Y. S., R. Y. Chu, J. C. He, X. H. Sun, N. Q. Zhao, D. N. Hu, M. R. Hoffman, J. H. Dai, X. M. Qu
and K. E. Pao (2009). "Incidence of myopia in high school students with and without
red-green color vision deficiency." Investigative Ophthalmology and Visual Science 50:
1598-1605.
Resnikoff, S., D. Pascolini, S. P. Mariotti and G. P. Pokharel (2008). "Global magnitude of visual
impairment caused by uncorrected refractive errors in 2004." Bulletin of the World
Health Organization 86(1): 63-70.
Ribeiro, P., Y. Wang, B. A. Citron and S. Kaufman (1992). "Regulation of recombinant rat
tyrosine hydroxylase by dopamine." Proceedings of the National Academy of Sciences
of the United States of America 89(20): 9593-9597.
Rohrer, B., A. W. Spira and W. K. Stell (1993). "Apomorphine blocks form-deprivation myopia
in chickens by a dopamine D2-receptor mechanism acting in retina or pigmented
epithelium." Visual Neuroscience 10(3): 447-453.
Rose, K. A., I. G. Morgan, J. Ip, A. Kifley, S. Huynh, W. Smith and P. Mitchell (2008). "Outdoor
activity reduces the prevalence of myopia in children." Ophthalmology 115(8): 12791285.
Rose, K. A., I. G. Morgan, W. Smith, G. Burlutsky, P. Mitchell and S. M. Saw (2008). "Myopia,
lifestyle, and schooling in students of Chinese ethnicity in Singapore and Sydney."
Archives of Ophthalmology 126(4): 527-530.
Rucker, F. J. (2013). "The role of luminance and chromatic cues in emmetropisation."
Opthalmic & Physiological optics 33(3): 196-214.
Rucker, F. J. and J. Wallman (2008). "Cone signals for spectacle-lens compensation: Differential
responses to short and long wavelengths." Vision Research 48(19): 1980-1991.
84
Saw, S. M., W. H. Chua, C. Y. Hong, H. M. Wu, W. Y. Chan, K. S. Chia, R. A. Stone and D. Tan
(2002). "Nearwork in early-onset myopia." Investigative Ophthalmology and Visual
Science 43(2): 332-339.
Saw, S. M., G. Gazzard, E. C. Shih-Yen and W. H. Chua (2005). "Myopia and associated
pathological complications." Ophthalmic and Physiological Optics 25(5): 381-391.
Saw, S. M., J. Katz, O. D. Schein, S. J. Chew and T. K. Chan (1996). "Epidemiology of myopia."
Epidemiologic Reviews 18(2): 175-187.
Saw, S. M., A. Shankar, S. B. Tan, H. Taylor, D. T. Tan, R. A. Stone and T. Y. Wong (2006). "A
cohort study of incident myopia in Singaporean children." Investigative Ophthalmology
and Visual Science 47(5): 1839-1844.
Saw, S. M., H. M. Wu, B. Seet, T. Y. Wong, E. Yap, K. S. Chia, R. A. Stone and L. Lee (2001).
"Academic achievement, close up work parameters, and myopia in Singapore military
conscripts." British Journal of Ophthalmology 85(7): 855-860.
Schaeffel, F., A. Glasser and H. C. Howland (1988). "Accommodation, refractive error and eye
growth in chickens." Vision Research 28(5): 639-657.
Schaeffel, F., G. Hagel, J. Eikermann and T. Collett (1994). "Lower-field myopia and astigmatism
in amphibians and chickens." J Opt Soc Am A Opt Image Sci Vis 11(2): 487-495.
Schaeffel, F., D. Troilo, J. Wallman and H. C. Howland (1990). "Developing eyes that lack
accommodation grow to compensate for imposed defocus." Visual Neuroscience 4(2):
177-183.
Schippert, R., E. Burkhardt, M. Feldkaemper and F. Schaeffel (2007). "Relative axial myopia in
Egr-1 (ZENK) knockout mice." Investigative Ophthalmology and Visual Science 48(1):
11-17.
Schippert, R., F. Schaeffel and M. P. Feldkaemper (2008). "Microarray analysis of retinal gene
expression in chicks during imposed myopic defocus." Molecular Vision 14: 1589-1599.
Schmid, K. L. and C. F. Wildsoet (1996). "Effects on the compensatory response to positive and
negative lenses of intermittent lens wear and ciliary nerve section in chicks." Vision
Research 36(7): 1023-1036.
Schmid, K. L. and C. F. Wildsoet (2004). "Inhibitory effects of apomorphine and atropine and
their combination on myopia in chicks." Optometry and Vision Science 81(2): 137-147.
Schwahn, H. N. and F. Schaeffel (1997). "Flicker parameters are different for suppression of
myopia and hyperopia." Vision Research 37(19): 2661-2673.
Seidemann, A. and F. Schaeffel (2002). "Effects of longitudinal chromatic aberration on
accommodation and emmetropization." Vision Research 42(21): 2409-2417.
Seko, Y., M. Shimizu and T. Tokoro (1998). "Retinoic acid increases in the retina of the chick
with form deprivation myopia." Ophthalmic Research 30(6): 361-367.
85
Seko, Y., H. Shimokawa and T. Tokoro (1996). "In vivo and in vitro association of retinoic acid
with form-deprivation myopia in the chick." Experimental Eye Research 63(4): 443452.
Shaikh, A. W., J. T. Siegwart, Jr. and T. T. Norton (1999). "Effect of interrupted lens wear on
compensation for a minus lens in tree shrews." Optometry and Vision Science 76(5):
308-315.
Sherwin, J. C., A. W. Hewitt, M. T. Coroneo, L. S. Kearns, L. R. Griffiths and D. A. Mackey (2012).
"The association between time spent outdoors and myopia using a novel biomarker of
outdoor light exposure " Investigative Ophthalmology and Visual Science 53: 43634370.
Shih, Y. F., T. H. Chiang and L. L. Lin (2009). "Lens thickness changes among schoolchildren in
Taiwan." Investigative Ophthalmology and Visual Science 50: 2637-2644.
Shulkin, D. J. and M. M. Bari (1986). "Deteriorating vision: an occupational risk for the medical
student." Archives of Ophthalmology 104(9): 1274.
Siegwart, J. T., C. K. Herman and T. T. Norton (2011). "Vitamin D3 supplement did not affect the
development of myopia produced with form deprivation or a minus lens in tree
shrews." Investigative Ophthalmology and Visual Science 52: ARVO E-Abstract 6298.
Siegwart, J. T., Jr. and T. T. Norton (2001). "Steady state mRNA levels in tree shrew sclera with
form-deprivation myopia and during recovery." Investigative Ophthalmology and
Visual Science 42(6): 1153-1159.
Siegwart, J. T., A. H. Ward and T. T. Norton (2012). "Moderately elevated fluorescent light
levels slow form deprivation and minus lens-induced myopia development in tree
shrews." Investigative Ophthalmology and Visual Science 53: ARVO E-abstract 3457.
Simon, P. (2003). "Q-Gene: processing quantitative real-time RT-PCR data." Bioinformatics
19(11): 1439-1440.
Smith, E. L., 3rd (2013). "Optical treatment strategies to slow myopia progression: effects of
the visual extent of the optical treatment zone." Experimental Eye Research 114: 7799.
Smith, E. L., 3rd, D. V. Bradley, A. Fernandes, L. F. Hung and R. G. Boothe (2001). "Continuous
ambient lighting and eye growth in primates." Investigative Ophthalmology and Visual
Science 42(6): 1146-1152.
Smith, E. L., 3rd, J. Huang, L. F. Hung, T. L. Blasdel, T. L. Humbird and K. H. Bockhorst (2009).
"Hemiretinal form deprivation: Evidence for local control of eye growth and refractive
development in infant monkeys." Investigative Ophthalmology and Visual Science
50(11): 5057-5069.
86
Smith, E. L., 3rd and L. F. Hung (1999). "The role of optical defocus in regulating refractive
development in infant monkeys." Vision Research 39(8): 1415-1435.
Smith, E. L., 3rd, L. F. Hung, B. Arumugam and J. Huang (2013). "Negative lens-induced myopia
in infant monkeys: effects of high ambient lighting." Investigative Ophthalmology and
Visual Science 54: 2959-2969.
Smith, E. L., 3rd, L. F. Hung and J. Huang (2012). "Protective effects of high ambient lighting on
the development of form-deprivation myopia in rhesus monkeys." Investigative
ophthalmology & visual science 53(1): 421-428.
Smith, E. L., 3rd, L. F. Hung, J. Huang, T. L. Blasdel, T. L. Humbird and K. H. Bockhorst (2010).
"Effects of optical defocus on refractive development in monkeys: Evidence for local,
regionally selective mechanisms." Investigative Ophthalmology and Visual Science
51(8): 3864-3873.
Stell, W. K., H. Ding and X. Zhong (2013). "Effects of outdoor light on experimental hyperopic
anisometropia (lens-induced myopia) in infant rhesus monkeys." E-Abstract (P28),
2013 Bi-annual International Myopia Conference, California, USA.
Stone, R. A., T. Lin, D. Desai and C. Capehart (1995). "Photoperiod, early post-natal eye growth,
and visual deprivation." Vision Research 35(9): 1195-1202.
Stone, R. A., T. Lin, A. M. Laties and P. M. Iuvone (1989). "Retinal dopamine and formdeprivation myopia." Proceedings of the National Academy of Sciences of the United
States of America 86(2): 704-706.
Teasdale, T. W., J. Fuchs and E. Goldschmidt (1988). "Degree of myopia in relation to
intelligence and educational level." The Lancet 2(8624): 1351-1354.
Troilo, D., M. D. Gottlieb and J. Wallman (1987). "Visual deprivation causes myopia in chicks
with optic nerve section." Current Eye Research 6(8): 993-999.
Troilo, D., D. L. Nickla, J. R. Mertz and J. A. Summers Rada (2006). "Change in the synthesis
rates of ocular retinoic acid and scleral glycosaminoglycan during experimentally
altered eye growth in marmosets." Investigative Ophthalmology and Visual Science
47(5): 1768-1777.
Veerappan, S., M. Schache, K. K. Pertile, F. M. Islam, C. Y. Chen, P. Mitchell, M. Dirani and P. N.
Baird (2009). "The retinoic acid receptor alpha (RARA) gene is not associated with
myopia, hypermetropia, and ocular biometric measures." Molecular Vision 15: 13901397.
Verhoeven, V. J., P. G. Hysi, R. Wojciechowski, Q. Fan, J. A. Guggenheim, R. Höhn, S.
Macgregor, A. W. Hewitt, A. Nag, C. Y. Cheng, E. Yonova-Doing, X. Zhou, M. K. Ikram,
G. H. Buitendijk, G. McMahon, J. P. Kemp, B. S. Pourcain, C. L. Simpson, K. M. Mäkelä,
T. Lehtimäki, M. Kähönen, A. D. Paterson, S. M. Hosseini, H. S. Wong, L. Xu, J. B. Jonas,
87
O. Pärssinen, J. Wedenoj, S. P. Yip, D. W. Ho, C. P. Pang, L. J. Chen, K. P. Burdon, J. E.
Craig, B. E. Klein, R. Klein, T. Haller, A. Metspalu, C. C. Khor, E. S. Tai, T. Aung, E.
Vithana, W. T. Tay, V. A. C. f. R. E. a. M. C. Barathi, P. Chen, R. Li, J. Liao, Y. Zheng, R. T.
Ong, A. D. C. a. C. T. E. o. D. I. a. C. D. E. R. G. Döring, D. M. Evans, N. J. Timpson, A. J.
Verkerk, T. Meitinger, O. Raitakari, F. Hawthorne, T. D. Spector, L. C. Karssen, M.
Pirastu, F. Murgia, W. W. T. C. C. C. W. Ang, A. Mishra, G. W. Montgomery, C. E.
Pennell, P. M. Cumberland, I. Cotlarciuc, P. Mitchell, J. J. Wang, M. Schache, S.
Janmahasatian, R. P. J. Igo, J. H. Lass, E. Chew, S. K. Iyengar, F. G. M.-C. S. Group., T. G.
Gorgels, I. Rudan, C. Hayward, A. F. Wright, O. Polasek, Z. Vatavuk, J. F. Wilson, B.
Fleck, T. Zeller, A. Mirshahi, C. Müller, A. G. Uitterlinden, F. Rivadeneira, J. R.
Vingerling, A. Hofman, B. A. Oostra, N. Amin, A. A. Bergen, Y. Y. Teo, J. S. Rahi, V.
Vitart, C. Williams, P. N. Baird, T. Y. Wong, K. Oexle, N. Pfeiffer, D. A. Mackey, T. L.
Young, C. M. van Duijn, S. M. Saw, J. E. Bailey-Wilson, D. Stambolian, C. C. Klaver and C.
J. Hammond (2013). "Genome-wide meta-analyses of multiancestry cohorts identify
multiple new susceptibility loci for refractive error and myopia." Nature Genetics
45(3): 314-318.
Vessey, K. A., K. A. Lencses, D. A. Rushforth, V. J. Hruby and W. K. Stell (2005). "Glucagon
receptor agonists and antagonists affect the growth of the chick eye: a role for
glucagonergic regulation of emmetropization?" Investigative Ophthalmology and
Visual Science 46(11): 3922-3931.
Vitale, S., L. B. Ellwein, M. F. Cotch, F. L. Ferris and R. D. Sperduto (2008). "Prevalence of
refractive error in the United States, 1999e2004." Archives of Ophthalmology 126(8):
1111-1119.
Vitale, S., R. D. Sperduto and F. L. Ferris, 3rd (2009). "Increased prevalence of myopia in the
United States between 1971-1972 and 1999-2004." Archives of Ophthalmology
127(12): 1632-1639.
Vongphanit, J., P. Mitchell and J. J. Wang (2002). "Prevalence and progression of myopic
retinopathy in an older population." Ophthalmology 109(4): 704-711.
Wallman, J. and J. I. Adams (1987). "Developmental aspects of experimental myopia in chicks:
susceptibility, recovery and relation to emmetropization." Vision Research 27(7):
1139-1163.
Wallman, J., J. I. Adams and J. N. Trachtman (1981). "The eyes of young chickens grow toward
emmetropia." Investigative Ophthalmology and Visual Science 20(4): 557-561.
Wallman, J., M. D. Gottlieb, V. Rajaram and L. A. Fugate-Wentzek (1987). "Local retinal regions
control local eye growth and myopia." Science 237(4810): 73-77.
88
Wallman, J., C. F. Wildsoet, A. Xu, M. D. Gottlieb, D. L. Nickla, L. Marran, W. Krebs and A. M.
Christensen (1995). "Moving the retina: Choroidal modulation of refractive state."
Vision Research 35(1): 37-50.
Wallman, J. and J. Winawer (2004). "Homeostasis of eye growth and the question of myopia."
Neuron 43(4): 447-468.
Wildsoet, C. (2003). "Neural pathways subserving negative lens-induced emmetropization in
chicks--insights from selective lesions of the optic nerve and ciliary nerve." Current Eye
Research 27(6): 371-385.
Wildsoet, C. F. and J. Wallman (1995). "Choroidal and scleral mechanisms of compensation for
spectacle lenses in chicks." Vision Research 35(9): 1175-1194.
Winawer, J. and J. Wallman (2002). "Temporal constraints on lens compensation in chicks."
Vision Research 42(24): 2651-2668.
Witkovsky, P., R. Gabriel, J. W. Haycock and E. Meller (2000). "Influence of light and neural
circuitry on tyrosine hydroxylase phosphorylation in the rat retina." Journal of
chemical neuroanatomy 19: 105-116.
Woo, W. W., K. A. Lim, H. Yang, X. Y. Lim, F. Liew, Y. S. Lee and S. M. Saw (2004). "Refractive
errors in medical students in Singapore." Singapore Medical Journal 45(10): 470-474.
Wu, H. M., B. Seet, E. P. Yap, S. M. Saw, T. H. Lim and K. S. Chia (2001). "Does education
explain ethnic differences in myopia prevalence? A population-based study of young
adult males in Singapore." Optometry and Vision Science 78(4): 234-239.
Wu, P. C., C. L. Tsai, H. L. Wu, Y. H. Yang and H. K. Kuo (2013). "Outdoor activity during class
recess reduced myopia onset and progression in school children." Ophthalmology
120(5): 1080-1085.
Xiang, F., Y. Zeng, J. Zhang, I. Morgan, K. A. Rose and M. He (2013). "Protective Effect of Time
Outdoors on the Development of Juvenile-‐onset Myopia: the Guangzhou Outdoor
Activity Longitudinal (GOAL) Study: a 3-‐Year Cluster Randomized Trial." AbstractInternational Myopia Conference 2013.
Yi, J. H. and R. R. Li (2011). "Influence of near-work and outdoor activities in myopia
progression in school schildren (in Chinese)." Zhongguo Dang Dai Er Ke Za Zhi 13(1):
32-35.
Yoshida, K., K. Kawamura and J. Imaki (1993). "Differential expression of c-fos mRNA in rat
retinal cells: regulation by light/dark cycle." Neuron 10(6): 1049-1054.
Zadnik, K., D. O. Mutti, G. L. Mitchell, L. A. Jones, D. Burr and M. L. Moeschberger (2004).
"Normal eye growth in emmetropic schoolchildren." Optometry and Vision Science
81(11): 819-828.
89
Zeng, G. and S. A. McFadden (2010). "Regional variation in susceptibility to myopia from partial
form deprivation in the guinea pig." ARVO Meetin Abstracts 51: 1736.
Zhong, X., J. Ge, E. L. Smith, 3rd and W. K. Stell (2004). "Image defocus modulates activity of
bipolar and amacrine cells in macaque retina." Investigative Ophthalmology and Visual
Science 45(7): 2065-2074.