Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Delta-6-desaturase Links PUFA Metabolism with Phospholipid
Transcript
Delta-6-desaturase Links PUFA Metabolism with Phospholipid Remodeling and Disease Progression in Heart Failure Le et al: Phospholipid Remodeling in Heart Failure Catherine H. Le, PhD1,2*; Christopher M. Mulligan, MS1,3*; Melissa A. Routh, MS1,2; Gerrit J. Bouma, PhD4; Melinda A. Frye, PhD4; Kimberly M. Jeckel, PhD4; Genevieve C. Sparagna, PhD6; Joshua M. Lynch, MS6; Russell L. Moore, PhD5; Downloaded from http://circheartfailure.ahajournals.org/ by guest on November 17, 2016 Sylvia A. McCune, PhD5; Michael Bristow, MD, PhD7; Simona Zarini, PhD8; Robert C. Murphy, PhD8; Adam J. Chicco, PhD1-5 1 Integrative Cardiac Biology Laboratory, 2Program in Cell and Molecular Moleecu cula larr Bi la Biol Biology, oloog ol og Departments of 3Food Science and nd H Human uman um a N an Nutrition, utrition, 4Biomedic Biomedical Bi diiccal al Sciences, S i aand n 5Health and Exercise nd Science, Colorado State tate Univers University, r itty, rs y Fort For ort Collins, Coll Co l ins, ll s, CO; CO O; 6De Department Depa partme ment ntt ooff In Inte Integrative tegr te graattiv Physiology, gr University of Colorado, ado ado o, Bo Boul Boulder, ulddeer, r C CO; O 7Di O; Division Divi visi vi sion si on of of Cardiology Card Ca rdio rd iolo io logy lo gy and anndd 8De Department Depa part pa rtme rt mennt of me Pharmacology,, University v versity of Colorad Colorado ad do at at D Denver, enve en v r, D Denver, enve en ver, ve r C CO O *These authors contributed equally Correspondence to Adam J. Chicco, PhD Colorado State University 200 West Lake Street, Mailstop 1582 Phone: 970-491-3605 Fax: 970-491-0445 Email: [email protected] DOI: 10.1161/CIRCHEARTFAILURE.113.000744 Journal Subject Codes: Myocardial biology:[107] Biochemistry and metabolism, Heart failure:[110] Congestive, Hypertension:[16] Myocardial cardiomyopathy disease, Basic science research:[130] Animal models of human disease Abstract Background—Remodeling of myocardial phospholipids has been reported in various forms of heart failure for decades, but the mechanism and pathophysiological relevance of this phenomenon have remained unclear. We examined the hypothesis that delta-6 desaturase (D6D), the rate limiting enzyme in long-chain polyunsaturated fatty acid (PUFA) biosynthesis, mediates the signature pattern of fatty acid redistribution observed in myocardial phospholipids following chronic pressure overload, and explored plausible links between this process and disease pathogenesis. Methods and Results—Compositional analysis of phospholipids from hearts explanted from Downloaded from http://circheartfailure.ahajournals.org/ by guest on November 17, 2016 patients with dilated cardiomyopathy revealed elevated PUFA product/precursor ratios reflective of D6D hyperactivity, manifesting primarily as lower levels of linoleic acid with reciprocally tte tern rn n ooff re remo mode mo dell de higher levels of arachidonic and docosahexaenoic acids. This pattern remodeling was icula laar as aassist sist si st ddevice. e ev attenuated in failing hearts chronically unloaded with a left ventricular Chronic n vvivo ivo rev iv everrsed similar patterns of ev of myocardial myocaard r iaal PUFA redistrib b inhibition of D6D in reversed redistribution in rat ove ove verload and an nd hypertensive hypeertensive hy vee heart heartt dise seaase, aand se ndd ssignificantly ig gnifica canntly aattenuated ca ttt models of pressure overload disease, cardiac dysfunctio dy ionn inn both io botth models. m de mo d ls. D6D inhibition n also attenuated hypertrophy, fibrosiss andd contractile dysfunction ns in ppathogenic atho at hoge ho g ni ge nicc ei eico cosa co sano sa noid no id sspecies, p ci pe cies es,, li es lipi p d pe pi pperoxidation, rox oxid idat id atio at ionn, aand io nd E myocardial elevations eicosanoid lipid ERK1/2 activation; normalized cardiolipin composition in mitochondria; reduced circulating levels of inflammatory cytokines; and elicited model-specific effects on cardiac mitochondrial respiratory efficiency, NFțB activation and caspase activities. Conclusions—These studies demonstrate a pivotal role of essential fatty acid metabolism though D6D in myocardial phospholipid remodeling induced by hemodynamic stress, and reveal novel links between this phenomenon and the propagation of multiple pathogenic systems involved in maladaptive cardiac remodeling and contractile dysfunction. Key Words: heart failure, hypertension, fatty acid, metabolism, inflammation 1 Heart failure is a complex, multifactorial syndrome characterized by progressive cardiac remodeling and contractile dysfunction that leads to an impaired matching of blood supply to tissue demands. Antecedent hypertension is present in the majority of cases1, supporting a paradigm by which chronic hemodynamic overload of the myocardium results in initially compensatory adaptations that ultimately become maladaptive, leading to pathologic hypertrophy, fibrosis and mechanical failure. Several well-established pathogenic systems have Downloaded from http://circheartfailure.ahajournals.org/ by guest on November 17, 2016 been implicated in the transition from adaptive cardiac hypertrophy to maladaptive remodeling and failure, including chronic inflammation2, oxidative stress3, impaired myocardial energetics4 and apoptosis5. However, the molecular triggers and precise contribution ntribu buti bu tion ti on of of these thees th es processes nse investigation ns inves e tiigation and debate. es remain areas of intense Alterations inn the the h fatty fattty t acid acidd composition co omp mpos osittio os ionn of of myocardial myoocar my ardiial phospholipids phosp sphooli sp lipi pidds hhave pi av v been reported 6, 7 c pathologyy fo forr ov ove er 25 2 yyears, eaars rs, in ncl c ud udin ing human cardiom in m in various forms of cardiac over including cardiomyopathies and animal models of pressure overload hypertrophy 77, 8, hypertensive heart disease 7, 9, postinfarct remodeling10, diabetic cardiomyopathy11, and senescence 12. Interestingly, despite distinct etiologies, genetic backgrounds, and biochemical techniques, the pattern of phospholipid remodeling has consistently manifested as a proportional loss of the essential polyunsaturated fatty acid (PUFA) linoleic acid (18:2n6; LA), often paralleled by reciprocal increases in long chain highly unsaturated fatty acids such as arachidonic acid (20:4n6, AA) and/or docosahexaenoic acid (22:6n3, DHA). While several hypotheses have been proposed, the mechanism and pathophysiological relevance of this phenomenon have remained areas of speculation. 2 The present investigation explored the hypothesis that the redistribution of phospholipid PUFAs in the pressure overloaded heart results from increased activity of delta-6 desaturase (D6D), the rate-limiting enzyme in the production of long-chain PUFAs such as AA and DHA from LA and D-linolenic acid (18:3n3, ALA), respectively13 (Figure 1). Serum PUFA ratios reflective of systemic D6D hyperactivity have been reported in patients with hypertension14, 15, and are highly predictive of overall cardiovascular mortality in humans16. However, no experimental studies have investigated the role of this enzyme in myocardial phospholipid Downloaded from http://circheartfailure.ahajournals.org/ by guest on November 17, 2016 remodeling or the pathogenesis of heart disease. Herein, we present the first comprehensive with hou o mechanical analysis of phospholipid composition in the failing human heart with and without unloading support, and investigated the effects of chronic pharmacological acolo lo ogi gica call D6 ca D6D D inhibition in ess ess ssure overload ovver erlo l ad hypertrophy hyp yper ertr er trop tr o hyy and op an nd hypertensive hype hy pert pe r en ensive heart ensi hea eart rt ddisease. isea is ease ea se. These studies se rodent models of pressure a ro al role le ooff D6 D6D D in in m yoo rd yocard rdia iall ph ia phos osph osph phol olip ol ipid ip id rremodeling emod em oddel elin ingg re in rresulting sult su lt demonstrate a central myocardial phospholipid from nd rreveal ev vea eall no nove vell li ve link nkss be nk betw twee tw eenn th ee this iss pprocess roce ro cess ce ss aand nd ddisease isea is ease ea se pprogression ro hemodynamic stresss aand novel links between at the molecular, organ, and systemic levels. Methods Human Heart Tissue Left ventricular tissue was obtained by an Institutional Review Board-approved protocol maintained by the University of Colorado Denver Cardiac Tissue Bank. Hearts donated for research purposes were obtained under written consent from family members of organ donors or by direct written consent from patients undergoing cardiac transplantation. Patient characteristics are presented in Table S1. 3 Animal Models Lean male spontaneously hypertensive heart failure (Mccfacp-/-; SHHF) rats were obtained from a colony maintained at the University of Colorado. SHHF rats were selected for these studies based on their well-characterized development of progressive hypertensive cardiomyopathy that shares many of the hallmark biochemical and pathophysiological features of DCM in humans17. Downloaded from http://circheartfailure.ahajournals.org/ by guest on November 17, 2016 Two cohorts of animals were studied: 1) at 21-22 months of age when rats exhibit pathologic ), and 2) follo ow cardiac hypertrophy progressing toward dilated heart failure (HF), following thoracic path thol th olog ol ogic og ic hhypertrophy in aortic banding at 3 months of age to induce hemodynamic stress andd pa pathologic ela lated pathology paath hol o og ogyy (TAC) (T TAC AC))7. Cohorts Coh o or ortss of of HF and and TAC AC (2 (2 weeks week we ekss post-surgery) ek the absence of age-related divided vide vi dedd aan de and nd ma matc matched tcheed on eechocardiography tc choc ch ocar oc arrdi d og ogra raph ra phyy pa ph para parameters raame mete terrs bbefore te e or ef oree being semianimals were each divi randomly assigned to o rreceive ecei ec eive ei ve tthe he D D6D 6D iinhibitor nhib nh ibit ib itor it or ((SC) SC)) oorr no ddrug rugg fo ru forr 4 we week weeks. ekss. T ek The h effect of the D6D inhibition was also examined in 3 month old SHHF rats exposed to a sham TAC surgery (Sham) that were followed along with TAC groups for 4 weeks as an experimental control. All animals were provided Purina 5001 chow and water ad libitum for the duration of the study. At the conclusion of the study, animals were sacrificed with a lethal dose of sodium pentobarbital (150 mg/kg i.p.) followed by midline thoracotomy and removal of the heart. All procedures were approved by the Animal Care and Use Committee at Colorado State University and/or University of Colorado Boulder in strict compliance with the Guide for the Care and Use of Laboratory Animals published by the US National Institutes of Health (NIH Publication No. 8523, revised 1996). 4 Inhibition of D6D in vivo Rats were administered the potent, orally active D6D inhibitor SC-26196 (a gift from Dr. Mark Obukowicz, Pfizer Corporation), at a dose previously reported to selectively inhibit D6D enzyme activity with no effect on other desaturase enzymes in rodents in vivo (100 mg/kg/d mixed in chow for 4 weeks), based on daily food consumption records taken over 3-4 weeks prior to treatment18. Downloaded from http://circheartfailure.ahajournals.org/ by guest on November 17, 2016 Echocardiography and Blood Pressure urane ne aanesthesia nest ne sthe st hessi he sia prior to and Transthoracic echocardiography was performed under light isoflurane k eexperimental xperim im men enta tall pe ta peri riod ri od uusing s ng a 12 si 12 M Hz ppediatric e ia ed iatr ttrricc ttransducer rans ra n du duce cerr connected ce c following the 4 week period MHz to a n s 55 nos 55500 500 00 U l ras lt raasou o nd aass pr prev evio ev ious io usly us ly y ddescribed escr es crib cr ibed ib ed1199. Tail Tai aill cuff cuff ff blood blo lo pressure Hewlett Packard Sonos Ultrasound previously measurements were obtained obta ob tain ta ined in ed in in the the Sham Sham and and HF HF groups gro roup up ps using usin us ingg the in the Kent Kent Coda Cod odaa 6 system (Kent Scientific, Torrinton, CT) in lightly isoflurane-anesthetized rats. Lipid analyses See the Expanded Methods on the online supplement for a detailed description of lipid analyses. Briefly, phospholipids were extracted by thin layer chromatography (total) or liquid chromatography (individual species) for compositional analysis by gas chromatography (fatty acid composition) or electrospray ionization mass spectrometry (cardiolipin molecular species).9 Myocardial contents of free AA and eicosanoid species were quantified in lipid extracts obtained from 50 mg of LV tissue by LC/MS/MS methods using deuterated standards as previously described 20. 5 Mitochondrial isolation and respiratory function Mitochondria were freshly isolated from ~300 mg of left ventricular (LV) tissue by differential centrifugation in the absence of proteases and assayed for respiratory function using a Clark-type electrode system (Strathkelvin) with pyruvate + malate as substrates as previously described19 . Biochemical analyses Downloaded from http://circheartfailure.ahajournals.org/ by guest on November 17, 2016 Immunoblotting was performed by standard methods using commercially available antibodies. tric assays (Biovision). (Bio iov io Serum glucose and free fatty acids were determined by colorimetric Caspase nesce c nc ce ncee as assa sayy (Promega). sa activities were determined in 30 mg of LV homogenates by luminescence assay ypr ypr prooline wa wass qu quan antiitat an ated ed aass a ma arker er ooff co ccollagen oll llag ll agen ag n (f (fib ibro ib rosi ro sis) si s) iin n 30-40 mg of Myocardial hydroxyproline quantitated marker (fibrosis) 2 collor col orim imet im e riic assay et ass ssay a of of Sw Swit itze it zerr an ze nd Su Summ mmer mm er 21 . Serum Ser erum um ccytokines y ok yt okin in were septal tissue by the colorimetric Switzer and Summer determined in 80 ȝL L of ssample ampl am p e by pl yE ELISA LISA LI SA cytokine cyt y ok okin inee array in arra ar rayy (Raybiotech). ra (Ray (R ay ybi biot otec ot ech) ec h)). qRT-PCR qRT RT-P -PC -P C was performed using 2X SYBR Green qPCR Master Mix and validated gene specific primers (listed in Table S2) with resulting data normalized to 18S rRNA and analyzed according to the comparative (ǻǻCt) Ct method. Statistical analyses All data are presented as group means r standard error. Human heart data were compared by one-way ANOVA with Tukey HSD tests post hoc when appropriate. Data from the animal studies were analyzed by separate 2 (condition) X 2 (drug) ANOVAs for determination of main and interaction effects of SC treatment and TAC or HF vs. Sham cohorts, followed by Dunnett’s test for comparison of group means vs. Sham control. Mean differences between SC-treated and 6 untreated groups were compared by Independent sample t-tests to examine a priori hypothesized effects of D6D inhibition within each condition. Pre- to post-treatment differences in echocardiography parameters were examined by paired t-tests for each condition cohort. Pearson correlations were calculated to determine the associations between phospholipid fatty acid composition and lipid peroxidation adducts. All reported p-values are two sided. Statistical significance was established at P < 0.05, using SPSS 21 software (IBM) for all analyses. Downloaded from http://circheartfailure.ahajournals.org/ by guest on November 17, 2016 Results rtt aand are reversed Phospholipid indices of D6D activity are elevated in the failing human heart by mechanical unloading etar et a y supplementation, supp ppple leme ment me ntat ntat nt atio atio ion, n, desaturation des e at atuuraatiionn aand n eelongation nd l ng lo ngatio ionn of io of L A aand ndd ALA provide the In the absence of dietary LA a n PUFAs ain PUF UFAs As present preese sentt in in mammalian mamm ma mmaaliian mm n tissues. tis issu sues su es. The es The most most abundant abu bund ndan nd an n of these are AA majority of long-chain ong with wit ithh LA account acc ccou ount ou nt for for over ove verr 90% 90% of PUFAs PUF UFAs As in in membrane memb me mbra mb rane ra ne phospholipids, p and DHA, which along their primary site of incorporation. D6D catalyzes rate-limiting steps in this pathway (Figure 1), therefore, changes in specific tissue phospholipid PUFA product/precursor ratios (e.g., AA/LA, 20:3n6/LA and DHA/22:5n3) reflect chronic changes in D6D activity in vivo16 . Reduced levels of cardiolipin molecular species normally enriched with LA acyl chains have been reported in hearts explanted from patients with dilated and ischemic cardiomyopathies6 7. However, whether these changes occur in other phospholipid classes or are reflective of a global redistribution of PUFAs in the total myocardial phospholipid pool was not addressed. Therefore, we performed a detailed compositional analysis of myocardial phospholipids from patients with dilated cardiomyopathy (DCM; n = 8) with or without mechanical unloading with a left ventricular assist device for at least 4 months prior to explant (LVAD; n = 4) (Figure 2). 7 Patient characteristics are presented in Table S1. Hearts from DCM patients exhibited markedly lower proportions of total phospholipid LA, with correspondingly higher levels of AA, DHA and PUFA product/precursor ratios reflective of D6D hyperactivity compared to donor hearts from age-matched individuals with no cardiac pathology (NF; n = 8). Comparatively minor differences were seen in saturated and monounsaturated fatty acid species (Figure S1). Chronic LVAD support was associated with significantly higher phospholipid LA levels and reduced AA, DHA and D6D product/precursor ratios compared to DCM. Compositional analysis of the three Downloaded from http://circheartfailure.ahajournals.org/ by guest on November 17, 2016 major phospholipid species present in the mammalian heart, phosphatidylcholine (PC), ns of fatty acid phosphatiydylethanolamine (PE) and cardiolipin (CL), revealed similar pattern patterns tudee ooff ch han ange gess and relative ge redistribution observed in total phospholipids, though the magnitude changes dua u l fatty fattty acids ac ds varied var arie iedd considerably ie cons co nssid i errably y between bet e weeen classes c as cl asse sess (Figure se (F Fig igur ure S1). ur abundance of individual e se erse er sess ph phos osph os p ol ph olip ipid ip id P UFA UF A remodeling remo re mode mo deli de ling li ngg in in TAC TAC and and HF D6D inhibition reverses phospholipid PUFA As seen in DCM patients, hearts from both TAC and HF animals exhibited markedly lower phospholipid LA content, with corresponding elevations in AA, DHA and D6D product/precursor ratios in total myocardial phospholipids compared to Sham controls (Figure 3A,B). Chronic administration of the D6D inhibitor ameliorated these effects of TAC and HF, bringing total phospholipid LA, AA, DHA and D6D activity indices to near Sham control levels. Despite intrinsic differences in baseline fatty acid composition, similar patterns of PUFA redistribution were seen within individual phospholipid classes in both models that were reversed by D6D inhibition (Figure S2). Interestingly, only minor effects of D6D inhibition were seen on phospholipid PUFA composition in the Sham rats, suggesting that “basal” levels of PUFAs in membranes are highly defended, perhaps aided by an incomplete inhibition of D6D enzymatic 8 activity in vivo (over a 24 hour period) and/or trace amounts of AA and DHA present in rodent chow (Purina 5001). D6D inhibition normalizes the cardiolipin molecular species profile in mitochondria Alterations in the highly regulated fatty acid composition of cardiolipin may have particular relevance in cardiac pathologies22. Therefore, cardiolipin molecular species were also examined in cardiac mitochondria isolated from animals in this study. As previously reported 7, a marked Downloaded from http://circheartfailure.ahajournals.org/ by guest on November 17, 2016 loss of the predominant tetra-linoleoyl species (L4CL) was seen in TAC and HF mitochondria, or DHA (highly (highl hlly unsaturated CL; which corresponded to elevations in species containing AA and/or HUFA(CL)), without any appreciable effect on total CL content (Figure (Figu gure gu re 3C 3C and and S4). D6D inhibition completely ly normalized ly normal a izzed the al the CL CL molecular mole mo l cu cularr species sppec ecie ies profile ie prof pr offil ile in TAC TAC aand nd H HF, restoring L4CL and reducing HUFA(CL) HUFA HU FA(C (CL) (C L) species spe peci c ess to to Sham Shham control con o tr trol ol llevels evel ev e s in el n bboth othh gr ot ggroups. oups ou p .T ps These h data provide novel evidence nce for for a central cen entr tral tr al role rol olee of LA LA desaturation desa de satu sa tura tu rati ra tion ti on and/or and nd/o /orr en /o endo endogenous doge do g no ge nous us H HUFA production in modulating CL composition in the hypertrophied and failing heart. Myocardial free arachidonic acid and eicosanoid contents Once liberated from phospholipids by phospholipase enzymes, AA can serve as a substrate for multiple oxygenase enzymes and non-enzymatic oxidation pathways capable of generating a host of bioactive eicosanoid species with complex effects on inflammatory, cardiovascular and transcriptional regulation 23, 24 . Both TAC and HF elicited significant increases in free AA and several eicosanoid species in the heart, all of which were reduced to near control levels with D6D inhibition (Figure 3D). Particularly significant changes were seen in 12- and 15hydroxyeicosatetraenoic acid (12- and 15-HETE), thromboxane A2 (TXA2), and isoprostanes 9 (IPs), which are formed via 12/15-LO, COX-2, and the non-enzymatic peroxidation of AA by ROS, respectively. Serum and hepatic phospholipids, circulating cytokines and animal characteristics Analysis of total serum and liver phospholipids revealed similar patterns of PUFA distribution seen in cardiac phospholipids in TAC and HF (Figure S2), suggesting that myocardial changes may be reflective of elevated systemic (e.g., hepatic) D6D activity. No significant effects of Downloaded from http://circheartfailure.ahajournals.org/ by guest on November 17, 2016 D6D inhibition were observed on body weight, serum glucose, free fatty acids, or blood pressure ron o in any of the groups (Table). However, significant elevations in serum interfer interferon-gamma (IFNg) d HF F groups grou gr ou ups w e attenuated er and serum monocyte chemotactic protein-1 (MCP-1) in TAC and were 18 tment, consistent tm con on nsi s stten entt with with an an anti-inflammatory an nti ti-inf nflaamm mmat ator at oryy effect or e ffec ef ecct of D 6D iinhibition n . with SC-26196 treatment, D6D nua uate tess maladaptive te mala ma lada la dapt da ptiv pt ivee cardiac iv card ca rdia rd iacc remodeling ia remo re mode mo deli de ling li ngg aand nd ccontractile ontr on trac tr acti ac tile ti le ddysfunction ysf ys sff D6D inhibition attenuates Echocardiography performed before and after the 4-week experimental period revealed significant progression of left ventricular dilatation and contractile dysfunction in the untreated TAC and HF animals that were significantly attenuated or reversed by D6D inhibition (Figure 4A, B). These improvements corresponded to lower final heart weights in the treated TAC and HF rats compared to untreated animals, and a trend for lower wet lung weights suggestive of reduced pulmonary congestion (Figure 4C, Table S3). Notably, a mild degree of cardiac hypertrophy and reduced fractional shortening is evident in the Sham SHHF rats compared to other rat strains at this age 7, 17 that was unaffected by D6D inhibition, indicating that this treatment attenuates the progression of more marked pathologic remodeling and dysfunction seen following chronic hemodynamic stress. Myocardial fibrosis, assessed by tissue 10 hydroxyproline content, was also reduced by D6D inhibition in TAC and HF (Figure 5B), which paralleled histological evidence of reduced interstitial and perivascular collagen deposition (Figure 5B, S7). TAC and HF significantly increased mRNA expression of atrial natriuretic peptide (ANP) and myocardial extracellular-regulated activated kinase 1/2 (ERK1/2) phosphorylation compared to Sham controls, which was largely prevented by D6D inhibition treatment in both models (Figure 5C, D). TAC, and to a lesser extent HF, were both associated with myocardial activation of nuclear factor kappa B (NFƸB), indicated by degradation of its Downloaded from http://circheartfailure.ahajournals.org/ by guest on November 17, 2016 endogenous inhibitory regulator I kappaB alpha (IƸBD), which was significantly attenuated in TAC, but not HF (Figure 5E). ria ial respiration respir irrat atio on and and caspase casp ca spas sp asse activities acctiiviiti ties es Cardiac mitochondrial n /o nd/o /orr ef ffi f ciien ncy c ooff ox ooxidative i attiv id ivee ph phos ossph phor oryl or ylat yl atiion iin at n ca card rdiaac mitochondria rd m tto mi o Reduced capacity and/or efficiency phosphorylation cardiac may bbioenergetics ioe oene nerg ne rg get etic icss an ic andd co cont ntri nt ribu ri butte th bu thee de deve veelo lopm p en pm entt an and/ d/or d/ or pprogression rogr ro gres gr esss es impair myocardial bi contribute development and/or of heart failure4. However, TAC had no effect on mitochondrial state 3 (ADP phosphorylating) or state 4 (uncoupled) respiration in the presence or absence of D6D inhibition (Figure 6A). Conversely, HF was associated with depressed state 3 respiration, respiratory control (RCR) and oxidative phosphorylation efficiency (ADP/O ratio) compared to TAC and Sham. D6D inhibition decreased state 4 respiration and restored RCR and ADP/O to near Sham control levels in HF mitochondria, but had no effect on state 3 respiration. Immunoblotting of mitochondrial proteins for respiratory complex subunits revealed a deficiency in complexes 1 and 2 in HF consistent with reduced respiratory capacity in this group (Figure 6B), which was similarly unaffected by D6D inhibition. Activities of capase-9 and caspase-3/7 were elevated in 11 myocardial tissue from TAC and HF rats compared to Sham controls (Figure 6C). Treatment with SC-26196 significantly attenuated caspase activities in TAC, but had no effect in HF. D6D inhibition reduces cardiac lipoxidative stress Aldehyde products of PUFA peroxidation such as malondialdehyde (MDA) and 4hydroxynonenal (HNE) are common markers of oxidative stress that correlate closely with the incidence and severity of heart failure in humans25. The peroxidizability of PUFAs increases Downloaded from http://circheartfailure.ahajournals.org/ by guest on November 17, 2016 exponentially with their double bond content 26, therefore the calculated cardiac membrane nd was normalized normali liiz to Sham peroxidizability index increased significantly in TAC and HF, and levels by D6D inhibition (Figure 7A). Consistent with this observation, rvati tion on,, MDAon MDA- and a HNE-protein adducts were elevated ed in ed in TAC AC and andd HF HF hearts, hear he arts ar ts, and and were w ree significantly we sig igni nifi ni f ca fi cant an ly y reduced red educ uced uc ed by by D6D inhibition (Figure 7B). Myocardial a di ardi dial al MDA MDA levels lev evel e s correlated c rr co r ellat ateed positively poosi s ti tive veely w with ithh th it thee re rela relative lati la t ve pproportion ti ro op of DHA in myocardial phospholipids p ol phol ph olip ipid ip idss across id acro ac ross ro ss the the experimental expper eriime ment ntal nt al groups, gro roup upps,, whereas whe here reas re as a strong str tron ongg ne on negative e correlation was seen between HNE and phospholipid LA (Figure 7C). D6D inhibition also tended to decrease myocardial superoxide dismutase (SOD) and glutathione peroxidase (GSHPx) enzyme contents (Figure 7D), collectively suggesting a decrease in myocardial oxidative stress. Cardiac and hepatic D6D expression While our lipid analyses support a central role of D6D in myocardial phospholipid remodeling associated with pressure overload, the mechanism driving D6D activity in response to hemodynamic stress is less clear. Expression of D6D is very low in the heart, and while detectable, we found no evidence of upregulation at the protein or mRNA levels, nor any significant changes in expression of downstream elongation/desaturation enzymes in TAC, HF or 12 human DCM (Figure S5). Interestingly, LVAD treatment significantly reduced myocardial D6D mRNA expression compared to DCM and NF controls, despite no detectable changes in enzyme protein content, suggesting potential regulatory role of hemodynamic unloading on at least enzyme expression in the human heart. Hepatic D6D might have influenced myocardial membrane composition by altering the distribution of PUFA supplied to the heart from the circulation (Figure S2), however liver D6D expression was also unaffected by TAC or HF (Figure S5). Little is known regarding posttranslational regulation of D6D activity, but putative Downloaded from http://circheartfailure.ahajournals.org/ by guest on November 17, 2016 mechanisms are currently being investigated in our laboratory. Discussion em nstrat emo a es a pivotal at pivo pi vota vo tall role ta role l of of essential esse senttia iall fatty fatt fa t y acid tt ac metabolism met etab ab abol bol olis ism is m through t The present study demonstrates D6D in t re ppattern ture atte at tern te rn off pphospholipid hoosp s ho holiipi pidd PU PUFA FA rredistribution edis ed istr is trib tr ibuuttiion ib n aassociated s oc ss ocia i te ia t d with cardiac generating the signature le ex expe peri pe rime ri ment me ntal nt al m odel od els, el s, aand nd sshow how ho w th that at iitt is cclosely lose lo sely se ly y llinked inke in kedd to hhemodynamic ke pathology in multiple experimental models, stress in the failing human heart. The remarkable phenotypic effects of D6D inhibition in TAC and HF animals highlight the pathophysiological importance of this process, and provide novel insight into the mechanisms responsible for maladaptive remodeling and contractile dysfunction in the pressure overloaded myocardium. While previous studies have associated serum markers of D6D activity with coronary artery disease risk and inflammation 16, 27, the present study is the first to demonstrate a role for this enzyme in regulating myocardial membrane composition and responses to pathologic stress. The proportional loss of phospholipid LA is the most marked and consistent manifestation of membrane remodeling associated with cardiac overload across species, tissues, and phospholipid classes observed herein and in previous studies. The reversibility of this effect 13 by D6D inhibition implicates the conversion of LA into downstream PUFA desaturation/elongation products, the most prominent being AA. However, reciprocal increases in phospholipid AA were not seen to the same magnitude as LA losses in the present study. Importantly, PUFAs must be hydrolyzed from phospholipids by phospholipase A2 (PLA2) enzymes in order to react with desaturation/elongation enzymes, and are subsequently reesterifed into phospholipids by acyltransferase enzymes with varying substrate specificities 28. Similarly, AA is cleaved from myocardial phospholipids by PLA2 enzymes for subsequent metabolism as Downloaded from http://circheartfailure.ahajournals.org/ by guest on November 17, 2016 “free” AA by cyclooxygenase (COX), lipoxygenase (LO), or cytochrome P450 monooxygenase effects feec 24. Myocardial enzymes 23, generating a host of eicosanoid species with diverse biological effe PLA2 activity is elevated in states of pathologic stress, including heart heaart r ffailure a lu ai lure re 29, and 1, 32 upregulation of myocardial ocar oc a dial C COX OX 30 aand OX nd 112/15-LO 2 15 2/ 1 -L -LO O31, ppathways athw at hway hw ayss have ay h ve bbeen ha eenn im ee impl implicated p in the d omy dio myop oppat opat athy hy. Th hy T erref efor ore, D or 6D-d 6D -d depe pend nden nd entt in en incr crea cr e se sess in m yooccaa yoca pathogenesis of cardiomyopathy. Therefore, D6D-dependent increases myocardial levels of free AA and its eicosanoid sano sa noid no id dderivatives eriv er ivaati iv tive vess ob ve obse observed serv se rved rv ed iin n TA TAC C an andd HF aanimals nim imal alss ma al mayy ha have a contributed to maladaptive remodeling in these cohorts. Several lines of evidence implicate myocardial AA-derived eicosanoids in the development of cardiac fibrosis and failure. Among these, the pathogenic roles of TXA2 and 12/15-HETE have been established through the development of transgenic mice with cardiomyocyte-specific overexpression of COX-2 30 and 12/15-LO31, respectively; both of which develop marked cardiac fibrosis, hypertrophy and contractile dysfunction. Myocardial AA promotes extracellular receptor kinase (ERK) signaling and cardiac hypertrophy via activation of specific intracellular G protein-coupled receptors by TXA2 and ROS-derived isoprostanes in cardiomyocytes33, 34. Overproduction of 12-HETE also increases ERK activity, hypertrophy and fibronectin content in cardiac fibroblasts32, suggesting a potential role in myocardial fibrosis. 14 Therefore, D6D inhibition might have attenuated maladaptive remodeling by reducing ERK signaling by multiple AA-derived eicosanoid species. Eicosanoids also serve as potent initiators and propagators of inflammatory signaling, many of which converge on the NFƸB pathway 35. Cardiomyocyte NFƸB signaling has been implicated in the pathogenesis of cardiac hypertrophy and failure 36 and has been associated with COX-2 induction in the failing human heart 37. D6D inhibition tended to attenuate NFƸB activation in TAC in the present study, but had no effect in HF. This is consistent with clinical evidence for a greater degree of inflammation associated Downloaded from http://circheartfailure.ahajournals.org/ by guest on November 17, 2016 with compensatory hypertrophy during early aortic stenosis compared to decompensated HF38. ffects thatt are ddifferentially i Therefore, NFƸB may mediate temporal and/or model-specific effects modulated by altered myocardial eicosanoid levels and/or membrane ranee P PUFA UFA UF A co com composition. m In addition to o it its ts supp suppression pre ress ssio ss ionn of ffree io reee AA re A aand ndd eic eicosanoid icos ic osan os anoi an o d le oi leve levels, els ls, D6 D6D D in inhi inhibition hi reversed several significant changes han han nggees in the the h fatty fat a ty y acid aciid composition comp co mpos mp ossittio on of individual ind ndiv nd ivid iv id duaal ph pho phospholipid osppholi hooli l p classes that could have altered functional u ct unct un ctio iona io nall pr na pproperties oper op erti er ties ti es ooff me memb membranes mbra mb rane ra ness in w ne which hich hi ch tthey heyy re he resi reside. side si de. W de While h a comprehensive evaluation of these is beyond the scope of this investigation, the reversal of PUFA remodeling in cardiolipin is particularly relevant and warrants further discussion. Cardiolipin is a dimeric tetra-acyl phospholipid found exclusively in mitochondria, where it provides critical structural and functional support to proteins involved in oxidative phosphorylation, and regulates apoptotic signaling by binding cytochrome c to the inner mitochondrial membrane 22, 39. The majority of cardiolipin molecular species in the healthy mammalian heart contain four LA acyl chains (L4CL). Several studies report that this LA enrichment is lost in states of cardiac pathology, which has been suggested as a potential contributor to mitochondrial dysfunction and disease progression 22. It is well established that the compositional uniformity of cardiolipin results from a series of deacylation/ reacylation 15 reactions following de novo biosynthesis in mitochondria. At least three enzymes have been identified that are capable of catalyzing these reactions; however, none have exhibited the anticipated specificity for LA acyl chains that predominate in the mammalian heart 39 . It was recently suggested that the LA enrichment may arise from an enzymatic equilibrium distribution of fatty acids exchanged between multiple phospholipid species40. Our data are consistent with this hypothesis, demonstrating that changes in cardiolipin composition coincide with changes in PC, PE and total phospholipid fractions reflective of a global redistribution of membrane Downloaded from http://circheartfailure.ahajournals.org/ by guest on November 17, 2016 PUFAs. Notwithstanding changes in specific acyltransferase enzymes implicated in aberrant pressuure overloaded and cardiolipin remodeling 41, our findings indicate that loss of L4CL in the pressure failing heart results from increased flux of PUFAs through D6D andd ddownstream owns ow nstr ns trea tr eam ea m elongation/desaturation enzymes and/or liver. reduces tion tio io on enzy yme mes in tthe he hheart eart ea r an rt nd/ d orr liv ver er.. Th This i uultimately is l im lt mat atel elyy re el redu duce du ce the bioavailability of phospholipid h sp hosp spho h li ho lipi ipi p d LA for forr cardiolipin carrdiol olip ipin ip in re rremodeling mode mo deli de ling li ng iin n th thee he hear heart, a t, t ffavoring av avor voorri an exchange of LA for long chain (i.e., AA DHA). n PUFA PUF UFA A products p od pr oduc ucts uc ts ooff tthis hiss pa hi ppathway thwa th wayy (i wa .e., e A A an andd DH DHA) A)). Reduced capacity and/or efficiency of oxidative phosphorylation in cardiac mitochondria may contribute to the development and/or progression of heart failure, and aberrant cardiolipin remodeling has been postulated as a mechanism for these defects7, 19. However, despite a significant loss of L4CL, TAC had no effect on mitochondrial respiratory function in the presence or absence of D6D inhibition. Impaired oxidative phosphorylation capacity was seen in HF mitochondria, but this was unaffected by D6D inhibition and may have resulted from the loss of complexes 1 and 2 that deliver reducing equivalents to respiratory chain. Reductions in oxidative phosphorylation efficiency may also contribute to cardiac dysfunction in heart failure 42 . Therefore, increases in RCR and ADP/O with D6D inhibition, while relatively modest, could have contributed to improvements in cardiac function observed in HF. Taken together, these 16 findings indicate that the LA enrichment of cardiolipin, at least within the range observed in these studies, does not significantly influence the oxidative phosphorylation capacity of cardiac mitochondria, but may support efficient respiratory coupling. The observed dissociation of mitochondrial respiratory parameters from changes in cardiolipin composition and cardiac function in TAC and HF groups further argues against their direct relationship in these models. Apoptotic loss of cardiomyocytes during maladaptive cardiac remodeling may hasten the progression of pathologic hypertrophy to decompensated failure5 . Myocardial activities of Downloaded from http://circheartfailure.ahajournals.org/ by guest on November 17, 2016 capase-9 and caspase-3/7 were elevated in both TAC and HF, but were only attenuated by D6D ntt effect e inhibition in TAC. This model-specific effect of argues against ann independent of PUFA ocarrdi dial a aapoptotic al popt po ptot pt o signaling in metabolism or phospholipid (i.e., cardiolipin) remodeling on myocardial he ppattern he atternn of m yoca yo card ca rdia rd iall NFƸ ia NF FƸB activation actiiva ac vati tionn seen ti see een en inn these the hesee animals. ani nima ma This is vivo, but parallels the myocardial NFƸB ence linking en lin nki k ng NFƸB NFƸB ac cti t vi vity ty aand nd aapoptotic popt po ptot pt oticc ssignaling ot ig gnnaali ling ng iin n th he ppr re consistent with evidence activity the pressure eart ea rt43. Ho Howe However, weve we ver, ve r, tthe he eextent xten xt entt to w en which hich hi ch ccaspase aspa as p se aactivities pa ctiv ct ivit iv itie it iess re ie refl reflect flee cumulative fl overloaded failing heart apoptotic myocyte loss that contributed to the observed changes in cardiac structure and function is unclear. Nevertheless, the absence of changes in caspase activities in HF despite marked improvements in cardiac structure and function with D6D inhibition suggests that mechanisms other than apoptotic signaling mediate the pathogenic effects of phospholipid remodeling in this model. Membrane PUFAs are a primary target of ROS, which react with hydrogens in methylene groups adjacent to their double bonds, triggering an autocatalytic series of oxidation events leading to chain breaks and reactive aldehyde formation. Serum levels of lipid peroxidation products such as MDA are positively associated with NYHA clinical class in HF patients25, suggesting that this process may be of prognostic importance. The susceptibility of PUFAs to 17 peroxidation increases exponentially with double bond content 26, therefore modification of membrane PUFA composition could influence the extent of aldehyde formation in states of oxidative stress. Consistent with this hypothesis, D6D inhibition significantly attenuated increases in myocardial MDA- and HNE-protein adducts in TAC and HF, which correlated closely with changes in phospholipid DHA and LA levels, respectively. Interestingly, while D6D inhibition completely abolished increases in myocardial MDA in both models, it led to significant, but less robust reductions in HNE. MDA and HNE are typically used Downloaded from http://circheartfailure.ahajournals.org/ by guest on November 17, 2016 interchangeably as markers of oxidative stress in tissues, however they differ with regard to their e origin and cellular toxicities. MDA is formed primarily from the autocatalytic pperoxidation of marilly by fforming ormi or ming mi n mutagenic DHA and during TXA2 synthesis, and is thought to be toxic primarily DNA-adducts 44. HNE N is de NE derived eri rive vedd fr ve from om tthe he pperoxidation errox o id dattio on of nn6 6 PU PUFA PUFAs, As, s pprimarily riima mari riily AA, and exerts rily c s bby cts y cr cros osss--liink nkin ng pr rotei tei eins ns aand nd ppromoting romo ro motiing iinflammatory mo nnfflaamm mmat attorry aan n fibrogenic its pathological effects cross-linking proteins and signaling 45. Relatively vel elyy minor mino mi norr changes no chan ch ange an gess in phospholipid ge pho hosp spho sp holi ho lipi li p d AA pi AA and/or and/ an d/or d/ or the the large lar argge increases incr in cree cr in LA might explain the less pronounced decreases in HNE with D6D inhibition, whereas dramatic changes in DHA and TXA2 parallel similar changes in MDA. Therefore, modulation of membrane PUFA content and composition appears to strongly influence the extent and pattern of lipid aldehyde species that accumulate in the heart during states of oxidative stress. In summary, our studies demonstrate a central role of essential fatty acid metabolism through D6D in generating the signature pattern of PUFA redistribution in myocardial phospholipids widely reported in cardiac pathologies, and suggests important pathophysiological consequences of this phenomenon in heart failure. While precisely defining how cardiac and hepatic lipid metabolism interact to influence myocardial membrane composition and disease progression in hypertensive heart disease will require further investigation, a primary pathogenic 18 effect of this process may be an increase in myocardial free AA, favoring production of multiple eicosanoid species implicated in hypertrophic and fibrotic remodeling. An exchange of membrane LA for highly unsaturated AA and DHA may also promote lipid peroxidation and alter critical membrane-dependent processes such as the efficiency of oxidative phosphorylation and perhaps others not evaluated herein. The observed model-specific effects of D6D inhibition on mitochondrial respiration, NF-țB and apoptotic signaling, despite eliciting consistent benefits on cardiac structure and function, argue against primary roles of these systems in mediating the Downloaded from http://circheartfailure.ahajournals.org/ by guest on November 17, 2016 pathogenic effects of phospholipid remodeling in heart failure. Similar patterns of PUFA pot po redistribution observed in myocardial and serum phospholipids highlight the potential ypert rtten ensi s on aand si nd ccardiovascular prognostic value of serum D6D activity ratios associated with hypertension emiologiica em call literature liite tera ratu ra ture tu re14, 16. In In co conclusion, oncclu lusi sion si on, ta on targeting arg rgetin ingg the in the D6D D6D pathway may morality in the epidemiological tive vee new new w approach app ppro ro oac a h to the the study stu tudy dy and dy and treatment tre reat atme at ment me nt of of he hear heart art fa ar fail failure i ur uree and perhaps represent an integrative other pathologies associated s ci soci so ciat ated at ed with wit ithh th this is ssignature ig gna natu ture tu re ppattern atte at tern te rn ooff pphospholipid hosp ho sppho holi lipi li p d PU pi PUFA FA rremodeling. e Acknowledgements The authors thank Allen Medway and Dr. Brian Stauffer for assistance with obtaining human heart samples and patient information at the University of Colorado Denver, and Juliano Silveria for assistance with the qRT-PCR. Sources of Funding Funding for this project was provided by a Scientist Development Grant from the American Heart Association (0835545N) and NIH grant HL094890-01A1 to AJC. 19 Disclosures None. References 1. 2. 3. Downloaded from http://circheartfailure.ahajournals.org/ by guest on November 17, 2016 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. Levy D, Larson MG, Vasan RS, Kannel WB, Ho KK. The progression from hypertension to congestive heart failure. JAMA : the journal of the American Medical Association. 1996;275:1557-1562. Yndestad A, Damas JK, Oie E, Ueland T, Gullestad L, Aukrust P. Role of inflammation in the progression of heart failure. Curr Cardiol Rep. 2007;9:236-241. Dhalla AK, Hill MF, Singal PK. Role of oxidative stress in transition of hypertrophy to heart failure. J Am Coll Cardiol. 1996;28:506-514. Neubauer S. The failing heart--an engine out of fuel. The New England journal of medicine. 2007;356:1140-1151. Kang PM, Izumo S. Apoptosis and heart failure: A critical review of the literature. Circulation research. 2000;86:1107-1113. lanc la nckk TJ nc TJ.. Di Dis s Heerdt PM, Schlame M, Jehle R, Barbone A, Burkhoff D,, B Blanck Disease-specific remodeling of cardiac mitochondria after a left ventricular ar assist asssisst de devi device. vice vi ce.. A ce Ann Thorac Surg. 2002;73:1216-1221. 73:1216-1221. 73:12 1216 12 16-1 16 - 22 -1 221. Sparagna GC, Chicco AJ, Murphy RC,, Br Bristow ML, Maxey ML, C C C, hicco oA J,, M uurrph phyy RC R B issto ow MR MR,, Jo JJohnson hnsonn CA hn CA,, Re Rees es M es McCune SA,, Moore Moore RL. L Loss Loss of of cardiac carrdi d acc tetralinoleoyl tettralin inol in oleeoyyl cardiolipin ol car ardi d olip di pin n inn human huum and experimentall heart hea eart r failure. rt fai a lu ure r . Journal Jourrna Jo nall off llipid ipid ip id rresearch. esea es earc ea rchh. 22007;48:1559-1570. rc 007; 00 7;48 7; 48:1 48 :155 :1 55955 9--15 1 70 70. Reibel DK, O'Rourke B, Foster O Fostter KA, KA, Hutchinson Hutc Hu t hi h nsson H, H, Uboh Uboh CE, Kent RL. Altered A phospholipidd metabolism hearts. met etab abol ab olis ol ism is m in pressure-overload pre ress ssur ss ureur e-ov eover ov erlo er loaad hypertrophied lo hyype p rt rtro roph ro p ie ph iedd he hear arts ar ts. Th ts Thee American journal of physiology. 1986;250:H1-6. hysiology hysi hy siol si olog ol ogyy 11986;250:H1-6 986; 98 6 25 6; 250: 0:H1 0: H1-6 H1 -6 6 Sparagna GC, Johnson CA, McCune SA, Moore RL, Murphy RC. Quantitation of cardiolipin molecular species in spontaneously hypertensive heart failure rats using electrospray ionization mass spectrometry. Journal of lipid research. 2005;46:1196-1204. Nasa Y, Sakamoto Y, Sanbe A, Sasaki H, Yamaguchi F, Takeo S. Changes in fatty acid compositions of myocardial lipids in rats with heart failure following myocardial infarction. Mol Cell Biochem. 1997;176:179-189. Han X, Yang J, Yang K, Zhao Z, Abendschein DR, Gross RW. Alterations in myocardial cardiolipin content and composition occur at the very earliest stages of diabetes: A shotgun lipidomics study. Biochemistry. 2007;46:6417-6428. Lee HJ, Mayette J, Rapoport SI, Bazinet RP. Selective remodeling of cardiolipin fatty acids in the aged rat heart. Lipids in health and disease. 2006;5:2. Nakamura MT, Nara TY. Structure, function, and dietary regulation of delta6, delta5, and delta9 desaturases. Annual review of nutrition. 2004;24:345-376. Russo C, Olivieri O, Girelli D, Guarini P, Pasqualini R, Azzini M, Corrocher R. Increased membrane ratios of metabolite to precursor fatty acid in essential hypertension. Hypertension. 1997;29:1058-1063. Zheng ZJ, Folsom AR, Ma J, Arnett DK, McGovern PG, Eckfeldt JH. Plasma fatty acid composition and 6-year incidence of hypertension in middle-aged adults: The atherosclerosis risk in communities (aric) study. Am J Epidemiol. 1999;150:492-500. 20 16. 17. 18. 19. Downloaded from http://circheartfailure.ahajournals.org/ by guest on November 17, 2016 20. 21. 22. 23. 24. 25. 26. 27. 28. 29. Warensjo E, Sundstrom J, Vessby B, Cederholm T, Riserus U. Markers of dietary fat quality and fatty acid desaturation as predictors of total and cardiovascular mortality: A population-based prospective study. The American journal of clinical nutrition. 2008;88:203-209. Heyen JR, Blasi ER, Nikula K, Rocha R, Daust HA, Frierdich G, Van Vleet JF, De Ciechi P, McMahon EG, Rudolph AE. Structural, functional, and molecular characterization of the shhf model of heart failure. American journal of physiology. Heart and circulatory physiology. 2002;283:H1775-1784. Obukowicz MG, Welsch DJ, Salsgiver WJ, Martin-Berger CL, Chinn KS, Duffin KL, Raz A, Needleman P. Novel, selective delta6 or delta5 fatty acid desaturase inhibitors as antiinflammatory agents in mice. The Journal of pharmacology and experimental therapeutics. 1998;287:157-166. Mulligan CM, Sparagna GC, Le CH, De Mooy AB, Routh MA, Holmes MG, HicksonBick DL, Zarini S, Murphy RC, Xu FY, Hatch GM, McCune SA, Moore RL, Chicco AJ. Dietary linoleate preserves cardiolipin and attenuates mitochondrial dysfunction in the failing rat heart. Cardiovascular research. 2012;94:460-468. io Zarini S, Gijon MA, Ransome AE, Murphy RC, Sala A. Transcellular bbiosynthesis of flam amma mati ma tion ti on.. Pr on Pro o Natl Acad Sci cysteinyl leukotrienes in vivo during mouse peritoneal inflammation. Proc U S A. 2009;106:8296-8301. Switzer BR, Summer Suumm mmer er GK. GK. K Improved method metho od for hydroxyp hydroxyproline yproline analysis in tissue yp hydrolyzates. Anal Biochem. 1971;39:487-491. s An s. A al B ioc oche oc heem. m. 197 971; 97 1;39 1; 3 :4 39 487 8 -4 491 91. Chicco AJ, Sparagna Spa Spa paragna GC. GC. Role GC R lee of cardiolipin Ro caard dio olipiin alterations alte al tera te r tiions inn mitochondrial ra mitoccho h ndri riia dysfunction and disease. American Ame meri riica cann journal jo our urna n l off physiology. na phy hysi siol si olog ol ogy. og y Cell Cel elll physiology. phys ph ysio ys io olo logy gy. 2007;292:C33-44. gy 2007 20 07;2 07 ;292 ;2 92:: 92 Leslie CC. Regulation arachidonic production. R of arach ch hid idon onic on ic aacid cid i aavailability vaail ilab abil ilitty fo forr eicosanoid pro Biochemistryy and and cell cel elll biology biol bi olog ol ogyy = Biochimie og Bioc Bi ochi oc himi hi miee et biologie mi bio iolo logi lo g e cellulaire. gi cell ce llul ll ulaair ul iree. 22004;82:1-17. 004; 00 4;82 4; 822 Jenkins CM, Cedars Ceda Ce dars da rs A, A Gross G os Gr osss RW. RW W Eicosanoid E co Ei cosa sano noid id signalling sig i na nall lllin llin i g pathways path pa th hwa ways ys iinn th thee heart. Cardiovasc Res. 2009;82:240-249. Keith M, Geranmayegan A, Sole MJ, Kurian R, Robinson A, Omran AS, Jeejeebhoy KN. Increased oxidative stress in patients with congestive heart failure. Journal of the American College of Cardiology. 1998;31:1352-1356. Pamplona R, Portero-Otin M, Ruiz C, Gredilla R, Herrero A, Barja G. Double bond content of phospholipids and lipid peroxidation negatively correlate with maximum longevity in the heart of mammals. Mechanisms of ageing and development. 2000;112:169-183. Martinelli N, Girelli D, Malerba G, Guarini P, Illig T, Trabetti E, Sandri M, Friso S, Pizzolo F, Schaeffer L, Heinrich J, Pignatti PF, Corrocher R, Olivieri O. Fads genotypes and desaturase activity estimated by the ratio of arachidonic acid to linoleic acid are associated with inflammation and coronary artery disease. The American journal of clinical nutrition. 2008;88:941-949. Shindou H, Shimizu T. Acyl-coa:Lysophospholipid acyltransferases. The Journal of biological chemistry. 2009;284:1-5. McHowat J, Tappia PS, Liu S, McCrory R, Panagia V. Redistribution and abnormal activity of phospholipase a(2) isoenzymes in postinfarct congestive heart failure. Am J Physiol Cell Physiol. 2001;280:C573-580. 21 30. 31. 32. 33. 34. Downloaded from http://circheartfailure.ahajournals.org/ by guest on November 17, 2016 35. 36. 37. 38. 39. 40. 41. 42. 43. 44. Zhang Z, Vezza R, Plappert T, McNamara P, Lawson JA, Austin S, Pratico D, Sutton MS, FitzGerald GA. Cox-2-dependent cardiac failure in gh/ttg transgenic mice. Circulation research. 2003;92:1153-1161. Kayama Y, Minamino T, Toko H, Sakamoto M, Shimizu I, Takahashi H, Okada S, Tateno K, Moriya J, Yokoyama M, Nojima A, Yoshimura M, Egashira K, Aburatani H, Komuro I. Cardiac 12/15 lipoxygenase-induced inflammation is involved in heart failure. The Journal of experimental medicine. 2009;206:1565-1574. Wen Y, Gu J, Peng X, Zhang G, Nadler J. Overexpression of 12-lipoxygenase and cardiac fibroblast hypertrophy. Trends in cardiovascular medicine. 2003;13:129-136. Graham DA, Rush JW. Cyclooxygenase and thromboxane/prostaglandin receptor contribute to aortic endothelium-dependent dysfunction in aging female spontaneously hypertensive rats. Journal of applied physiology. 2009;107:1059-1067. Kunapuli P, Lawson JA, Rokach JA, Meinkoth JL, FitzGerald GA. Prostaglandin f2alpha (pgf2alpha) and the isoprostane, 8, 12-iso-isoprostane f2alpha-iii, induce cardiomyocyte hypertrophy. Differential activation of downstream signaling pathways. The Journal of biological chemistry. 1998;273:22442-22452. nscription factor faccto in chronic Barnes PJ, Karin M. Nuclear factor-kappab: A pivotal transcription 71. 1 inflammatory diseases. N Engl J Med. 1997;336:1066-1071. nff-ka k pp ka ppab ab in in the heart: To be Gordon JW, Shaw JA, Kirshenbaum LA. Multiple facets of nf-kappab or not to nf-kappab. kappab. kap ppa pab. b. C b. Circ ircc Res.108:1122-113 ir Res.108:1122-1132. 32. 2 Wong SC, Fukuchi and u uchi M, uku uk M, Melnyk Meln Me lnyk ln yk P, P, Rodger Rodg Ro dg ger e I,, Giaid Giiai aidd A. A. Induction Indduc u tiion of of cyclooxygenase-2 cycl cy cloo cl oo activation off nuclear nu factor-kappab faactorr-kap ap ppa p b in nm myocardium y ca yo card diu ium m off pati patients tien nt s w with itth ccongestive ong ngge heart failure. Circulation. u ati ula tion on 19 on on. 11998;98:100-103. 98;9 98 ;9 98: 8:10000 10 1 3. 3 Vanderheyden Voss Knuefermann Sivasubramanian e M, Paulus WJ, en J, V osss M, os M K nu uefe ferm rman rm ann P, S an ivasubramanian n N, Mann D, Baumgarten G. G. Myocardial Myoc My ocar oc ardi ar dial di al cytokine cyt y ok okin inee gene in gene expression exppre ress ssio ss ionn is hhigher io ig ghe herr in aaortic orti or ticc sstenosis than in ti idiopathic dilated cardiomyopathy. Heart. 2005;91:926-931. llated ated at ed ccardiomyopathy ardi ar diom di omyo yopa path thyy H th Heart eart ea rtt 20 2005 2005;91:926 0 ;9 05 91: 1 92 9 66 93 931 31 Claypool SM, Koehler CM. The complexity of cardiolipin in health and disease. Trends in biochemical sciences. 2012;37:32-41. Malhotra A, Xu Y, Ren M, Schlame M. Formation of molecular species of mitochondrial cardiolipin. 1. A novel transacylation mechanism to shuttle fatty acids between sn-1 and sn-2 positions of multiple phospholipid species. Biochimica et biophysica acta. 2009;1791:314-320. Saini-Chohan HK, Holmes MG, Chicco AJ, Taylor WA, Moore RL, McCune SA, Hickson-Bick DL, Hatch GM, Sparagna GC. Cardiolipin biosynthesis and remodeling enzymes are altered during development of heart failure. J Lipid Res. 2009;50:16001608. Murray AJ, Cole MA, Lygate CA, Carr CA, Stuckey DJ, Little SE, Neubauer S, Clarke K. Increased mitochondrial uncoupling proteins, respiratory uncoupling and decreased efficiency in the chronically infarcted rat heart. J Mol Cell Cardiol. 2008;44:694-700. Hamid T, Guo SZ, Kingery JR, Xiang X, Dawn B, Prabhu SD. Cardiomyocyte nf-kappab p65 promotes adverse remodelling, apoptosis, and endoplasmic reticulum stress in heart failure. Cardiovasc Res.89:129-138. Esterbauer H, Schaur RJ, Zollner H. Chemistry and biochemistry of 4-hydroxynonenal, malonaldehyde and related aldehydes. Free Radic Biol Med. 1991;11:81-128. 22 45. Poli G, Schaur RJ. 4-hydroxynonenal in the pathomechanisms of oxidative stress. IUBMB Life. 2000;50:315-321. Downloaded from http://circheartfailure.ahajournals.org/ by guest on November 17, 2016 23 Table. Animal Characteristics and Serum Analyses Sham Sham+SC TAC TAC+SC HF HF+SC Body Weight, g 285 ± 8 289 ± 10 260 ± 8 259 ± 10 394 ± 10 381 ± 11 Systolic BP, mmHg 151 ± 10 153 ± 11 ND ND 175 ± 15 188 ± 11 Glucose, mM 6.2 ± 0.9 6.1 ± 0.3 6.6 ± 0.5 6.8 ± 1.1 6.8 ± 0.5 5.5 ± 3 FFA, ȝM 314 ± 15 306 ± 20 308 ± 28 287 ± 25 283 ± 13 296 ± 25 IFNg, pg/mL 28 ± 18 ND 89 ± 9* 51 ± 15† 135 ± 12* 87 ± 19*† IL-1ȕ, pg/mL 107 ± 50 ND 161 ± 15* 163 63 ± 47 152 152 ± 50 92 ± 21 IL-10, pg/mL 549 549 ± 289 289 9 ND ND 241 ± 41* 41 337 3337 ± 41 309 309 09 ± 45 430 ± 49 MCP-1, pg/mL 1143 114 143 3 ± 645 645 ND 2267 226 267 7 ± 28 285* 5* 1573 1573 73 ± 261† 261 61† † 2175 217 75 ± 151* 1674 ± 241† TIMP-1, pg/mL 4405 4405 ± 1745 174 745 5 ND 4436 443 436 6 ± 43 437 7 Serum Analyses Downloaded from http://circheartfailure.ahajournals.org/ by guest on November 17, 2016 5086 508 508 086 6 ± 473 473 4773 477 477 773 3 ± 418 5122 ± 680 Data are means ± SEM. Abbreviations: BP, blood pressure; FFA, free fatty acids; IFNg, interferon gamma. IL, interleukin; MCP-1, macrophage chemotactic protein-1 TIMP-1, TIMP metallopeptidase. *P < 0.05 vs. Sham; †P < 0.05 vs. untreated. 24 Figure Legends Figure 1. Central role of D6D in PUFA metabolism. A) Delta-6 desaturase (D6D) catalyzes rate limiting steps in the production of long chain PUFAs from linoleic (18:2n6, LA) and linolenic (18:3n3) acids obtained in the diet. Fatty acid nomenclature: C:XnY where C = number of carbons, X = number of double bonds, and Y = location of first double bond from the omega carbon. Double arrows indicate additional reactions catalyzed by elongase enzymes (E), delta-5 Downloaded from http://circheartfailure.ahajournals.org/ by guest on November 17, 2016 desaturase (D5D) and peroxisomal fatty acid E-oxidation (EOx). LA, AA and DHA (shaded) are otal ot a fatty acids in the only PUFAs that readily accumulate in cardiac phospholipidss to >2% off tot total ubstrrat ates es routinely rou outi tine ti n used to humans and rats. Underscored fatty acids are D6D products or substrates zym zym yme activity acti tivi ti vity vi ty in in tissues. tiss ti ssue ss ues. ue s. AA A serves serv rvess as as the th he substrate suubs b trrat atee for f r multiple fo mult mu l i lipoxygenase estimate chronic enzyme g as genas asee (COX) (COX (C OX)) enzymes, OX en nzyme mes, or me or may may be b nnon-enzymatically on-eenz nzym ym mat a ic ical ally al l oxidized ly oxi x di d ze by reactive (LO) and cyclooxygenase S), generating S) gene ge neera rati ting ti ng g an an array arra ar rayy of bioactive ra bio ioac acti ac tive ti ve eicosanoid eic icos osan os anoi an oidd species oi sppec ecie iess (s ie (see ee ttext for oxygen species (ROS), abbreviations). Figure 2. Phospholipid PUFA desaturation in human heart failure. Gas chromatographic analysis of total phospholipid fatty acids extracted from human left ventricular tissue revealed a loss of phospholipid LA paralleled by elevations in AA, DHA and PUFA product/precursor ratios in hearts explanted from patients with dilated cardiomyopathy (DCM; n = 8) compared to non-failing donor hearts (NF; n = 8), which was partially reversed in patients implanted with a left ventricular assist device for 4-10 months (LVAD; n = 4). * P < 0.05 vs. NF. † P < 0.05 vs. DCM. 25 Figure 3. Myocardial phospholipid composition and eicosanoids. Treatment of TAC and HF animals with the selective D6D inhibitor SC-26196 for 4 weeks (black bars) normalized relative proportions of LA, AA and DHA (A), and reversed D6D product/precursor indices (B) in the global myocardial phospholipid pool (n= 8-10/group). C) Mass spectrometry of cardiolipin molecular species revealed a restoration of L4CL and CL species containing highly unsaturated fatty acids (HUFAs) to control levels in cardiac mitochondria with D6D inhibition (n = 46/group). D) SC-26196 treatment significantly attenuated elevations in myocardial unesterifed Downloaded from http://circheartfailure.ahajournals.org/ by guest on November 17, 2016 (“free”) AA and several of its pathogenic eicosanoid derivatives (n = 4-6/group). Significant ts leading to si ig group X SC interaction effects were seen for TAC and HF cohorts significant effects GE2 iinn (D), (D), ) therefore th only of SC treatment on all outcomes except 16:0 and 18:0 in (A, and PG PGE significant group differences fferrencess vs ff vs. Sh Sham am ccontrol ontr on trol tr o aatt P < 00.05 .055 (* .0 (*) *) ar are re indi indicated dica di cate ca t d fo te forr cl clarity. l See text for abbreviations. Figure 4. D6D inhibition attenuates contractile dysfunction and pathologic hypertrophy in TAC and HF. Serial echocardiography revealed marked left ventricular dilatation (LV internal diameter in diastole, LVIDd), systolic dysfunction (decreased fractional shortening) and diastolic dysfunction (decreased E/A ratio) in TAC animals (n=8), which was significantly attenuated by D6D inhibition (SC; n=8) beginning 2 weeks following surgery (Tx) (A). LV dilatation and systolic dysfunction in aged SHHF rats (n = 12) during the 4 week experimental period was attenuated or reversed by D6D inhibition (n = 10) (B). SC treatment resulted in significantly lower heart weights in TAC and HF animals, and decreased pulmonary congestion in HF rats (C). * P < 0.05 vs. baseline (A), Pre-Tx (B) or Sham (C). † P < 0.05 vs. untreated cohort. 26 Figure 5. Myocardial fibrosis, hypertrophic and inflammatory signaling Masson’s trichrome staining of LV tissue from TAC and HF animals revealed interstitial and perivascular fibrosis that was markedly reduced with D6D inhibition (A), which paralleled a significant attenuation of elevated myocardial hydroxyproline (collagen) content in TAC and HF animals (n = 6/group) (B). SC treatment prevented significant elevations in ANP expression (C) and ERK phosphorylation (D) in TAC and HF, and attenuated loss of the endogenous NFțB inhibitor IțBĮ (E) in TAC (n = 4-6/group). * P < 0.05 vs. Sham. † P < 0.05 vs. untreated cohort. Downloaded from http://circheartfailure.ahajournals.org/ by guest on November 17, 2016 (phosp sph sp Figure 6. Mitochondrial respiration and caspase activities. A)) State 3 (phosphorylating) and tate3 e3 3/4 4) an andd ph pho State 4 (uncoupled) respiration, respiratory control ratio (RCR, state3/4) phosphorylation osphoryllatted os e pper er O2 consumed, con onsu s me su m d, A ADP/O) DP/O DP /O)) in /O in ccardiac a diiac m ar mitochondria ittoc ocho honn ho isolated efficiency (ADP phosphorylated p rim per imen en enta nta tall groups grou gr oups ou p (n (n =4-8/group). =4-8 =4 -8/g -8 /gro /g roup ro up)). B) Protein up Pro ote tein in n expression exp xpre resssio re i n of ssubunits from from each of the experimental each of the five respiratory p ra pira pi rato tory to ry complexes com ompl p ex pl exees (CI-V) ( I(C I-V) V) obtained obt btai aine ai nedd byy iimmunoblotting ne mmun mm unob un oblo ob lott lo ttin tt ingg 10 uug in g of mitochondrial protein (n = 4/group). C) Caspase activities in myocardial homogenates assayed by luminescence assay (n = 4-6/group). * P < 0.05 vs. Sham. † P < 0.05 vs. untreated. Figure 7. Myocardial lipoxidative stress. A) Membrane peroxidizability index of total myocardial phospholipids calculated from fatty acid analyses in Figure S1 as: (%monoenoic X 0.025)+ (%dienoic X 1)+(%trienoic X 2)+(%tetraenoic X 4)+(%pentaenoic X 6)+(%hexaenoic X 8). B) Relative contents of malondialdehyde (MDA) and 4-hydroxynonenal (4-HNE) protein adducts in myocardial homogenates (n = 4-6/group). C) Scatterplots of data from tissue for which both total phospholipid fatty acid profiles and lipid aldehyde-adduct data reveal significant correlations between MDA and membrane DHA, and between 4-HNE and LA. D) Myocardial 27 contents of Mn and Cu/Zn superoxide dismutase (SOD) isozymes and glutathione peroxidase (GSHPx) (n = 4-6/group). A significant main effect of D6D inhibition was seen in all three enzymes by ANOVA (P < 0.05).* P < 0.05 vs. Sham. † P < 0.05 vs. untreated. Downloaded from http://circheartfailure.ahajournals.org/ by guest on November 17, 2016 28 Downloaded from http://circheartfailure.ahajournals.org/ by guest on November 17, 2016 Downloaded from http://circheartfailure.ahajournals.org/ by guest on November 17, 2016 Downloaded from http://circheartfailure.ahajournals.org/ by guest on November 17, 2016 Downloaded from http://circheartfailure.ahajournals.org/ by guest on November 17, 2016 Downloaded from http://circheartfailure.ahajournals.org/ by guest on November 17, 2016 Downloaded from http://circheartfailure.ahajournals.org/ by guest on November 17, 2016 Downloaded from http://circheartfailure.ahajournals.org/ by guest on November 17, 2016 Downloaded from http://circheartfailure.ahajournals.org/ by guest on November 17, 2016 Delta-6-desaturase Links PUFA Metabolism with Phospholipid Remodeling and Disease Progression in Heart Failure Catherine H. Le, Christopher M. Mulligan, Melissa A. Routh, Gerrit J. Bouma, Melinda A. Frye, Kimberly M. Jeckel, Genevieve C. Sparagna, Joshua M. Lynch, Russell L. Moore, Sylvia A. McCune, Michael Bristow, Simona Zarini, Robert C. Murphy and Adam J. Chicco Circ Heart Fail. published online November 27, 2013; Circulation: Heart Failure is published by the American Heart Association, 7272 Greenville Avenue, Dallas, TX 75231 Copyright © 2013 American Heart Association, Inc. All rights reserved. Print ISSN: 1941-3289. Online ISSN: 1941-3297 The online version of this article, along with updated information and services, is located on the World Wide Web at: http://circheartfailure.ahajournals.org/content/early/2013/11/27/CIRCHEARTFAILURE.113.000744 Data Supplement (unedited) at: http://circheartfailure.ahajournals.org/content/suppl/2013/11/27/CIRCHEARTFAILURE.113.000744.DC1.html Permissions: Requests for permissions to reproduce figures, tables, or portions of articles originally published in Circulation: Heart Failure can be obtained via RightsLink, a service of the Copyright Clearance Center, not the Editorial Office. Once the online version of the published article for which permission is being requested is located, click Request Permissions in the middle column of the Web page under Services. Further information about this process is available in the Permissions and Rights Question and Answer document. Reprints: Information about reprints can be found online at: http://www.lww.com/reprints Subscriptions: Information about subscribing to Circulation: Heart Failure is online at: http://circheartfailure.ahajournals.org//subscriptions/ CIRCHF/2013/000744/R1 Supplemental Material for Delta-6-desaturase links PUFA metabolism with phospholipid remodeling and disease progression in heart failure Catherine H. Le, BS1,2*, Christopher M. Mulligan, MS1,3*, Melissa A. Routh, MS1,2, Gerrit J. Bouma, PhD4, Melinda A. Frye, PhD4, Kimberly M. Jeckel, PhD4, Genevieve C. Sparagna, PhD6, Joshua M. Lynch, MS6, Russell L. Moore, PhD5, Sylvia A. McCune, PhD5, Michael Bristow, MD, PhD7, Simona Zarini, PhD8, Robert C. Murphy, PhD8, Adam J. Chicco, PhD1-5† Supplemental Methods Human Heart Tissue Left ventricular tissue from previously frozen human hearts was obtained by an Institutional Review Board-approved protocol maintained by the University of Colorado Denver Cardiac Tissue Bank. Hearts donated for research purposes were obtained under written consent from family members of organ donors or by direct written consent from end-stage DCM patients undergoing cardiac transplantation. Patient characteristics are presented in Table S1. Animal Models Lean male spontaneously hypertensive heart failure (Mccfacp-/-; SHHF) rats were obtained from a colony maintained at the University of Colorado by Dr. Sylvia McCune. SHHF rats were selected for these studies based on their well-characterized development of progressive hypertensive heart disease leading to pathologic hypertrophy and terminal heart failure by 22-24 months of age, sharing many of the hallmark biochemical and pathophysiological features of DCM in humans 1, including phospholipid remodeling 2. Two cohorts of animals were studied: 1) at 21-22 months of age when animals exhibit early signs of dilated heart failure (HF), and 2) following rapid induction of pathologic left ventricular hypertrophy by thoracic aortic banding at 3 months of age (TAC; see Supplemental Methods). HF rats were matched on echocardiographic parameters at 21 months of age prior to being semi-randomly assigned to treatment or control groups for the 4 week treatment period. TAC surgery was performed as previously described 2 in 3 month old rats. Two weeks following confirmation of successful TAC (see Figure S3), two cohorts of animals were matched on aortic Doppler and M-mode echocardiography parameters to ensure uniform responses and baseline pathology before being randomly assigned to receive the D6D inhibitor or no drug for 4 weeks. The effect of the D6D inhibition was also examined in 3 month old SHHF rats exposed to a sham TAC surgery (Sham) that were followed along with TAC groups for 4 weeks as an experimental control. All animals were provided Purina 5001 chow and water ad libitum for the duration of the study. At the conclusion of the study, animals were sacrificed with a lethal dose of sodium pentobarbital (150 mg/kg i.p.) followed by midline thoracotomy and removal of the heart. All procedures were approved by the Animal Care and Use Committee at Colorado State University and/or University of Colorado Boulder in strict compliance with the Guide for the Care and Use of Laboratory Animals published by the US National Institutes of Health (NIH Publication No. 85-23, revised 1996). Inhibition of D6D in vivo Rats were administered the potent, orally active D6D inhibitor SC-26196 (2,2-diphenyl-5-(4-[[(1 E)pyridin-3-yl-methylidene]amino]piperazin-1-yl)pentanenitrile a generous gift from Dr. Mark Obukowicz, Pfizer Corporation; at 100 mg/kg/d mixed in chow based on daily food consumption records taken over 1 CIRCHF/2013/000744/R1 3-4 weeks, A detailed description of the pharmacokinetics and selectivity of this compound for D6D over the other desaturase enzymes (D5D and stearoyl-CoA desaturase, D9D) has been reported elsewhere 3. .The 100 mpk dose for 4 weeks was selected based on previous studies demonstrating full inhibition of D6D (LA to AA conversion) and expected changes in tissue PUFA levels in rodent models 3-5 and pilot studies in our lab demonstrating less inhibition with 50 mpk and similar effects of 200 mpk in aged SHHF rats (data not shown). Echocardiography and Blood Pressure Transthoracic echocardiography was performed in isoflurane anesthetized rats prior to and following the 4 week experimental period using a 12 MHz pediatric transducer connected to a Hewlett Packard Sonos 5500 Ultrasound as previously described 6. Tail cuff blood pressure measurements were obtained in the Sham and HF groups using the Kent Coda 6 system (Kent Scientific, Torrinton, CT) in lightly isofluraneanesthetized rats. Lipid analyses To determine the global fatty acid profile of tissue phospholipids, lipids were extracted from ~40 mg of tissue or 100 μL serum using 4 ml of 2:1 Chloroform:Methanol and 1ml of water. The aqueous layer was removed and the lipid containing fraction was dried down using nitrogen and re-suspended in 0.5ml hexane. Thin layer chromatography was then used to separate out the phospholipid fraction using a 20cm x 20cm silica gel TLC plate in a 70:30:1 hexane:ethyl ether:acetic acid solution. The band associated with the phospholipid fraction was scraped and dissolved in 0.5ml hexane and 0.5ml 0.5N KOH. 2ml of 14% BF3-methanol was then added and samples were heated at 100 °C for 30 minutes to obtain methyl esters for subsequent determination of fatty acid composition by gas chromatography (GC). Separation of individual phospholipid classes was performed by normal phase liquid chromatography (Agilent Zorbax Rx-Sil column, 4.6 X 250mm, 5-micron) using a Hexane:Isopropanol:Potassium Acetate mobile phase gradient optimized for separation of PE, PC and CL by UV detection (206 nm). Fractions were collected based on elution time of known standards, evaporated under a nitrogen stream, and resuspended in hexane for GC analysis as described above. GC analysis was performed using an Agilent Technologies DB-225 30m x 0.250mm x 0.25µm column (model 122-2232, J&W Scientific) on an Agilent 6890 Series Gas Chromatographer. The initial temperature of the oven was 120 °C with an initial ramp temperature of 10°C/min for 8 minutes, then 2.5°C/min for 4 minutes and held at 210°C for the remaining 6 minutes for a total run time of 20 min. The inlet split ratio was 15:1 with the column at constant flow and an initial flow, pressure, and velocity at 1.8ml/min, 23.59 psi, and 42 cm/sec, respectively. Tissue PC and PE contents were determined by colorimetric phosphorus assay on LC fractions obtained from 20-30mg tissue as described above. Briefly, evaporated fractions were heated in perchloric acid overnight at 160˚C and cooled, followed by the sequential addition of 275 µl of H2O, 41.7 µl of 20.2 mM Ammonium molybdate, and 41.7 µl of 0.568 M Ascorbic Acid, vortexing each for 20 seconds. The assay mix was then heated for 5 minutes at 100˚C, cooled and read on a spectrophotometer at 800 nm for quantitation of total phosphorus based on a KH2PO4 standard curve. Cardiolipin molecular species were determined in lipid extracts from 0.25 mg of mitochondrial protein isolated from rat left ventricle or 40 mg of LV protein (humans) by electrospray ionization mass spectrometry previously described in detail 7. “Total” cardiolipin represents the m/z sum of the 10 most prevalent CL species detected. Myocardial contents of free AA and eicosanoid species were quantified in lipid extracts obtained from 50 mg of LV tissue by LC/MS/MS methods developed in Dr. Murphy’s laboratory using deuterated standards as previously described 8. Mitochondrial isolation and respiratory function Mitochondria were freshly isolated from ~300 mg of left ventricular (LV) tissue by differential centrifugation in the absence of proteases as described previously 6. State 3 (ADP-stimulated) and state 2 CIRCHF/2013/000744/R1 4 (ADP-limited) mitochondrial respiratory function was measured in isolated mitochondria (0.25 mg protein) using a Clark-type electrode system (Strathkelvin) at 30C with pyruvate + malate as substrates as previously described 6. Biochemical analyses Immunoblotting for D6D, (p)ERK, IκBα, MDA and HNE-adducts, and antioxidant enzymes were performed in 40-50 mg LV homogenates by standard methods using commercially available antibodies and chemiluminescent detection. Blot densities were normalized to total lane protein content (Coomassie or ponceau staining) to control for any differences in loading on each membrane, then expressed relative to at least 2 Sham samples on each gel to allow for comparisons between blotting experiments. The source, catalog number and blotting conditions used for each of the antibodies used are listed below. GSHPX1 (Abnova, #MAB0845) 1:5000 in 5%NFM O/N @4°C MnSOD (Assay Designs, #SOD-111) 1:10,000 in 5%NFM O/N @4°C CuZnSOD (Assay Designs, #SOD-101) 1:10,000 in 5%NFM O/N @4°C MDA (Anti-Malondialdehyde) (Calbiochem, #442730) 1:5000 in 5%NFM O/N @4°C HNE (Anti-HNE-Michael Adducts Reduced) (Calbiochem, # 393207) 1:5000 in 5%NFM O/N @4°C pERK (Cell Signaling, #9101S) 1:1000 in 5%BSA O/N @4°C ERK (Cell Signaling, #9102) 1:1000 in 5%BSA O/N @4°C OXPHOS (Mitosciences, #MS604) 1:2000 in 5%NFM O/N @4°C IkBalpha (Abcam, #ab32518) 1:10000 in 5%NFM O/N @4°C Serum glucose and free fatty acids were determined by colorimetric assays according to the manufacturer’s instructions (Biovision). Caspase activities were determined in 30 mg of LV homogenates by luminescence assay (Promega). Myocardial hydroxyproline was quantitated as a marker of collagen (fibrosis) in 30-40 mg of septal tissue by the colorimetric assay of Switzer and Summer 9. Serum cytokines were determined in 80 μL of sample by ELISA cytokine array (Raybiotech). qRT-PCR was performed using 2X SYBR Green qPCR Master Mix and the LightCycler480 PCR system (Roche Applied Sciences). Total RNA (10-15mg tissue) was converted into quantifiable cDNA using Trizol, followed by Qiagen RNeasy Mini kit according to the manufacturer’s instructions. RNA purity was assessed using a NanoDrop ND1000 spectrophotometer, and only samples with a 260:280 ratio 2.0 or greater were used. Gene specific primers (listed in Table S2) were designed and validated by sequencing PCR products, and dissociation curve analysis. qRT-PCR data was normalized to 18S rRNA, and analyzed according to the comparative (∆∆Ct) Ct method 10. Changes in relative transcript level was compared to sham control and expressed as fold change. Statistical analyses All data are presented as group means standard error. Human heart data were compared by one way ANOVA with Tukey tests post hoc when appropriate. Rat data were analyzed by 3(condition) X 2(drug) ANOVA to determine main and interaction effects with Tukey tests post hoc for determination of significant group differences. Within-group differences in echocardiography data from pre- to posttreatment were compared by paired t-tests. Statistical significance was established at P < 0.05 for all analyses. 3 CIRCHF/2013/000744/R1 Supplemental Tables Table S1. Patient Characteristics Lab code SEX AGE PATHOLOGY EF (%) BP (mmHg) NF1 NF2 NF3 NF4 NF5 NF6 NF7 NF8 F F M M M F M M 50 61 68 20 19 22 69 72 None None None None None None None None n/a n/a n/a n/a n/a n/a n/a n/a 106/56 115/63 110/52 90/58 100/62 n/a 115/51 n/a I1 I2 I3 I4 I5 I6 I7 F F M M M M M 46 53 65 48 57 63 39 DCM DCM DCM DCM DCM DCM DCM <20 <25 24.00 10.00 <25 <20 12.00 n/a 86/64 115/63 105/63 109/68 98/66 99/61 L1 L2 L3 L4 M M M M 47 34 52 56 LVAD 5 mo LVAD 4 mo LVAD 10 mo LVAD 9 mo <15 <25 8.45 10.00 n/a n/a 161/79 136/50 4 CIRCHF/2013/000744/R1 Table S2. Primer sequences used for qRT-PCR gene species primer sequence fads2 Rat Forward TGTCCACAAGTTTGTCATTGG fads2 Rat Reverse ACACGTGCAGGCTCTTTATG fads2 Human Forward ATCCCTTTCTACGGCATCCT fads2 Human Reverse TAGGCCTCCTGGTCAATCTC fads1 Rat Forward TGGAGAGCAACTGGTTTGTG fads1 Rat Reverse GTTGAAGGCTGACTGGTGAA fads1 Human Forward TTGGCCTGGATGATTACCTT fads1 Human Reverse CTGTGTCACCCACACAAACC Elovl5 Rat Forward TACCACCATGCCACTATGCT Elovl5 Rat Reverse GACGTGGATGAAGCTGTTGA Elovl5 Human Forward GTGCACATTCCCTCTTGGTT Elovl5 Human Reverse TGGTCCTTCAGGTGGTCTTT Elovl2 Rat Forward TTTGGCTGTCTCATCTTCCA Elovl2 Rat Reverse GGGAAACCGTTCTTCACTTC Elovl2 Human Forward CCCTTCGGTTGTCTCATCTT Elovl2 Human Reverse CAGGTGGCTCTTGCATATCTT 5 CIRCHF/2013/000744/R1 Table S3. Animal Morphology Body Weight, g Sham Sham+SC TAC TAC+SC HF HF+SC 285 ± 8 289 ± 10 260 ± 8 259 ± 10 394 ± 10* 381 ± 11* Heart, gww 1.18 ± 0.03 1.19 ± 0.06 1.44 ± 0.06* 1.25 ± 0.03† 1.77 ± 0.04* Lungs, gww 1.45 ± 0.04 1.50 ± 0.09 2.21 ± 0.25* 1.99 ± 0.21* 2.42 ± 0.10* 2.19 ± 0.07*† Brain, gww 1.76 ± 0.03 1.74 ± 0.02 1.77 ± 0.01 1.79 ± 0.02 2.11 ± 0.02* 2.10 ± 0.04* Heart/BW, g/kg 4.15 ± 0.10 4.12 ± 0.12 5.57 ± 0.25* 4.88 ± 0.20*† 4.39 ± 0.09* 4.17 ± 0.09† Heart/Brain, g/g 0.67 ± 0.02 0.68 ± 0.03 0.81 ± 0.04* 0.70 ± 0.01† 0.83 ± 0.02* 0.77 ± 0.02*† Lungs/BW, g/kg 4.75 ± 0.45 5.19 ± 0.60 8.59 ± 1.11* 7.71 ± 0.80* 6.09 ± 0.24* 5.74 ± 0.19* Lungs/Brain, g/g 0.86 ± 0.04 0.86 ± 0.04 1.25 ± 0.14* 1.11 ± 0.11* 1.16 ± 0.05* 1.05 ± 0.04* Data are means ± SEM. *P < 0.05 vs. Sham; †P < 0.05 vs. untreated. 6 1.60 ± 0.04*† CIRCHF/2013/000744/R1 Supplemental Figures Figure S1. Fatty acid composition of phospholipid extracts from human left ventricle. Data are means ± SEM of %total fatty acids from phospholipids extracted from 30-50 mg of left ventricular (LV) tissue by thin layer chromatography (total phospholipids) or HPLC (individual phospholipid classes) as described in Methods (n = 4-8/group). 7 CIRCHF/2013/000744/R1 Figure S2. Phospholipid fatty acid composition of rat heart, liver and serum Data are means ± SEM of %total fatty acids from phospholipids extracted from 30-50 mg of left ventricular (LV) or liver tissue and30 µL serum, by TLC (total phospholipids) or HPLC (individual phospholipid classes) as described in Methods (n = 4-8/group). 8 CIRCHF/2013/000744/R1 Figure S3. Aortic outflow Doppler on TAC mice. Following successful TAC surgery, aortic outflow acceleration time (AT) decreases markedly, while total ejection time (ET) increases, resulting in a dramatic elevation in ET/AT indicative of severe aortic stenosis. Thus, the ET/AT ratio served as a basis for pre-treatment matching of TAC and TAC+SC groups 2 weeks following surgery to ensure similar extents of aortic constriction prior to beginning treatment. No change in AT or ET/AT from 12-16 weeks in TAC or TAC+SC indicates a nearly identical maintenance of aortic constriction throughout the experimental period in both groups. Data are means ± SEM, n = 4-8/group. **P < 0.01 vs. Sham and Sham+SC. *P < 0.05 for TAC+SC vs. Sham. 9 CIRCHF/2013/000744/R1 Figure S4. Total CL content and representative mass spectra of CL molecular species from cardiac mitochondria. Quantitation of the 18 most abundant CL species revealed no significant change in the amount of CL present in cardiac mitochondria (above left). Representative mass spectra obtained via electrospray ionization mass spectrometry show the relative abundance of CL molecular species obtained from cardiac mitochondria isolated from TAC and HF rats with and without D6D inhibition (SC-26196). X axis unit is mass/charge ratio (m/z), which is identical molecular weight ,thus the peak at m/z 1448 is L4CL, and peaks at higher m/z values contain various combinations of AA and/or DHA (see Sparagna et al. J Lipid Res 46:1196, 2005). Y axis units are arbitrary relative peak intensities representing the relative abundance of CL species for each spectra. 10 CIRCHF/2013/000744/R1 Figure S5. D6D pathway expression (A) Relative mean (+/- SEM) data for qRT-PCR of mRNA encoding D6D (fads2), delta-5 destaurase (fads1), and elongase-5 (elovl5) in the rat and human heart.*P < 0.05 vs. NF and DCM/HF; n = 4-6/group. (B) Representative blots and mean (+/- SEM) data for D6D protein by immunoblotting in rat and human tissues (n = 6/group). 11 CIRCHF/2013/000744/R1 Figure S6. Representative blots from Figures 6B (top) and 7D (bottom). Blots are representative chemiluminescent images from several blotting experiments comparing all or some of the experimental groups. Data presented in Figures 6 and 7 were derived from several blotting experiments with various combinations of samples normalized to coomassie or ponceau staining for total protein, expressed relative to sham samples on each gel. 12 CIRCHF/2013/000744/R1 Figure S7. Semi-quantitative histological analysis of myocardial fibrosis Semi-quantitative analysis of myocardial fibrosis was performed on Masson’s trichrome stained sections (10 µm thick) derived from 20-35 mg paraffin-embedded sections of LV free wall tissue fixed in 4% paraformaldehyde in PBS. The percent of interstitial collagen deposition was determined by measuring the total stained (blue) area relative total tissue area in at least 4 separate 1 X 1.4 mm light microscopy images of sections obtained from 2-4 rats per group using ImageJ software (NIH). Data are mean values of multiple sections from 2-4 rats per group SE. * P < 0.05 vs. Sham control. † P < 0.05 vs. untreated. 13 CIRCHF/2013/000744/R1 Supplemental References 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. Heyen JR, Blasi ER, Nikula K, Rocha R, Daust HA, Frierdich G, Van Vleet JF, De Ciechi P, McMahon EG, Rudolph AE. Structural, functional, and molecular characterization of the shhf model of heart failure. Am J Physiol Heart Circ Physiol. 2002;283:H1775-1784 Sparagna GC, Chicco AJ, Murphy RC, Bristow MR, Johnson CA, Rees ML, Maxey ML, McCune SA, Moore RL. Loss of cardiac tetralinoleoyl cardiolipin in human and experimental heart failure. J Lipid Res. 2007;48:1559-1570 Obukowicz MG, Welsch DJ, Salsgiver WJ, Martin-Berger CL, Chinn KS, Duffin KL, Raz A, Needleman P. Novel, selective delta6 or delta5 fatty acid desaturase inhibitors as antiinflammatory agents in mice. The Journal of pharmacology and experimental therapeutics. 1998;287:157-166 Duffin KL, Obukowicz MG, Salsgiver WJ, Welsch DJ, Shieh C, Raz A, Needleman P. Lipid remodeling in mouse liver and plasma resulting from delta6 fatty acid desaturase inhibition. Lipids. 2001;36:1203-1208 Hansen-Petrik MB, McEntee MF, Johnson BT, Obukowicz MG, Masferrer J, Zweifel B, Chiu CH, Whelan J. Selective inhibition of delta-6 desaturase impedes intestinal tumorigenesis. Cancer letters. 2002;175:157-163 Mulligan CM, Sparagna GC, Le CH, De Mooy AB, Routh MA, Holmes MG, Hickson-Bick DL, Zarini S, Murphy RC, Xu FY, Hatch GM, McCune SA, Moore RL, Chicco AJ. Dietary linoleate preserves cardiolipin and attenuates mitochondrial dysfunction in the failing rat heart. Cardiovasc Res.94:460-468 Sparagna GC, Johnson CA, McCune SA, Moore RL, Murphy RC. Quantitation of cardiolipin molecular species in spontaneously hypertensive heart failure rats using electrospray ionization mass spectrometry. Journal of lipid research. 2005;46:1196-1204 Zarini S, Gijon MA, Ransome AE, Murphy RC, Sala A. Transcellular biosynthesis of cysteinyl leukotrienes in vivo during mouse peritoneal inflammation. Proc Natl Acad Sci U S A. 2009;106:8296-8301 Switzer BR, Summer GK. Improved method for hydroxyproline analysis in tissue hydrolyzates. Anal Biochem. 1971;39:487-491 Schmittgen TD, Livak KJ. Analyzing real-time pcr data by the comparative c(t) method. Nat Protoc. 2008;3:1101-1108 14
