Download Dietary NaCl Regulates Renal Aminopeptidase N

Dietary NaCl Regulates Renal Aminopeptidase N: Relevance
to Hypertension in the Dahl Rat
Mariam Farjah, Theressia L. Washington, Bryan P. Roxas, David L. Geenen, and Robert S. Danziger
Abstract—Aminopeptidase N (APN) is an abundant metallohydrolase in the brush border of kidney proximal tubule cells
that degrades angiotensin III (Ang III) to angiotensin IV (Ang IV) and, along with dipeptidylaminopeptidase, degrades
Ang IV. We examined the impact of a high-salt diet on renal APN activity and transcript abundance in the
Sprague-Dawley and Dahl salt-sensitive (SS/Jr) rat strains. APN transcript abundance and protein abundance were
⬇2-fold greater (P⬍0.05; n⫽6) in the kidneys of Sprague-Dawley and Lewis rats ingesting 8% versus 0.3% salt diets,
suggesting that increased aminopeptidase activity may contribute to decreased renal sodium uptake during adaptation
to a high-salt diet. In contrast, renal APN transcript abundance and activity were the same in Dahl SS/Jr rats ingesting
8.0% versus 0.3% salt diets. The APN gene was mapped, using a radiation-hybrid panel, to known quantitative loci on
chromosome 1 for blood pressure in the Dahl SS/Jr rat. The results suggest that the APN gene is a good candidate for
salt-sensitivity in the Dahl SS/Jr rat. (Hypertension. 2004;43:282-285.)
Key Words: sodium 䡲 kidney 䡲 Dahl rat 䡲 angiotensin 䡲 hypertension
A
ngiotensin II (Ang II) is metabolized to angiotensin III
(Ang III) (Arg-Val-Tyr-lle-His-Pro-Phe) by aminopeptidase A. In turn, APN metabolizes Ang III to Ang IV
(Val-Tyr-IIe-His-Pro-Phe) and, along with dipeptidylaminopeptidase, degrades Ang IV.1 Ang III shares many of the
physiological functions of Ang II in the cardiovascular and
nervous systems, including stimulation of vasopressin, aldosterone, and catecholamine secretion.1 Similar to Ang II, it
acts as a pro-inflammatory agent by stimulating MCP-1
cytokine production and activating NF-kB and AP-1. Ang III
has been postulated to contribute to the inflammatory response and cell growth with progression of renal disease.2,3
However, Ang IV is thought to have minor biological activity
because Ang II receptors AT1 and AT2 have poor affinity for
Ang IV, and Ang IV infusion does not elicit Ang IIdependent effects.4,5 Recently, receptors for Ang IV have
been detected in cortical collecting ducts and mesangial cells6
and Ang IV, in contrast to Ang III, has been shown to
increase renal blood flow and cerebral vasodilation.7 Thus,
APN may be in a critical position to modulate salt uptake in
nephrons and renal vascular resistance by controlling the
metabolism of Ang III to Ang IV. We hypothesized that APN
may play a mechanistic role in salt adaptation and
hypertension.
APN is a major constituent of the brush-border membranes
of kidney proximal tubule cells and enterocytes.8,9 APN
(IUBMB enzyme nomenclature ec 3.4.11.2, ap-n), known
also as microsomal aminopeptidase or aminopeptidase M, is
a homodimeric, membrane-bound, zinc-dependent peptidase
particle-bound aminopeptidase that preferentially releases
neutral amino acids from the N-terminal end of oligopeptides
and has specificity similar to that of cytosolic leucine aminopeptidase.10,11. APN belongs to the M1 family of the MA
clan of peptidases, which includes membrane-bound type II
glycoproteins and has been cloned from 6 different mammalian species. In the present study, we examined the impact of
dietary salt content on renal APN in normotensive and Dahl
salt-sensitive (SS) rats.
Methods
Animals
The animal-use protocols were approved by the Chicago-West Side
Veterans Administration Institutional Animal Care and Use Committee. Male Sprague-Dawley, Lewis, and Dahl SS/Jr rats weighing
250 to 300 grams and obtained from Harlan Sprague-Dawley
(Indianapolis, Ind) were administered basal (0.3%) and high-salt
(8%) rat-chow diets (Purina series 5500) for 10 days. Urinary sodium
was measured to confirm diets. Intra-aortic measurements of blood
pressure were performed as previously described.12 Telemetric blood
pressure measurements of these arrivals have previously been
reported.12
RNA Preparation
Kidneys were removed and fast-frozen in liquid nitrogen. Total RNA
was isolated with TRIzol (Invitrogen), with subsequent removal of
residual contaminants by using the RNeasy Total RNA Isolation Kit
(Qiagen). For high-quality poly(A)⫹ mRNA, total RNA prepared by
TRIzol was followed by use of the Oligotex mRNA kit (Qiagen).
Received June 11, 2003; first decision July 2, 2003; revision accepted November 18, 2003.
From the Section of Cardiology (M.F., T.L.W., B.P.R., D.L.G., R.S.D.), Department of Medicine, University of Illinois at Chicago, and West Side
Division Veterans Administration (M.F., B.P.R., R.S.D.), Chicago Health Care System, Chicago, Ill.
Correspondence to Dr Robert S. Danziger, Department of Medicine, University of Illinois at Chicago, 840 S. Wood St, Chicago, IL 60612. E-mail
[email protected]
© 2004 American Heart Association, Inc.
Hypertension is available at http://www.hypertensionaha.org
DOI: 10.1161/01.HYP.0000111584.15095.8a
282
Farjah et al
Aminopeptidase N in Salt Adaptation and Dahl Rat
283
Real-Time Polymerase Chain Reaction
SYBR green polymerase chain reaction (PCR) amplifications were
performed as previously described.12 APN primers were designed on
the basis of GenBank database accession number AFO39890 (Rattus
norvegicus APN gene, exon 2, and partial cds) using Primer Express
Software version 1.0 (PE Applied Biosystems) and checked by
running virtual PCR (forward: 5⬘ TCCTGGAGCCTGGTGAATCC
3⬘; reverse: 5, GGAAAGGCGGTGACACTAAT 3⬘). Primers for
GAPDH were as follows: forward ⫽ 5⬘ GAAGGGCTCATGACCACAGT 3⬘; reverse ⫽ 5⬘ GGATGCAGGGATGATGTTCT 3⬘. PCR
yielded unique bands of the predicted sizes. Sequencing of these
cloned products verified gene specificity. Near-log–linear amplification was observed, with amplification occurring between cycles 26
and 32. Each sample and reaction was replicated 3 times. Expression
was normalized to GAPDH as an endogenous reference and relative
to basal salt gene expression as a calibrator.
Western Analysis
Immunoblot analysis of kidney homogenates was performed as
previously described.12 Membranes were immunoprobed with mouse
polyclonal antihuman APN antibody (CD13 Ab-3 Laboratory Vision). Secondary antibody was a goat antimouse IgG HRPconjugated antibody (Santa Cruz Biotechnology). Blots were controlled for differences in sample loading by normalization to actin.
APN Activity
APN activity was measured in total kidney extract (prepared as
described for Western blots) by the methods of Ryan et al13 and
Salardi et al,14 except we used fluorogenic substrate Arg-Phe-AFC
(Enzyme System Products, Livermore, Calif) rather than radioactive
substrate. The rate of fluorescence increase was linear for ⬎20
minutes. Substrate without kidney extract was used as blank. The
enzyme activity was expressed as micromoles of AFC produced per
minute per milligram of protein using authentic AFC as a calibrator.
Radiation Hybrid Mapping
A rat– hamster hybrid panel consisting of 106 clones with an average
locus retention rate of 28% created by Peter Goodfellow (Cambridge, UK) (Research Genetics, Huntsville, AL) was used. Each
marker was tested separately (none was multiplexed) and screened at
least twice. The presence or absence of the aminopeptidase gene was
determined by PCR using gene-specific primers (forward: 5⬘ ATTTGCCCCCTTTTTACGAG 3⬘; reverse: 5⬘ ACTGCATGGGAATGTCACAA 3⬘; predicted product size: 448 bp). PCR products were
resolved on a 3% agarose gel and analyzed using the Bio-Rad gel
documentation system. The data were submitted to the Otsuka Gene
Research Institute (http://e4000.otsuka.gr.jp:8012/cgi-bin/RH/
rhNgv.pl) for testing against framework maps.
Gene locus markers were integrated into the virtual comparative
map (http://rgd.mcw.edu/tools/vcmap/vcmap.cgi?Ver⫽5.0) and related to known quantitative trait locus (QTL) and rat hormone
markers using Medical College of Ohio (http://home.mco.edu/depts/
physiology/research/rat/marker.html), Massachusetts Institute of
Technology (http://www-genome.wi.mit.edu/rat/public/),Oxford
(http://www.well.ox.ac.uk/rat_mapping_resources/), and Arb (http://
www.niams.nih.gov/rtbc/ratgbase/index.htm) linkage and rat hormone maps.
Figure 1. APN abundance in kidneys from Sprague-Dawley,
Lewis, and Dahl SS/Jr rats on 8% or 0.3% salt diets (see Methods). A, APN transcript abundance measured by (kinetic)
RT-PCR using SYBR green. B, APN protein abundance determined by Western analysis (see Methods). Expression of genes
within strains compared by ANOVA and change between strains
by 2-sided t test. Mean⫾SE; n⫽number of rats.
on 8% versus 0.3% salt diet (147⫾8 mm Hg versus
116⫾6 mm Hg, respectively; P⬍0.01).
Renal APN Transcript and Protein Abundance
Renal APN transcript abundance (Figure 1A) in kidneys was
the same in Sprague-Dawley, Lewis, and Dahl SS/Jr rats on
0.3% salt diets. On 8% salt diets, transcript abundance was
⬇2.5-fold greater than in 0.3% salt (P⬍0.01) in the SpragueDawley rats and the same in the Dahl SS/Jr rats on 0.3% salt.
Renal APN protein abundance (Figure 1B) in the three rat
strains on 0.3% salt diets was the same. On 8% salt,
abundance was 3-fold and 2-fold greater in Sprague-Dawley
and Lewis rats, respectively, than in Dahl SS/Jr rats
(P⬍0.05). Thus, protein and transcript abundance parallel
each other in both strains.
Statistics
Transcript/protein abundance and activities within strains were
compared using ANOVA and change between strains by 2-sided t
test. Significance was set at a level of P⬍0.05.
Results
Blood Pressure and Weights
In Sprague-Dawley rats, arterial blood pressure was the same
on 0.3% and 8% salt diets (116⫾4 mm Hg versus
116⫾7 mm Hg). In Dahl SS rats, blood pressure was greater
Renal APN Activity
APN activity was measured in membrane extracts from
kidneys after 10 days on either 8% or 0.3% salt diets (Figure
2). On a 0.3% salt diet, activity was ⬇3-fold and 2- fold
greater in Dahl SS/Jr and Lewis rats versus Sprague-Dawley
rats. APN activity was increased by ⬇10-fold and 2-fold in
Sprague-Dawley and Lewis rats, respectively, on 8% versus
0.3% salt diets. However, there was no change in activity in
the Dahl SS/Jr rats on the same diets.
284
Hypertension
February 2004
Figure 2. Total APN activity in membrane extracts from kidneys
of Sprague-Dawley, Lewis, and Dahl SS/Jr rats on 8% and
0.3% salt diets (see Methods). Expression of genes within
strains compared by ANOVA and change between strains by
2-sided t test. Mean⫾SE; n⫽number of rats.
Chromosomal Mapping of APN Gene
The marker was detected in 26% of the hybrids. LOD score
from 2-point analysis showed close correlation of the locus to
D1Rat42, D1Rat38, D1Got122, and D1Got115. The closest
linkage was with D1Rat42 (␪⫽0.086, LOD⫽17.749).
D1Rat42 and D1Rat38 were within blood pressure QTL 1b,
which was congenically defined in Dahl SS/Jr X Lewis.15 The
relationship to other markers and crosses are indicated in
Figure 3.
Discussion
The results suggest that APN may mediate salt-adaptation
and play a role in the pathogenesis of SS hypertension.
Adaptation to a high-salt diet in the Sprague-Dawley and
Lewis rats is accompanied by increased APN abundance and
activity, suggesting that increased metabolism of Ang III to
Ang IV may be a mechanism for reducing Na⫹ uptake and
renal vascular resistance in adaptation to a high-salt diet.
From the present studies, it is not possible to determine
whether a change in APN activity contributes to the development versus maintenance of pressure in salt-adaptation,
because the temporal relationship of the increase in blood
pressure to the increase in APN transcript in the rats was not
evaluated. In contrast, a high-salt diet does not increase renal
APN abundance or activity in Dahl SS/Jr rats. This is
consistent with the hypothesis that reduced APN activity
contributes to salt-sensitivity. Because Ang III acts on AT2
receptors, which are present in the thick ascending loop of
Henle, less metabolism of Ang III in Dahl SS rats on an 8%
salt diet may be a mechanism for increased sodium uptake in
the thick ascending loop of Henle in the Dahl SS rat.16 –18
Because reduced plasma Ang I and Ang II, renin, and
aldosterone levels have been found in the Dahl SS rats,19 –25
the RAS system has generally been thought to undergo
normal compensatory changes in response to hypertension
and not play a role in the pathogenesis of hypertension in this
strain. However, the present findings raise the possibility that
Ang III and IV play a mechanistic role in salt adaptation and
in the pathogenesis of hypertension. These measurements
may also help explain the finding of greater renal APN
activity in the Dahl SS/Jr than in the Sprague-Dawley on a
0.3% salt diet, even though there is greater renal uptake of
Na⫹ in the Dahl SS/Jr rat. To further address this requires
measurements of angiotensin metabolites, including angiotensins II, III, and IV, in these rat strains. The possibility that
other APN substrates, which include a variety of aliphatic
branched N-terminal amino acids,26 play a role in blood
pressure cannot be ruled out.
Further support for APN as a candidate gene for hypertension in the Dahl SS/Jr rat is provided by the finding that it
maps to a reported blood pressure QTL on chromosome
1.27,28 This is consistent with, but does not demonstrate, APN
as the culprit gene within the QTL that affects blood pressure.
Because this QTL was determined from a series of congenic
rat strains with segments of chromosome 1 from Lewis rats
introgressed into Dahl SS/Jr,27,28 this provides additional
support for APN as a candidate gene in the Dahl SS/Jr rat,
because we have identified it by comparing the Lewis strain
and the Sprague-Dawley rat strain, which is the progenitor
strain, to the Dahl SS/Jr rat.
Because selection in the present study was based on
differences in gene transcript abundance, we speculate that
functional polymorphisms/alleles of the APN gene associated
with SS hypertension are in noncoding flanking and/or
intronic regions of the APN gene, because there is altered
regulation of transcript abundance. The APN gene consists of
20 exons that encode segments differing in size from 18 to
205 amino acids.11 However, the possibility that there are
functional differences in the coding region cannot be excluded, especially because APN activity is different in
Sprague-Dawley versus Lewis and Dahl SS/Jr rats on 0.3%
Figure 3. Schematic diagram of a virtual chromosome 1 with relative map position of APN to blood pressure QTL and other markers.
Marker positions in defined crosses as designated on right side of figure (see Methods).
Farjah et al
Aminopeptidase N in Salt Adaptation and Dahl Rat
salt diets, even though APN protein abundance is the same. If
post-translational modifications of APN, rather than the APN
gene, are important in the pathogenesis of hypertension,
genes for the culprit modifiers (eg, kinases, phosphatases, and
the like) should cosegregate with hypertension rather than the
APN gene. Sequencing and further cosegregation analysis
should help to resolve this in the future.
Perspectives
The role that aminopeptidases and APN play in human blood
pressure remains to be determined. Thirty-three polymorphisms in the adipocyte-derived leucine aminopeptidase gene
have been identified, one of which (a Lys528Arg polymorphism) recently has been associated with essential human
hypertension.29 The APN gene has been assigned to the
long-arm region (q11-qter) of human chromosome 15, a
region in which there is evidence for a QTL for blood
pressure.30
Acknowledgments
The authors received the Veterans Administration Advanced Career
Development Award (R.S.D.), American Heart Association grantin-aid (R.S.D.), and NIH MIRS fellowship on R37 HL 22231 (T.W.).
References
1. Ardaillou R, Chansel D. Synthesis and effects of active fragments of
angiotensin II. Kidney Int. 1997;52:1458 –1468.
2. Ruiz-Ortega M, Lorenzo O, Ruperez M, Esteban V, Suzuki Y, Mezzano
S, Plaza JJ, Egido J. Role of the renin-angiotensin system in vascular
diseases: expanding the field. Hypertension. 2001;38:1382–1387.
3. Ruiz-Ortega M, Lorenzo O, Ruperez M, Suzuki Y, Egido J. Angiotensin
II activates nuclear transcription factor-kappaB in aorta of normal rats and
in vascular smooth muscle cells of AT1 knockout mice. Nephrol Dial
Transplant. 2001;16:27–33.
4. Blair-West JR, Coghlan JP, Denton DA, Funder JW, Scoggins BA,
Wright RD. The effect of the heptapeptide (2– 8) and hexapeptide (3– 8)
fragments of angiotensin II on aldosterone secretion. J Clin Endocrinol
Metab. 1971;32:575–578.
5. Fitzsimons JT. The effect on drinking of peptide precursors and of shorter
chain peptide fragments of angiotensin II injected into the rat’s diencephalon. J Physiol. 1971;214:295–303.
6. Czekalski S, Chansel D, Vandermeersch S, Ronco P, Ardaillou R.
Evidence for angiotensin IV receptors in human collecting duct cells.
Kidney Int. 1996;50:1125–1131.
7. Harding JW, Wright JW, Swanson GN, Hanesworth JM, Krebs LT. AT4
receptors: specificity and distribution. Kidney Int. 1994;46:1510 –1512.
8. Kenny AJ, Maroux S. Topology of microvillar membrance hydrolases of
kidney and intestine. Physiol Rev. 1982;62:91–128.
9. Olsen J, Kokholm K, Noren O, Sjostrom H. Structure and expression of
aminopeptidase N. Adv Exp Med Biol. 1997;421:47–57.
10. Noren O, Sjostrom H, Olsen J. Aminopeptidase N. In: Kenny AJ,
Boustead CM, eds. Cell-surface peptidases in health and disease. Oxford:
BIOS Scientific; 1997.
285
11. Sjostrom H, Noren O, Olsen J. Structure and function of aminopeptidase
N. Adv Exp Med Biol. 2000;477:25–34.
12. Farjah M, Roxas BP, Geenen DL, Danziger RS. Dietary salt regulates
renal SGK1 abundance: relevance to salt sensitivity in the Dahl rat.
Hypertension. 2003;41:874 – 878.
13. Ryan JW, Chung AY, Nearing JA, Valido FA, Shun-Cun C, Berryer P. A
radiochemical assay for aminopeptidase N. Anal Biochem. 1993;210:
27–33.
14. Salardi S, Falchetto R, Troffa C, Parenti P, Barber BR, Pastore S,
Glorioso N, Bianchi G. Relationships among alterations in renal
membrane sodium transport, renin and aminopeptidase M activities in
genetic hypertension. Biochim Biophys Acta. 1993;1182:22–29.
15. Rapp JP. Genetic analysis of inherited hypertension in the rat. Physiol
Rev. 2000;80:135–172.
16. Miyata N, Park F, Li XF, Cowley AW, Jr. Distribution of angiotensin
AT1 and AT2 receptor subtypes in the rat kidney. Am J Physiol. 1999;
277:F437–F446.
17. Alvarez-Guerra M, Garay RP. Renal Na-K-Cl cotransporter NKCC2 in
Dahl salt-sensitive rats. J Hypertens. 2002;20:721–727.
18. Garay RP, Alvarez-Guerra M, Alda JO, Nazaret C, Soler A, Vargas F.
Regulation of renal Na-K-Cl cotransporter NKCC2 by humoral natriuretic factors: relevance in hypertension. Clin Exp Hypertens. 1998;20:
675– 682.
19. Tamura K, Chiba E, Yokoyama N, Sumida Y, Yabana M, Tamura N,
Takasaki I, Takagi N, Ishii M, Horiuchi M, Umemura S. Renin-angiotensin system and fibronectin gene expression in Dahl Iwai salt-sensitive
and salt-resistant rats. J Hypertens. 1999;17:81– 89.
20. Campbell WG, Jr., Gahnem F, Catanzaro DF, James GD, Camargo MJ,
Laragh JH, Sealey JE. Plasma and renal prorenin/renin, renin mRNA, and
blood pressure in Dahl salt-sensitive and salt-resistant rats. Hypertension.
1996;27:1121–1133.
21. Gomez-Sanchez EP, Zhou M, Gomez-Sanchez CE. Mineralocorticoids,
salt and high blood pressure. Steroids. 1996;61:184 –188.
22. Rapp JP. Dahl salt-susceptible and salt-resistant rats. A review. Hypertension. 1982;4:753–763.
23. Cover CM, Wang JM, St Lezin E, Kurtz TW, Mellon SH. Molecular
variants in the P450c11AS gene as determinants of aldosterone synthase
activity in the Dahl rat model of hypertension. J Biol Chem. 1995;270:
16555–16560.
24. Rapp JP, Dahl LK. Suppression of aldosterone in salt susceptible and salt
resistant rats. Endocrinology. 1973;92:1286 –1289.
25. Rapp JP, Tan SY, Margolius HS. Plasma mineralocorticoids, plasma
renin, and urinary kallikrein in salt-sensitive and salt-resistant rats.
Endocr Res Commun. 1978;5:35– 41.
26. Kenny AJ, Stephenson LS, Turner AJ. Cell surface peptidases. In: Kenny
AJ, Turner AJ, eds. Mammalian ectoenzymes. Amsterdam: Elsevier
Science Publishers; 1987.
27. Saad Y, Garrett MR, Rapp JP. Multiple blood pressure QTL on rat
chromosome 1 defined by Dahl rat congenic strains. Physiol Genomics.
2001;4:201–214.
28. Saad Y, Garrett MR, Lee SJ, Dene H, Rapp JP. Localization of a blood
pressure QTL on rat chromosome 1 using Dahl rat congenic strains.
Physiol Genomics. 1999;1:119 –125.
29. Yamamoto N, Nakayama J, Yamakawa-Kobayashi K, Hamaguchi H,
Miyazaki R, Arinami T. Identification of 33 polymorphisms in the
adipocyte-derived leucine aminopeptidase (ALAP) gene and possible
association with hypertension. Hum Mutat. 2002;19:251–257.
30. Weder AB, Delgado MC, Zhu X, Gleiberman L, Kan D, Chakravarti A.
Erythrocyte sodium-lithium countertransport and blood pressure: a
genome-wide linkage study. Hypertension. 2003;41:842– 846.