Download Esculetin Suppresses Proliferation of Human Colon Cancer Cells by

Published OnlineFirst October 8, 2013; DOI: 10.1158/1940-6207.CAPR-13-0241
Cancer
Prevention
Research
Research Article
Esculetin Suppresses Proliferation of Human Colon Cancer
Cells by Directly Targeting b-Catenin
Sung-Young Lee1,2, Tae-Gyu Lim1,6, Hanyong Chen1, Sung Keun Jung1, Hyo-Jeong Lee5, Mee-Hyun Lee1,
Dong Joon Kim1,7, Aram Shin2, Ki Won Lee3,4,6, Ann M. Bode1, Young-Joon Surh2, and Zigang Dong1,2
Abstract
The Wnt pathway is a promising therapeutic and preventive target in various human cancers. The
transcriptional complex of b-catenin–T-cell factor (Tcf), a key mediator of canonical Wnt signaling, has been
implicated in human colon cancer development. Current treatment of colon cancer depends on traditional
cytotoxic agents with limited effects. Therefore, the identification of natural compounds that can disrupt the
b-catenin–TcF complex to suppress cancer cell growth with fewer adverse side effects is needed. To identify
compounds that inhibit the association between b-catenin and Tcf, we used computer docking to screen a
natural compound library. Esculetin, also known as 6,7-dihydroxycoumarin, is a derivative of coumarin and
was identified as a potential small-molecule inhibitor of the Wnt–b-catenin pathway. We then evaluated the
effect of esculetin on the growth of various human colon cancer cell lines and its effect on Wnt–b-catenin
signaling in cells and in an embryonic model. Esculetin disrupted the formation of the b-catenin–Tcf
complex through direct binding with the Lys312, Gly307, Lys345, and Asn387 residues of b-catenin in colon
cancer cells. In addition, esculetin effectively decreased viability and inhibited anchorage-independent
growth of colon cancer cells. Esculetin potently antagonized the cellular effects of b-catenin–dependent
activity, and in vivo treatment with esculetin suppressed tumor growth in a colon cancer xenograft mouse
model. Our data indicate that the interaction between esculetin and b-catenin inhibits the formation of the
b-catenin–Tcf complex, which could contribute to esculetin’s positive therapeutic and preventive effects
against colon carcinogenesis. Cancer Prev Res; 6(12); 1356–64. 2013 AACR.
Introduction
The Wnt family of secreted glycoproteins is highly conserved and regulates many biologic processes including
development and disease (1–6). In the embryonic development process, appropriate activation of Wnt signaling
regulates cell proliferation, differentiation, and determination of cell fate (7–11). Inappropriate activation of the Wnt
signaling pathway is implicated in human diseases, including various human cancers (1, 2, 6, 12–14). In particular,
Authors' Affiliations: 1The Hormel Institute, University of Minnesota,
Austin, Minnesota; 2WCU, Department of Molecular Medicine and Biopharmaceutical Sciences, Graduate School of Convergence Sciences and
Technology; 3Department of Agricultural Biotechnology; 4Center for Food
and Bioconvergence, Department of Agricultural Biotechnology, College of
Agriculture and Life Sciences, Seoul National University; 5College
of Korean Medicine, Kyung Hee University, Seoul; 6Advanced Institutes
of Convergence Technology, Gyeonggi-do; and 7Medical Genomics Center, Korea Research Institute of Bioscience and Biotechnology, Daejeon,
Republic of Korea
Note: Supplementary data for this article are available at Cancer Prevention
Research Online (http://cancerprevres.aacrjournals.org/).
S-Y. Lee and T.-G. Lim contributed equally to this work.
Corresponding Author: Zigang Dong, The Hormel Institute, University of
Minnesota, 801 16th Ave NE, Austin, MN 55912. Phone: 507-437-9600;
Fax: 507-437-9606; E-mail: [email protected]
doi: 10.1158/1940-6207.CAPR-13-0241
2013 American Association for Cancer Research.
1356
deregulation of the Wnt signaling pathway is a critical event
in colon carcinoma tumorigenesis (15–18). Thus, the Wnt
signaling pathway is considered a key therapeutic and
preventive target for cancer (19, 20).
In the absence of active Wnt signaling, the b-catenin
destruction complex, which is composed of glycogen
synthase kinase-3b (GSK-3b), adenomatous polyposis coli
(APC), and Axin, catalyzes the phosphorylation of b-catenin leading to its proteosomal degradation. Activation of
the canonical Wnt signaling pathway through the formation of a ligand-activated receptor complex inhibited the
formation of the b-catenin destruction complex, which
allows b-catenin to accumulate and subsequently translocate to the nucleus. Nuclear b-catenin directly binds with the
T-cell factor (Tcf)/lymphoid enhancer factor (LEF) family,
and these interactions stimulate transcription of Wnt target
genes, whose promoters contain binding sites of the Tcftranscription factor (3, 21–23).
Colorectal cancer (CRC) is the third most commonly
diagnosed cancer in males and the second most frequent
cancer reported in females (24). In the majority of colon
cancers, the canonical Wnt/b-catenin pathway is constitutively active (15–18). Approximately 90% of colon
cancers exhibit mutation of the APC or Axin genes, which
leads to a disruption of the b-catenin destruction complex
and accumulation of b-catenin. Multiple mutations
lead to the nuclear accumulation of b-catenin and
Cancer Prev Res; 6(12) December 2013
Downloaded from cancerpreventionresearch.aacrjournals.org on April 29, 2017. © 2013 American Association for Cancer
Research.
Published OnlineFirst October 8, 2013; DOI: 10.1158/1940-6207.CAPR-13-0241
Esculetin Is a Potent Inhibitor of b-Catenin
subsequent formation of a nuclear b-catenin–Tcf transcription complex (17, 25, 26). This leads to the inappropriate activation of its target genes, including c-myc
(27) and cyclin D1 (28, 29), and also plays an essential
role in proliferation of colon cancer cells. Therefore,
disrupting the b-catenin–Tcf complex and inhibiting the
nuclear function of b-catenin is considered to be therapeutically beneficial and could be useful for preventing
colon cancer.
Here, we performed virtual structure-based screening of a
natural product compound library using the crystal structure of the b-catenin–Tcf complex (PDB ID:1JPW). Esculetin (6,7-dihydroxy-2-chromenone), a derivative of coumarin that is present in many medicinal plants (30–33), was
identified as a potential inhibitor of b-catenin–Tcf-mediated transcription. Esculetin exhibits many pharmacologic
effects, including inhibiting lipooxygenase (34, 35) and
acting as an anticoagulant (36). In addition, inhibition of
cancer cell growth by esculetin has been reported previously
(37–39). Although esculetin has shown antiproliferative
effects in cancer cells, the molecular mechanism by which
this occurs has not been investigated carefully. In the
present study, we demonstrated that esculetin exhibits
inhibitory effects against human colon cancer cells by
directly targeting b-catenin, leading to the disruption of the
b-catenin–Tcf complex. These results suggested that esculetin has a significant therapeutic and preventive potential
against human colon cancer.
Materials and Methods
Reagents
Esculetin and anti-b-actin were purchased from SigmaAldrich. McCoy’s 5A and RPMI1640 medium were obtained
from Thermo Fisher Scientific. Basal Medium Eagle (BME),
gentamicin, penicillin/streptomycin, and L-glutamine were
obtained from Invitrogen. [g-32P]-ATP and the chemiluminescence detection kit were obtained from Amersham Pharmacia Biotech. CNBr-Sepharose 4B beads were purchased
from GE Healthcare. The MTS solution was purchased from
Promega. Antibodies against b-catenin and cyclin D1 were
obtained from Santa Cruz Biotechnology. Antibodies
against c-Myc and Tcf4 were purchased from Cell Signaling
Technology.
Plasmid constructs
The Myc-tagged b-catenin TM mutant, in which Lys312,
Gly307, Lys345, and Asn387 was changed to Glu, Val, Glu,
and Ala, respectively, was generated using the QuickChange
II site directed mutagenesis kit (Stratagene).
Cell culture
All cell lines were purchased from the American Type
Culture Collection and were cytogenetically tested and
authenticated before the cells were frozen. Each vial of
frozen cells was thawed and maintained in culture for a
maximum of 8 weeks. HCT116 human colon cancer cells
were cultured in McCoY’s 5A medium supplemented with
www.aacrjournals.org
10% (v/v) FBS (Atlanta Biologicals) and HCT15 and DLD-1
human colon cancer cells were cultured in RPMI1640
medium supplemented with 10% (v/v) FBS.
Cell viability assay
Cells were seeded (2 103 cells per well) in 96-well
plates and incubated for 12 hours and then treated with
different doses of esculetin. After incubation for 72 hours,
20 mL of Cell Titer96 Aqueous One Solution (Promega)
were added and cells were incubated for 1 hour at 37 C
in a 5% CO2 incubator. Absorbance was measured at
492 nm.
Preparation of esculetin-Sepharose 4B beads
To activate Sepharose 4B beads, esculetin and Sepharose
4B powder (0.3 g) were suspended in 1 mmol/L HCl. Then
the coupled solution (0.1 mol/L NaHCO3, pH 8.3 and 0.5
mol/L NaCl) was added and rotated overnight at 4 C. The
mixture was washed with coupling buffer, and transferred
to 0.1 mol/L Tris–HCl buffer (pH 8.3). The excess of
uncoupled esculetin was removed by washing with 0.1
mol/L acetate buffer (pH 4.0) and 0.1 mol/L Tris–HCl
buffer (pH 8.0) containing 0.5 mol/L NaCl.
Cell-based pull-down assay
Proteins (500 mg) of HCT116, HCT15, and DLD-1 cells
extracted with reaction buffer were mixed with Sepharose
4B beads (as a negative control) or esculetin-Sepharose 4B
beads (100 mL) in reaction buffer [50 mmol/L Tris, pH 7.5, 5
mmol/L EDTA, 150 mmol/L NaCl, 1 mmol/L dithiothreitol
(DTT), 0.01% Nonidet P-40, 2 mg/mL BSA, 0.2 mmol/L
phenylmethylsulfonylfluoride (PMSF), and 1 protease
inhibitor mixture]. After incubation with gentle rocking
overnight at 4 C, the beads were washed 5 times with buffer
(50 mmol/L Tris, pH 7.5, 5 mmol/L EDTA, 150 mmol/L
NaCl, 1 mmol/L DTT, 0.01% Nonidet P-40, and 0.02
mmol/L PMSF) and binding was visualized by Western
blotting.
Anchorage-independent cell growth
In brief, cells (8 103 per well) suspended in BME
supplemented with 10% FBS were added to 0.3% agar with
different doses of esculetin in a top layer over a base layer of
0.6% agar. The cultures were maintained at 37 C in a 5%
CO2 incubator for 2 weeks and then colonies were counted
under a microscope using the Image-Pro Plus Software
version 4 program (Media Cybernetics).
Western blot analysis
Cell lysates were prepared with lysis buffer (10 mmol/L
Tris, pH 7.5, 150 mmol/L NaCl, 5 mmol/L EDTA, 1% Triton
X-100, 1 mmol/L DTT, 0.1 mmol/L PMSF, 10% glycerol,
and protease inhibitor cocktail tablet). The protein concentration was measured using the bicinchoninic acid assay
(Pierce Biotechnology). A horseradish peroxidase-conjugated secondary antibody (Pierce Biotechnology) was used and
the signal was detected with chemiluminescence reagent
(Amersham).
Cancer Prev Res; 6(12) December 2013
Downloaded from cancerpreventionresearch.aacrjournals.org on April 29, 2017. © 2013 American Association for Cancer
Research.
1357
Published OnlineFirst October 8, 2013; DOI: 10.1158/1940-6207.CAPR-13-0241
Lee et al.
Total RNA isolation and reverse transcription-PCR
(RT-PCR)
Total RNA was extracted from cells using the TRizol
reagent (Tel-Test Inc.) according to the manufacturer’s
instructions. cDNA was synthesized using the Superscript
pre-amplification system (Life Technologies Inc.). PCR
reactions were performed using the following conditions:
94 C for 5 minutes and 25 to -28 amplification cycles at
94 C for 30 seconds, the appropriate annealing temperature
for 45 seconds, and 72 C for 30 seconds, and a final
extension at 72 C for 10 minutes. The PCR primers were
GAPDH (forward: 50 -CTCAGACACCATGGGGAAGGT-30 )
and reverse: 50 -TGATCTTGAGGCTGTTGTCATA-30 ); c-myc
(forward: 50 -TGTCAAGAGGCGAACACACAACGTC-30 and
reverse: 50 - ATCTTTCAGTCTCAAGACTCAGCCA-30 ); and cyclin D1 (forward: CCTGTCCTACTACCGCCTCA and reverse:
50 - TCCTCCTCTTCCTCCTCCTC-30 ).
Immunoprecipitation assay
HCT116 and HCT15 cells were treated with the indicated
concentration of esculetin for 24 hours and then disrupted
with lysis buffer (50 mmol/L Tris, pH 8, 250 mmol/L NaCl,
5 mmol/L EDTA, 0.1% NP-40, 10% glycerol, and 1
protease inhibitor cocktail). Cell lysates were cleared by
centrifugation, and immunoprecipitations were performed
by incubating overnight with anti-b-catenin. Protein A/G
Plus Agarose (Santa Cruz Biotechnology) was added and
the solution was incubated for 3 hours at 4 C. Unbound
proteins were removed by washing 4 times with lysis buffer.
Bound proteins were harvested by boiling in sample buffer,
and resolved by electrophoresis in 8% SDSPAGE. b-catenin
and Tcf4 proteins were visualized using a chemiluminescence reagent (Amersham).
(Invitrogen) containing BSA (1 mg/mL), 7 mmol/L Tris–HCl
(pH 7.5), and gentamicin (50 mg/mL). Xenopus embryos at
stage 40 do not have vertebrae, but have the notochord,
which is a precursor of the backbone.
Xenograft studies in nude mice
Female athymic nude mice (6- to 7-week old) were
purchased from Central Lab Animal Inc. (Seoul, Korea)
and maintained under "specific pathogen-free" conditions
on the basis of the guidelines established by the University
of Seoul National University (Seoul, Korea) Institutional
Animal care and Use Committee (SNU120106-4). Mice
were divided into four groups: (i) untreated vehicle
group (n ¼ 10); (ii) 20 mg esculetin per kilogram of body
weight (n ¼ 10); (iii) 100 mg esculetin per kilogram of body
weight (n ¼ 10); (iv) no cells and 100 mg esculetin per
kilogram of body weight (n ¼ 10). HCT116 cells (2.5 106
cells/100 mL) suspended in serum-free McCoy 5A medium
were injected subcutaneously in the flank of each animal.
Esculetin or vehicle was administered intraperitoneally 3
times per week for 11 days. Dimethyl sulfoxide (DMSO;
4%) and polyethylene glycol (40%) were diluted with PBS
buffer and used as the vehicle. At the end of the experiment,
Transfection and luciferase reporter gene assay
Transient transfection was performed using jetPEI
(VWR), and assays to detect firefly luciferase and Renilla
activities were performed according to the manufacturer’s
instructions (Promega). Briefly, cells were seeded into 96well plates and cotransfected with 50 ng of the Renilla
luciferase internal control gene and 100 ng of the TOPflash luciferase reporter construct containing three tandem
Tcf consensus binding sites upstream of luciferase cDNA, or
the FOP-flash luciferase reporter construct, a plasmid with
mutated Tcf binding sites. After 12 hours of transfection,
cells were incubated with the indicated concentration of
esculetin for another 24 hours. Luciferase and Renilla activities were measured using substrates included in the reporter
assay system (Promega). The luciferase activity was normalized to Renilla activity.
Xenopus experiment
Xenopus laevis embryos were obtained by artificial fertilization. Vitelline membranes were removed by immersing embryos in a 2% cysteine solution (pH 8). Embryos
were injected with 250 pg of b-catenin mRNA alone or
together with the indicated concentration of esculetin and
then cultured to stage 40 in 67% Leibovitzs L-15 medium
1358
Cancer Prev Res; 6(12) December 2013
Figure 1. Modeling of esculetin binding with b-catenin. A, chemical
structure of esculetin. B, esculetin binds with b-catenin. Hydrogen bonds
are formed between esculetin and b-catenin at the Lys312, Gly307,
Lys345, and Asn387 residues of b-catenin. Images were generated with
the UCSF Chimera program.
Cancer Prevention Research
Downloaded from cancerpreventionresearch.aacrjournals.org on April 29, 2017. © 2013 American Association for Cancer
Research.
Published OnlineFirst October 8, 2013; DOI: 10.1158/1940-6207.CAPR-13-0241
Esculetin Is a Potent Inhibitor of b-Catenin
mice were sacrificed, and tumors were extracted. Tumor
volume was calculated from measurements of two diameters of the individual tumor base using the following
formula: tumor volume (mm3) ¼ (length width height
0.52).
Immunohistochemical staining
For histopathologic examination, paraffin sections
(4 mm) were stained with hematoxylin and eosin. Immunohistochemical staining for Ki-67 (Lab Vision Corporation), cyclin D1 (Santa Cruz Biotechnology), or c-Myc
(Novous Biologicals) was performed using the indirect
avidin–biotin-enhanced horseradish peroxidase method
(Vector Laboratories). For quantitation, each slide was
scanned to obtain an overall impression of the staining
patterns and 10 representative 200 power (Ki-67 and
cyclin D1) or 400 (c-Myc) photomicrographs were taken
with a digital camera, avoiding gross necrotic areas. The
positively stained cancer epithelial cells within each photomicrograph were counted. Counting the total number of
cancer cells was aided with the Image Proþ image-processing program. The Ki-67 and cyclin D1 indices were based
on the counting of approximately 7,000 total cells per
tumor slide.
Virtual screening
To find potential inhibitors of b-catenin, a molecular
docking method was developed using the Glide module
from Schr€
odinger Suite 2011 (40, 41) and used to perform the virtual screening. A crystal structure of a human
Tcf-4–b-catenin complex (PDB ID:1JPW; refs. 42, 43) was
downloaded from the PDB Bank (44) for virtual screening studies. This is an X-ray diffraction structure with a
resolution of 2.5 A. Waters, metals, and Tcf-4 were
stripped from the structure, and then hydrogens and
atom charges are added to the structure using the Protein
Preparation Wizard in Schr€
odinger suite 2011 with the
standard procedure outlined.
Two pockets were generated
respectively within a 30-A3 grid based on the binding site
of Tcf-4 with b-catenin. One pocket was centered with
Lys312 and the other with Lys435. The 2-D TCMD (Traditional Chinese Medicine Databse) structure database,
which consists of approximately 9,000 structures of natural products (45), was first converted to a three-dimensional (3D) structure database using the LigPrep module
of the Schr€
odinger Suite of software and then used for
virtual screening. High-throughput virtual screening
(HTVS) docking is usually first performed because it is
intended for the rapid screening of large numbers of
Figure 2. Direct binding of esculetin and b-catenin disrupts the b-catenin–Tcf complexes. A, esculetin directly binds to b-catenin. Colon cancer cell lysates
were incubated with esculetin-conjugated Sepharose 4B beads (Es-sepharose) or Sepharose 4B beads alone, and then the pulled-down proteins
were analyzed by immunoblotting. B, Lys312, Gly307, Lys345, and Asn387 of b-catenin are crucial for binding with esculetin. Myc-tagged wild-type (WT) or
mutant (TM) b-catenin was transfected into 293T cells. The pulled-down proteins were analyzed by immunoblotting. C, esculetin dose-dependently disrupts
the b-catenin–Tcf complex. Nuclear extracts derived from esculetin-treated colon cancer cells were used for an immunoprecipitation assay.
www.aacrjournals.org
Cancer Prev Res; 6(12) December 2013
Downloaded from cancerpreventionresearch.aacrjournals.org on April 29, 2017. © 2013 American Association for Cancer
Research.
1359
Published OnlineFirst October 8, 2013; DOI: 10.1158/1940-6207.CAPR-13-0241
Lee et al.
ligands followed by standard and extra precision (SP and
XP) docking.
Statistical analysis
All data are presented as means SD of triplicate samples
from at least three independent experiments. Differences
between means were assessed by ANOVA, and the minimum level of significance was set at P value less than 0.05.
Results
Computer modeling of the b-catenin and esculetin
complex
To find potential inhibitors of b-catenin, we performed
structure-based in silico screening using a molecular docking
method as described in the Materials and Methods section.
The crystal structure of b-catenin bound to the Tcf protein
has been determined and two major pockets of b-catenin for
binding with Tcf were identified previously (42, 43). Based
on the crystal structure, we screened a small-molecule
library to identify compounds that could possibly bind
to the two pockets of b-catenin, sites that are critical for
the binding of Tcf to b-catenin. We used in silico screening
to select three top-ranked compounds and tested their
effect on human colon cancer cell growth. Of the three,
esculetin was the most effective (Supplementary Fig. S1).
Esculetin (Fig. 1A) is a derivative of coumarin that is
present in many medicinal plants (30–33). The computational prediction of the binding affinity between esculetin and b-catenin was predicted to be very good with a
score of 6.75 kcal/mol. In addition, computer modeling
results predicted that esculetin could directly bind to the
Lys312, Gly307, Lys345, and Asn387 residues of b-catenin through hydrogen bonds (Fig. 1B). Therefore, we
suggest that esculetin might contribute to the inhibition
of the b-catenin–Tcf complex formation by directing
interacting with b-catenin.
Figure 3. Effects of esculetin
on the b-catenin–Tcf pathway.
A, esculetin inhibits the
transcriptional activity of the
b-catenin–Tcf complex in colon
cancer cells. Colon cancer cells
were cotransfected with reporter
genes harboring the b-catenin–Tcf
binding site (TOP-flash) or a mutant
b-catenin–Tcf binding site (FOPflash), respectively, and the Renilla
gene. Cells were treated for 24
hours with the indicated
concentration of esculetin. The
luciferase activity was normalized
to Renilla activity. B and C, colon
cancer cells were incubated for
24 hours with the indicated
concentration of esculetin. B,
esculetin inhibits the expression of
target proteins, c-Myc and cyclin
D1, of b-catenin–Tcf in colon
cancer cells. c-Myc and cyclin D1
protein levels were determined by
immunoblotting. C, esculetin
decreases the mRNA level of the
cyclin D1 and c-myc genes. –RT
indicates negative control of
reverse transcription (RT). D,
esculetin inhibits b-catenin–
induced axis duplication of
Xenopus embryos.
1360
Cancer Prev Res; 6(12) December 2013
Cancer Prevention Research
Downloaded from cancerpreventionresearch.aacrjournals.org on April 29, 2017. © 2013 American Association for Cancer
Research.
Published OnlineFirst October 8, 2013; DOI: 10.1158/1940-6207.CAPR-13-0241
Esculetin Is a Potent Inhibitor of b-Catenin
Esculetin directly binds with b-catenin
To confirm the results of the computer docking model,
we determined whether esculetin could directly bind to
b-catenin. We performed pull-down assays using esculetinconjugated Sepharose 4B beads with cell lysates of human
colon cancer cells. These results showed that esculetin directly
bound to b-catenin precipitated from HCT116, HCT15, and
DLD1 cell lysates (Fig. 2A). In addition, molecular docking of
the esculetin and b-catenin complex indicated that esculetin
binds with b-catenin at Lys312, Gly307, Lys345, and Asn387.
In order to confirm this prediction, we generated myc-tagged
wild-type b-catenin and mutant (TM) b-catenin plasmids in
which Lys312, Gly307, Lys345, and Asn387 were replaced
with Glu, Val, Glu, and Ala, respectively. Lysates from 293T
cells were transfected with myc-tagged wild-type or TM
b-catenin and were incubated with esculetin-conjugated
Sepharose 4B beads for a pull-down assay. These results
indicated that mutant (TM) b-catenin failed to bind esculetin
(Fig. 2B), which supports the computer docking model of the
predicted binding sites between esculetin and b-catenin.
We then investigated whether the direct binding of esculetin with b-catenin could interrupt the association of b-catenin with Tcf4. Tcf4 in nuclear extracts of esculetin-treated
HCT116 and HCT15 cells was coimmunoprecipitated with
anti-b-catenin. Indeed, esculetin suppressed the association
of b-catenin with Tcf4 in a dose-dependent manner (Fig. 2C).
These results suggested that esculetin might be able to attenuate the association of the b-catenin–Tcf4 transcriptional
complex by directly interacting with b-catenin.
Esculetin inhibits b-catenin–Tcf transactivation
To confirm the effect of esculetin on the b-catenin–Tcf
transcriptional complex in cells, we measured TOP/FOPluciferase activity in HCT116, HCT15, and DLD1 colon
cancer cells. Colon cancer cells were cotransfected with a
luciferase reporter gene containing three tandem Tcf consensus binding sites (TOP) or a mutated Tcf binding site
(FOP) and the Renilla-luciferase reporter gene as a normalizing transfection control. At 12 hours posttransfection,
cells were treated for 24 hours with the indicated concentration of esculetin. TOP or FOP-luciferase activity was
measured and normalized to Renilla-luciferase activity. Data
are shown as relative values compared with untreated
control. Esculetin effectively suppressed the TOP-luciferase
activity in a dose-dependent manner, without significantly
affecting FOP-luciferase activity (Fig. 3A). These results
indicated that esculetin inhibited the b-catenin–Tcf complex signaling, which is consistent with the finding that
esculetin disrupted the association of the b-catenin–Tcf
transcriptional complex.
Next, we examined the expression of c-myc and cyclin D1,
which are direct target genes of the b-catenin–Tcf complex.
We treated HCT116, HCT15, and DLD1 colon cancer cells
with esculetin and assessed the protein abundance of c-Myc
and cyclin D1. Treatment with esculetin for 24 hours
substantially repressed the protein levels of c-Myc and cyclin
D1, but had no effect on the levels of b-catenin or Tcf (Fig.
3B). In addition, we examined the mRNA levels of c-myc and
cyclin D1 in esculetin-treated human colon cancer cells.
Consistent with the protein abundance of c-Myc and cyclin
D1, the mRNA level of c-myc and cyclin D1 was attenuated by
esculetin (Fig. 3C). Taken together, these results indicated
that esculetin potently antagonizes the cellular effects of
b-catenin–Tcf-dependent transactivation.
To further confirm the inhibitory effects of esculetin on
the Wnt–b-catenin signaling pathway, we determined the
effect of esculetin on Wnt–b-catenin signaling in vivo. During early Xenopus development, ectopic expression of b-catenin on the future ventral side leads to duplication of
the embryonic body axis. This developmental model
has been well established to investigate the regulation of
Wnt–b-catenin signaling in vivo (46). Thus, this developmental model pathway provides rigorous methods for
determining the biologic effects of compounds on the
Figure 4. Anticancer activity of
esculetin. A, esculetin inhibits
proliferation of colon cancer cells.
Cells were treated with esculetin for
72 hours, and proliferation was
analyzed using the MTS assay.
B, esculetin inhibits anchorageindependent cell growth. , P <
0.05; , P < 0.01; , P < 0.001;
inhibitory effect of esculetin on
cancer cell growth and anchorageindependent cell growth.
www.aacrjournals.org
Cancer Prev Res; 6(12) December 2013
Downloaded from cancerpreventionresearch.aacrjournals.org on April 29, 2017. © 2013 American Association for Cancer
Research.
1361
Published OnlineFirst October 8, 2013; DOI: 10.1158/1940-6207.CAPR-13-0241
Lee et al.
b-catenin–Tcf pathway. Approximately 90% of embryos
injected with 250 pg of b-catenin mRNA showed duplication of ventral–dorsal axis (Fig. 3D). In contrast, coinjection
of b-catenin mRNA with 5 pmol of esculetin inhibited the
induction of axis duplication, with no contribution from
the DMSO vehicle (Fig. 3D). These experiments further
support the notion that esculetin inhibits the b-catenin–
Tcf-dependent signaling pathway.
Esculetin decreases viability and inhibits anchorageindependent growth of colon cancer cells
To determine the biologic effects of esculetin in cells,
HCT116, HCT15, and DLD1 colon cancer cells were treated
for 72 hours with various concentration of esculetin and
cell viability was assessed by the MTS assay. Esculetin
decreased viability of all three cell lines in a dose-dependent
manner (Fig. 4A). In addition, we evaluated the effect of
esculetin on anchorage-independent cell growth. HCT116,
HCT15, and DLD1 colon cancer cells were seeded with
esculetinin0.3% agarandincubatedfor3weeks.Datashowed
that esculetin significantly suppressed anchorage-indepen-
dent cell growth in a dose-dependent manner (Fig. 4B). These
results indicated that esculetin had antiproliferative and antitumorigenic effects against human colon cancer cells.
Esculetin inhibits tumor growth in a xenograft mouse
model
To examine the antitumor activity of esculetin in vivo,
HCT116 cancer cells were injected into the right flank of
individual athymic nude mice. Mice were injected intraperitoneally with vehicle or esculetin at 20 or 100 mg/kg body
weight 3 times a week for 2 weeks. Esculetin treatment
suppressed xenograft tumor development in mice. Treatment with 20 and 100 mg/kg esculetin significantly inhibited HCT116 tumor size by 44% and 64%, respectively,
relative to the vehicle-treated mice (Fig. 5A). All mice,
including those treated with only esculetin, were viable at
the end of the experiment, and body weight loss was not
observed in any mice treated with esculetin. This indicates
that the doses used were not overtly toxic to the animals.
Using the xenograft tumor tissues, we examined the effect
of esculetin on a tumor proliferation marker, Ki-67. The
Figure 5. Esculetin inhibits
xenograft tumor growth. A, the
average tumor volume of control
and esculetin-treated mice.
Esculetin suppresses colon tumor
growth. B, esculetin inhibits cyclin
D1 and c-Myc expression in tumor
tissues. The tumor tissues derived
from groups treated with vehicle
or 20 or 100 mg esculetin per
kilogram of body weight were
immunostained with the indicated
antibody. Positively stained cells
were counted and the values
were converted to a graphic
representation. , P < 0.05;
, P < 0.01; inhibitory effect of
esculetin on expression of
Ki-67, cyclin D1, and c-Myc.
1362
Cancer Prev Res; 6(12) December 2013
Cancer Prevention Research
Downloaded from cancerpreventionresearch.aacrjournals.org on April 29, 2017. © 2013 American Association for Cancer
Research.
Published OnlineFirst October 8, 2013; DOI: 10.1158/1940-6207.CAPR-13-0241
Esculetin Is a Potent Inhibitor of b-Catenin
expression of Ki-67 was markedly inhibited by treatment
with esculetin. In addition, we investigated the effect of
esculetin on the direct targets of Wnt–b-catenin signaling,
cyclin D1, and c-Myc by immunohistochemical analysis of
HCT116 xenograft tumor tissues. Expression of cyclin D1
and c-Myc also was suppressed by treatment with esculetin
(Fig. 5B). These data suggested that esculetin inhibited
HCT116 colon tumor development by suppressing Wnt–
b-catenin signaling.
Discussion
CRC is the third most common cancer in men and
women and is the third leading cause of cancer death
(39, 40). Thus, the causes and methods of preventing and
treating colon cancer are a high priority. In particular,
abnormal activation of Wnt signaling has been tightly
linked to colon cancer. Therefore, identifying small molecules targeting Wnt signaling is a promising preventive or
treatment strategy against cancer.
In the current study, we identified a natural product,
esculetin, as a potent inhibitor of Wnt signaling. Previously,
the inhibitory effect of esculetin on cell proliferation in
many cell lines has been reported (32, 33, 43, 44). However,
the molecular mechanism of the antiproliferation effect of
esculetin against colon cancer cells is not clearly understood. In the present study, we demonstrated that esculetin
could disrupt the interaction between b-catenin and Tcf by
targeting b-catenin, leading to suppression of the proliferation of three different colon cancer cell lines without
exhibiting any significant cytotoxic effects on the viability
of normal human colon cells (Supplementary Fig. S2). In
addition, we demonstrated that esculetin potently antagonized the cellular effects of b-catenin–dependent activity in
human colon cancer cells and in an animal model (Fig. 3).
Moreover, esculetin effectively decreased viability and
inhibited colony formation of human colon cancer cells
(Fig. 4) and tumorigenesis in vivo (Fig. 5). A high level of the
b-catenin–Tcf transcriptional complex caused by the accumulation of b-catenin is associated with human colon
cancer and colon carcinogenesis (9, 14, 16, 41, 42). Overall,
our results suggest that esculetin could be a potential
chemopreventive agent against colon carcinogenesis. In
particular, our results showing that esculetin could effectively inhibit b-catenin–induced morphogenesis in the frog
provide strong evidence supporting the potential preventive
effect of esculetin.
Recently, a number of existing drugs and natural compounds were reported to be antagonists of Wnt signaling.
However, their molecular mechanisms of action and cellular targets are largely unknown, making their applications in
cancer prevention and treatment and drug development
very limited. In the present studies, we identified esculetin as
a potent natural inhibitor of the Wnt–b-catenin signaling
pathway and elucidated its molecular mechanism of action.
Thus, we suggest that esculetin could be a potent cancer
therapeutic and preventive agent. However, several challenges remain to be addressed in the development of
clinically useful Wnt pathway inhibitors. We screened many
natural compounds that might affect the binding of Tcf to
b-catenin. However, biochemical and structural studies
showed that the region of b-catenin that binds to Tcf overlaps other binding partners, such as E-cadherin and APC
(47, 48). In the future, we will address whether esculetin can
disrupt other interactions or whether it is selective for the
b-catenin–Tcf protein–protein interaction. In addition,
although esculetin, a nontoxic natural compound, appears
to be potentially useful in treating or preventing cancer, its
efficacy, safety, and toxicity need to be elucidated.
In conclusion, we identified esculetin as a potent inhibitor of Wnt–b-catenin signaling, which acts by targeting
b-catenin to effectively suppress proliferation of human
colon cancer cells both in culture and in vivo. Overall, these
results indicate that esculetin could be a potential therapeutic or preventive and safe agent against human colon
cancers.
Disclosure of Potential Conflicts of Interest
No potential conflicts of interest were disclosed.
Authors' Contributions
Conception and design: S-Y. Lee, T.G. Lim, H. Chen, S.K. Jung, H-J. Lee,
K.W. Lee, Z. Dong
Development of methodology: S-Y. Lee, H. Chen, Z. Dong
Acquisition of data (provided animals, acquired and managed patients,
provided facilities, etc.): S-Y. Lee, T.G. Lim, M-H. Lee, A. Shin, Z. Dong
Analysis and interpretation of data (e.g., statistical analysis, biostatistics, computational analysis): S-Y. Lee, T.G. Lim, H. Chen, Z. Dong
Writing, review, and/or revision of the manuscript: S-Y. Lee, T.G. Lim,
H. Chen, K.W. Lee, A.M. Bode, Z. Dong
Administrative, technical, or material support (i.e., reporting or organizing data, constructing databases): S-Y. Lee, H. Chen, H-J. Lee,
M-H. Lee, D-J. Kim, A.M. Bode, Z. Dong
Study supervision: H-J. Lee, K.W. Lee, A.M. Bode, Y-J. Surh, Z. Dong
Grant Support
This work was financially supported by The Hormel Foundation and
National Institutes of Health (grant nos. CA120388, CA1666011,
CA172457, and R37 CA081064), the World Class University Grant, Ministry
of Education, Science, Technology, Republic of Korea (grant no. R31-2008000-10103-0), the National Leap Research Program (No. 2010-0029233)
through the National Research Foundation of Korea funded by the Ministry
of Education, Science and Technology of Korea, Republic of Korea and by the
Global Frontier Project grant (NRF-M1AXA002-2012M3A6A4054949) of
National Research Foundation funded by the Ministry of Education, Science
and Technology of Korea, Republic of Korea.
The costs of publication of this article were defrayed in part by the
payment of page charges. This article must therefore be hereby marked
advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate
this fact.
Received June 27, 2013; revised September 6, 2013; accepted September
24, 2013; published OnlineFirst October 8, 2013.
References
1.
Moon RT, Kohn AD, De Ferrari GV, Kaykas A. WNT and beta-catenin
signalling: diseases and therapies. Nat Rev Genet 2004;5:691–701.
www.aacrjournals.org
2.
Logan CY, Nusse R. The Wnt signaling pathway in development and
disease. Annu Rev Cell Dev Biol 2004;20:781–810.
Cancer Prev Res; 6(12) December 2013
Downloaded from cancerpreventionresearch.aacrjournals.org on April 29, 2017. © 2013 American Association for Cancer
Research.
1363
Published OnlineFirst October 8, 2013; DOI: 10.1158/1940-6207.CAPR-13-0241
Lee et al.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
1364
Miller JR, Hocking AM, Brown JD, Moon RT. Mechanism and function
of signal transduction by the Wnt/beta-catenin and Wnt/Ca2þ pathways. Oncogene 1999;18:7860–72.
Moon RT. Teaching resource. Canonical Wnt/beta-catenin signaling.
Sci STKE 2004;2004:tr5.
Peifer M, Polakis P. Wnt signaling in oncogenesis and embryogenesis–
a look outside the nucleus. Science 2000;287:1606–9.
Polakis P. Wnt signaling and cancer. Genes Dev 2000;14:1837–51.
Sokol SY. Wnt signaling and dorso-ventral axis specification in vertebrates. Curr Opin Genet Dev 1999;9:405–10.
De Robertis EM, Kuroda H. Dorsal-ventral patterning and neural
induction in Xenopus embryos. Annu Rev Cell Dev Bio1 2004;20:
285–308.
Wang J, Sinha T, Wynshaw-Boris A. Wnt signaling in mammalian
development: lessons from mouse genetics. Cold Spring Harb Perspect Biol 2012;4:pii:a007963.
Wodarz A, Nusse R. Mechanisms of Wnt signaling in development.
Annu Rev Cell Dev Bio1 1998;14:59–88.
Flaherty MP, Kamerzell TJ, Dawn B. Wnt signaling and cardiac differentiation. Prog Mol Biol Transl Sci 2012;111:153–74.
Kharaishvili G, Simkova D, Makharoblidze E, Trtkova K, Kolar Z,
Bouchal J. Wnt signaling in prostate development and carcinogenesis.
Biomed Pap Med Fac Univ Palacky Olomouc Czech Repub 2011;155:
11–8.
Miyoshi K, Rosner A, Nozawa M, Byrd C, Morgan F, LandesmanBollag E, et al. Activation of different Wnt/beta-catenin signaling
components in mammary epithelium induces transdifferentiation and
the formation of pilar tumors. Oncogene 2002;21:5548–56.
Miyoshi K, Hennighausen L. Beta-catenin: a transforming actor on
many stages. Breast Cancer Res 2003;5:63–8.
Segditsas S, Tomlinson I. Colorectal cancer and genetic alterations in
the Wnt pathway. Oncogene 2006;25:7531–7.
Morin PJ, Sparks AB, Korinek V, Barker N, Clevers H, Vogelstein B,
et al. Activation of beta-catenin-Tcf signaling in colon cancer by
mutations in beta-catenin or APC. Science 1997;275:1787–90.
Fearnhead NS, Wilding JL, Bodmer WF. Genetics of colorectal cancer:
hereditary aspects and overview of colorectal tumorigenesis. Br Med
Bull 2002;64:27–43.
Moravec M. [Colorectal cancer and canonical Wnt signaling pathway].
Cas Lek Cesk 2012;151:335–42.
Herbst A, Kolligs FT. Wnt signaling as a therapeutic target for cancer.
Methods Mol Biol 2007;361:63–91.
Luu HH, Zhang R, Haydon RC, Rayburn E, Kang Q, Si W, et al. Wnt/
beta-catenin signaling pathway as a novel cancer drug target. Curr
Cancer Drug Targets 2004;4:653–71.
Kikuchi A. Roles of Axin in the Wnt signaling pathway. Cell Signal
1999;11:777–88.
Clevers H, Nusse R. Wnt/beta-catenin signaling and disease. Cell
2012;149:1192–205.
Behrens J. The role of the Wnt signaling pathway in colorectal tumorigenesis. Biochem Soc Trans 2005;33:672–5.
Jemal A, Bray F, Center MM, Ferlay J, Ward E, Forman D. Global cancer
statistics. CA Cancer J Clin 2011;61:69–90.
Buchert M, Athineos D, Abud HE, Burke ZD, Faux MC, Samuel MS,
et al. Genetic dissection of differential signaling threshold requirements for the Wnt/beta-catenin pathway in vivo. PLoS Genet 2010;6:
e1000816.
Klaus A, Birchmeier W. Wnt signaling and its impact on development
and cancer. Nat Rev Cancer 2008;8:387–98.
Cancer Prev Res; 6(12) December 2013
27. He TC, Sparks AB, Rago C, Hermeking H, Zawel L, da Costa LT, et al.
Identification of c-MYC as a target of the APC pathway. Science
1998;281:1509–12.
28. Shtutman M, Zhurinsky J, Simcha I, Albanese C, D'Amico M, Pestell R,
et al. The cyclin D1 gene is a target of the beta-catenin/LEF-1 pathway.
Proc Natl Acad Sci U S A 1999;96:5522–7.
29. Tetsu O, McCormick F. Beta-catenin regulates expression of cyclin D1
in colon carcinoma cells. Nature 1999;398:422–6.
30. Cai Y, Luo Q, Sun M, Corke H. Antioxidant activity and phenolic
compounds of 112 traditional Chinese medicinal plants associated
with anticancer. Life Sci 2004;74:2157–84.
31. Bubols GB, Vianna DD, Medina-Remon A, von Poser G, LamuelaRaventos RM, Eifler-Lima VL, et al. The antioxidant activity of coumarins and flavonoids. Mini Rev Med Chem 2012;13:318–34.
32. Ng TB, Liu F, Wang ZT. Antioxidative activity of natural products from
plants. Life Sci 2000;66:709–23.
33. Adfa M, Yoshimura T, Komura K, Koketsu M. Antitermite activities of
coumarin derivatives and scopoletin from Protium javanicum Burm. f.
J Chem Ecol 2010;36:720–6.
34. Panossian AG. Inhibition of arachidonic acid 5-lipoxygenase of human
polymorphonuclear leukocytes by esculetin. Biomed Biochim Acta
1984;43:1351–5.
35. Sekiya K, Okuda H, Arichi S. Selective inhibition of platelet lipoxygenase by esculetin. Biochim Biophys Acta 1982;713:68–72.
36. Awaad AS, Al-Jaber NA, Soliman GA, Al-Outhman MR, Zain ME,
Moses JE, et al. New biological activities of Casimiroa edulis leaf
extract and isolated compounds. Phytother Res 2012;26:452–7.
37. Kaneko T, Tahara S, Takabayashi F. Inhibitory effect of natural coumarin compounds, esculetin and esculin, on oxidative DNA damage
and formation of aberrant crypt foci and tumors induced by 1,2dimethylhydrazine in rat colons. Biol Pharm Bull 2007;30:2052–7.
38. Yang J, Xiao YL, He XR, Qiu GF, Hu XM. Aesculetin-induced apoptosis
through a ROS-mediated mitochondrial dysfunction pathway in
human cervical cancer cells. J Asian Nat prod Res 2010;12:185–93.
39. Matsunaga K, Yoshimi N, Yamada Y, Shimizu M, Kawabata K, Ozawa
Y, et al. Inhibitory effects of nabumetone, a cyclooxygenase-2 inhibitor, and esculetin, a lipoxygenase inhibitor, on N-methyl-N-nitrosourea-induced mammary carcinogenesis in rats. Jpn J Cancer Res
1998;89:496–501.
€ dinger Suite Schro
€ dinger, LLC; 2011.
40. Schro
41. Miller JR, Mikol Y. Surveillance for diarrheal disease in New York City.
J Urban Health 1999;76:388–90.
42. Graham TA, Weaver C, Mao F, Kimelman D, Xu W. Crystal structure of a
beta-catenin/Tcf complex. Cell 2000;103:885–96.
43. Poy F, Lepourcelet M, Shivdasani RA, Eck MJ. Structure of a human
Tcf4-beta-catenin complex. Nat Struct Biol 2001;8:1053–7.
44. Berman HM, Westbrook J, Feng Z, Gilliland G, Bhat TN, Weissig H,
et al. The protein data bank. Nucleic Acids Res 2000;28:235–42.
45. Zhou JJ, Xie GR, Yan XJ. Traditional Chinese medicines: Molecular
structures, natural sources and applications. China: Chemical Industry
Press; 2004.
46. Moon RT, Kimelman D. From cortical rotation to organizer gene
expression: toward a molecular explanation of axis specification in
Xenopus. BioEssays 1998;20:536–45.
47. Sommer T, Hirsch C. San1p, checking up on nuclear proteins. Cell
2005;120:734–6.
48. Liu J, Xing Y, Hinds TR, Zheng J, Xu W. The third 20 amino acid repeat is
the tightest binding site of APC for beta-catenin. J Mol Biol 2006;360:
133–44.
Cancer Prevention Research
Downloaded from cancerpreventionresearch.aacrjournals.org on April 29, 2017. © 2013 American Association for Cancer
Research.
Published OnlineFirst October 8, 2013; DOI: 10.1158/1940-6207.CAPR-13-0241
Esculetin Suppresses Proliferation of Human Colon Cancer Cells
by Directly Targeting β-Catenin
Sung-Young Lee, Tae-Gyu Lim, Hanyong Chen, et al.
Cancer Prev Res 2013;6:1356-1364. Published OnlineFirst October 8, 2013.
Updated version
Supplementary
Material
Cited articles
E-mail alerts
Reprints and
Subscriptions
Permissions
Access the most recent version of this article at:
doi:10.1158/1940-6207.CAPR-13-0241
Access the most recent supplemental material at:
http://cancerpreventionresearch.aacrjournals.org/content/suppl/2013/10/08/1940-6207.CAPR-13-0241.DC
1
This article cites 45 articles, 8 of which you can access for free at:
http://cancerpreventionresearch.aacrjournals.org/content/6/12/1356.full.html#ref-list-1
Sign up to receive free email-alerts related to this article or journal.
To order reprints of this article or to subscribe to the journal, contact the AACR Publications Department at
[email protected].
To request permission to re-use all or part of this article, contact the AACR Publications Department at
[email protected].
Downloaded from cancerpreventionresearch.aacrjournals.org on April 29, 2017. © 2013 American Association for Cancer
Research.