Download Full Paper - Biotechniques.org

Differential Expression of Insulin-like Growth Factor 2 (IGF2) but not Insulin-like
Growth Factor Receptors (IGF1R/IGF2R) in Neuroblastoma Cell Lines
Zi Yan
Introduction
Neuroblastoma is the most common solid tumor in young children that arises from neural
crest cells. Cellular heterogeneity is found in both primary neuroblastoma tumor and
isolated neuroblastoma cell lines. NB tumor cells can be classified according to the
phenotype into N-type (neuroblastic), S-type (substrate-adherent), and I-type
(intermediate) (Ross et al. 1995, Ross et al. 2007). I-type NB cells were characterized as
cancer stem cells, which keep the self-renewal ability and also the potential to
differentiate along both neuron and glial pathways. Previous study by J. Walton showed
that the I-type is the most malignant phenotype, which has much higher tumorigenicity
than N- type NB cells, and S-type NB cells are not tumorigenic (Walton et al. 2004).
Comparing among these three phenotypes can help our understanding the molecular
mechanism of the malignancy of I-type cells as cancer stem cell, and the nature of the
cellular heterogeneity of neuroblastoma.
Insulin-like growth factors (IGFs) play important roles in many tumors (Baserga, 1995;
Satyamoorthy et al., 2001; Wu et al., 2002), including neuroblastoma (Sullivan et al.,
1995; Zumkeller and Schwab, 1999; Misawa et al., 2000; van Golen and Feldman, 2000;
Kim et al., 2004). IGF2 is an autocrine signal known to be involved in tumorigenesis
directly (Werner and LeRoith, 1993). The effect of IGFs is mediated by insulin-like
growth factors receptor 1 (IGF1R) that possesses tyrosine kinase activity. Ligand binding
causes autophosphorylation of IGF1R which initiates a cascade of cellular signaling
including Ras-MAP signaling pathway (Kim et al. 1997) and PI3K pathway (Czech, 1998;
Pollak et al., 2004). It is shown that inhibition of IGF1R in neuroblastoma cells induces
the regression of established tumor in mice (Liu et al., 1998). Furthermore, IGF1R
overexpression causes less apoptosis and enhances neuroblastoma tumorigenesis
(Singleton et al. 1996).
Previous studies suggest that IGF signaling pathway is differentially activated in
neuroblastoma cell lines (Kim et al., 2004). In this study, I compared the expression of
IGF2 ligand, IGF1R, and IGF2R in seven neuroblastoma cell lines with three different
phenotypes. The result showed that the most malignant I-type cell lines express the
highest level of IGF2 mRNA compared to N- and S-type cell lines, and IGF1R and
IGF2R expression is phenotype-independent, suggesting a possible role of IGF signal
pathway in the malignant property of I-type cancer stem cells.
Materials and Methods
Cell Culture
Two neuroblastoma I-type cell lines: BE(2)-C, CB-JMN, two N-type cell lines: SHSY5Y, IMR32, and three S-type cell lines: LA1-5s, KCNs, SH-EP1 were cultured in a
1:1 mixture of Eagle's minimum essential medium (with nonessential amino acids) and
Ham's nutrient mixture F12 supplemented with 10% fetal bovine serum. BE(2)-C cells
were grown for 14 days in the presence of 1 µM of all-trans retinoic acid (RA) or 10 µM
5-bromo-2′-deoxyuridine (BU) to in differentiation studies.
Reverse Transcription Polymerase Chain Reaction (RT-PCR)
Cells were collected in exponential growth phase. Total RNA was extracted using RNA
extraction kit from Qiagen. RT-PCR reaction was done using master mix from Qiagen
according to the instructions of the manufacturer. Primers used for PCR were: IGF2 (5’CGTTGAGGCGTGCTGTTTCC-3’ and 5’- GTCTTGGGTGGGTAGAGCAA-3’),
IGF1R (5’- GAGAACAATGAGTGCTGCCA -3’ and 5’AATTGCCCTTGAAGATGGTG -3’), and IGF2R (5’AGTGGAAGGGGACAACTGTG -3’ and 5’- GAAGAAGATGGCTGTGGAGC -3’).
The thermal cycler parameters were: 50°C 30 minutes; 95°C 15 minutes; 25 to 35 cycles
at 94°C for 30 seconds, to 57°C for 30 seconds, and 72°C for 30 seconds; and a final
extension at 72°C for 10 minutes. PCR products were resolved on 1.5 % agarose gels
and the amount of mRNA was determined by scanning densitometry of resulting
photographs, and then was normalized to that of GAPDH.
Quantitative Real-Time PCR
Quantitative Real-Time PCR was performed with using 7500 Real-Time PCR System
from Applied Biosystems. SYBR green master mix was supplied by Qiagen.
.
Results
IGF1R is expressed in all cell lines with three different phenotypes at a similar level
First, the expression of the IGF receptor, IGF1R, was examined with RT-PCR. RNA
samples from seven neuroblastoma cell lines with three phenotypes (I-type: BE(2)-C,
CB-JMN; N-type: SH-SY5Y, IMR32; S-type: LA1-5s, KCNs, and SH-EP1) were tested.
The result showed similar IGF1R mRNA levels in all seven NB cell lines from three
phenotypes (figure 1). This suggested that IGF signal pathway may be essential for
neuroblastoma since every cell lines from all three phenotypes expresses the mRNA.
Also, if there is a phenotype-specific regulatory mechanism of this signal pathway, it is
not at the transcriptional level of IGF receptor gene in neuroblastoma.
IGF2R expression is not related with phenotype in neuroblastoma cell lines
IGF2R is the receptor of IGF2 which lacks the tyrosine kinase domain. Binding IGF2 by
IGF2R can not promote any cellular signal. Therefore, IGF2R is a negative regulator of
IGF signaling pathway. Here, the expression of this gene was also examined in these
seven neuroblastoma cell lines by RT-PCR. The result showed that the mRNA level of
IGF2R was similar in all cell lines and was not related with phenotype of the cell lines
(figure 2). It indicates that in neuroblastoma phenotype-specific IGF signaling regulation
is not at the transcriptional step of IGF2R gene.
IGF2 is differentially expressed in three phenotypes
The next question is that if the expression of the IGF ligands is different among three
phenotypes. RT-PCR was used to detect the mRNA of IGF1 and IGF2 in the same seven
neuroblastoma cell lines with three phenotypes. The result showed that the two I-type cell
lines both express the highest level of IGF2 mRNA followed by N-type cell lines with
low level of IGF2 mRNA and S-type cell lines with very low expressed IGF2 mRNA
level, expect for one S-type cell line outliner, LA1-5s, which expressed high IGF2
mRNA level as the I-type cell lines. I-type is the most malignant phenotype with much
higher tumor forming ability in nude mice and colony forming efficiency in soft ager than
N- and S-type. IGF signal pathway is involved with activating PI3K and RAS-MAP
cascade and promoting cell survive and growth. Highly expressed IGF2 ligand in I-type
cells is consist with the previous study of IGF function, indicating I-type cells, but not Nand S-type cells, activate IGF signaling pathway by autocrine IGF2 and promote its own
proliferation. The outlier expressing high level of IGF2 mRNA, S-type LA1-5s cell line,
represents a high growth rate and lack of non-contact inhibition. Those properties are
shared with I-type cell lines but not other S-type cell lines, further suggesting that IGF
signaling is related with cell growth.
IGF1 mRNA was tested with RT-PCR also. With two different sets of well-designed
IGF1 primer and a 50-cycle RT-PCR in thermal cycler, no product can by detected (data
not shown). This result suggested that IGF1 is not express by neuroblastoma cells. But
further support of the result was definitely required since there was no positive control to
show the PCR condition and the primers were working.
Phenotype-related IGF2 expression is supported by differentiation experiment
I-type neuroblastoma cells can be induced to differentiate into N- and S-phenotype.
Previous study showed that I-type cells treated with retinoid acid (RA) can induce N-
phenotype and treated with Bromodeoxyuridine (BU) can induce S-phenotype. I-type cell
line BE(2)-C was treated with RA and BU to induce differentiation. After differentiated
phenotype was observed under the microscope, the cells were collected and subject to
RT-PCR and quantitative real-time PCR. The result showed that BU-induced S-type
phenotype greatly decreased IGF2 mRNA level, which consisted with the previous
finding. Surprisingly, RA-induced N-type phenotype did not decrease but increased IGF2
mRNA level (data not shown). This consists with a previous study that in neuroblastoma
cell line SK-N-SH, short term RA treatment increases IGF2 mRNA level, indicating that
in IGF2 expression in related with RA independent of phenotype changes.
Figure 1. IGF1R mRNA level in NB cell lines. (A). RT-PCR showing that IGF1R mRNA
level expressed in all cell lines, and the mRNA levels are similar (B). Gel pictures are
scanned. Density of each band is measured by Kodak gel imaging system. IGF1R mRNA
level is normalized to GAPDH. Three independent experiments are done. Average and
standard error are shown.
Figure 2. IGF2R mRNA level in NB cell lines. (A). RT-PCR showing that IGF2R mRNA
levels are similar in all cell lines (B). Gel pictures are scanned. Density of each band is
measured by Kodak gel imaging system. IGF1R mRNA level is normalized to GAPDH.
Three independent experiments are done. Average and standard error are shown.
Figure 3. IGF2 mRNA level in NB cell lines. (A). RT-PCR showing that IGF2 mRNA
level is high in both I-type cell line, intermediate in both N-type cell lines, and low in Stype cell lines, except for LA1-5s. (B). Gel pictures are scanned. Density of each band is
measured by Kodak gel imaging system. IGF2 mRNA level is normalized to GAPDH.
Three independent experiments are done. Average and standard error are shown.
A
B
Figure 4. IGF2 mRNA level in BE(2)-C cell line treated with BU. (A). BU treatment
induces S-type like differentiation of I-type BE(2)-C cell and decreases IGF2 mRNA
level. IGF2R mRNA level is not changed with BU treatment. (B). Differentiation
induced by BU causes IGF2 mRNA level change is further supported by quantitative
real-time PCR.
Summary
IGF signaling pathway plays key roles in cell cycle progression, cell proliferation and
tumor progression. In the study three important genes: IGF2, IGF1R, and IGF2R in IGF
signaling were examined in seven neuroblastoma cell lines with three different
phenotypes. IGF1R and IGF2R were found expressed in all seven cell lines at the same
level regardless the phenotype. Interestingly, IGF2 was found expressed at the highest
level in the most malignant phenotype, I-type neuroblastoma cell lines, indicating a
possible important role of this signaling pathway in the malignancy of these
neuroblastoma cancer stem cells.
Discussion
IGF signaling pathway is shown to play important roles in neuroblastoma. IGF1R
inhibition induces established neuroblastoma tumor regression in mice. IGF1R
overexpression enhances neuroblastoma tumorigenesis. IGF can also induce N-myc
overexpression, one key player in neuroblastoma. And, IGF is related with the metastasis.
It is shown that high level expression of IGF in bone marrow induces colony-forming by
migrated tumor cells.
In this study the expression of three genes related with IGF signaling pathway: IGF2,
IGF1R, and IGF2R is examined at the mRNA level. The observation that ligand IGF2
mRNA is expressed at the highest level in I-type neuroblastoma cancer stem cell lines
compared with the other two NB phenotype cell lines suggests the possibility that IGF
signaling is more activated in I-type cells. The result indicates the potential function of
IGF signaling in the malignant property of I-type cells. However, to further test such
possibility, this study at the mRNA level is not sufficient. Future study concerning the
expression of these genes at protein level is necessary. Furthermore, other important
players such as IGF binding proteins, IGF receptor substrates, and downstream Ras signal
pathway regulators, GEF, and GAP can also be critical steps regulating IGF signaling.
Further study about these steps may help us to better understand the IGF signaling
pathway and its function in neuroblastoma.
Acknowledgement
I would like to thank Dr. Robert Ross for providing neuroblastoma cell lines, and thank
Leleesha Samaraweera and Bo Liu for the help in the lab work of this project. I also
would like to thank Barbara Spengler for her valuable advices. I appreciate Dr. Berish
Rubin for his guidance. Finally, I would like to thank my husband, Dan Han for he gives
me so much help and encouragement during this year.
References
Baserga R. (1995), Cancer Research, 55: 249-252.
Czech MP. (1989), Cell, 59: 235-238.
Kim B, Leventhal PS, Saltiel AR, and Feldman EL. (1997), Journal of Biological
Chemistry, 272: 21268-21273.
Kim B, van Golen CM, and Feldman EL. (2004). Oncogene, 23: 130-141.
Liu X, Turbyville T, Fritz A, and Whitesell L. (1998), Cancer Research, 58: 5432-5438.
Misawa A, Hosoi H, Arimoto A, Shikata T, Akioka S, Matsumura T, Houghton PJ, and
Sawada T. (2000), Cancer Research, 60: 64-69.
Pollak MN, Schernhammer ES, and Hankinson SE. (2004), Nature Reviews (Cancer), 4:
505-518.
Ross R, Spengler B, Domenech C, Porubcin M, Rettig W, and Biedler J. (1995) Cell
Growth and Differentiation, 6: 449-456.
Ross R, and Spengler B. (2007), Seminar in Cancer Biol, 27: 241-247
Satyamoorthy K, Li G, Vaidya B, Patel D, and Herlyn M. (2001), Cancer Research, 61:
7318-7324.
Singleton JR, Randolph AE, and Feldman EL. (1996), Cancer Research, 56(19): 4522-9.
Sullivan KA, Castle VP, Hanash SM, and Feldman EL. (1995), American Journal of
Pathology, 147: 1790-1798.
van Golen CM, and Feldman EL. (2000), Journal of Cellular Physiology, 182: 24-32.
Walton J, Kattan D, Thomas S, Spengler B, Guo H, Biedler J, Cheung N, and Ross R.
(2004), Neoplasia 6: 838–845.
Wu Y, Yakar S, Zhao L, Hennighausen L, and LeRoith D. (2002), Cancer Research, 62:
1030-1035.
Zumkeller W, and Schwab M. (1999), Hormone and Metabolic Research, 31: 138-141