Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Differential Expression of Insulin-like Growth Factor 2 (IGF2) but not Insulin-like Growth Factor Receptors (IGF1R/IGF2R) in Neuroblastoma Cell Lines Zi Yan Introduction Neuroblastoma is the most common solid tumor in young children that arises from neural crest cells. Cellular heterogeneity is found in both primary neuroblastoma tumor and isolated neuroblastoma cell lines. NB tumor cells can be classified according to the phenotype into N-type (neuroblastic), S-type (substrate-adherent), and I-type (intermediate) (Ross et al. 1995, Ross et al. 2007). I-type NB cells were characterized as cancer stem cells, which keep the self-renewal ability and also the potential to differentiate along both neuron and glial pathways. Previous study by J. Walton showed that the I-type is the most malignant phenotype, which has much higher tumorigenicity than N- type NB cells, and S-type NB cells are not tumorigenic (Walton et al. 2004). Comparing among these three phenotypes can help our understanding the molecular mechanism of the malignancy of I-type cells as cancer stem cell, and the nature of the cellular heterogeneity of neuroblastoma. Insulin-like growth factors (IGFs) play important roles in many tumors (Baserga, 1995; Satyamoorthy et al., 2001; Wu et al., 2002), including neuroblastoma (Sullivan et al., 1995; Zumkeller and Schwab, 1999; Misawa et al., 2000; van Golen and Feldman, 2000; Kim et al., 2004). IGF2 is an autocrine signal known to be involved in tumorigenesis directly (Werner and LeRoith, 1993). The effect of IGFs is mediated by insulin-like growth factors receptor 1 (IGF1R) that possesses tyrosine kinase activity. Ligand binding causes autophosphorylation of IGF1R which initiates a cascade of cellular signaling including Ras-MAP signaling pathway (Kim et al. 1997) and PI3K pathway (Czech, 1998; Pollak et al., 2004). It is shown that inhibition of IGF1R in neuroblastoma cells induces the regression of established tumor in mice (Liu et al., 1998). Furthermore, IGF1R overexpression causes less apoptosis and enhances neuroblastoma tumorigenesis (Singleton et al. 1996). Previous studies suggest that IGF signaling pathway is differentially activated in neuroblastoma cell lines (Kim et al., 2004). In this study, I compared the expression of IGF2 ligand, IGF1R, and IGF2R in seven neuroblastoma cell lines with three different phenotypes. The result showed that the most malignant I-type cell lines express the highest level of IGF2 mRNA compared to N- and S-type cell lines, and IGF1R and IGF2R expression is phenotype-independent, suggesting a possible role of IGF signal pathway in the malignant property of I-type cancer stem cells. Materials and Methods Cell Culture Two neuroblastoma I-type cell lines: BE(2)-C, CB-JMN, two N-type cell lines: SHSY5Y, IMR32, and three S-type cell lines: LA1-5s, KCNs, SH-EP1 were cultured in a 1:1 mixture of Eagle's minimum essential medium (with nonessential amino acids) and Ham's nutrient mixture F12 supplemented with 10% fetal bovine serum. BE(2)-C cells were grown for 14 days in the presence of 1 µM of all-trans retinoic acid (RA) or 10 µM 5-bromo-2′-deoxyuridine (BU) to in differentiation studies. Reverse Transcription Polymerase Chain Reaction (RT-PCR) Cells were collected in exponential growth phase. Total RNA was extracted using RNA extraction kit from Qiagen. RT-PCR reaction was done using master mix from Qiagen according to the instructions of the manufacturer. Primers used for PCR were: IGF2 (5’CGTTGAGGCGTGCTGTTTCC-3’ and 5’- GTCTTGGGTGGGTAGAGCAA-3’), IGF1R (5’- GAGAACAATGAGTGCTGCCA -3’ and 5’AATTGCCCTTGAAGATGGTG -3’), and IGF2R (5’AGTGGAAGGGGACAACTGTG -3’ and 5’- GAAGAAGATGGCTGTGGAGC -3’). The thermal cycler parameters were: 50°C 30 minutes; 95°C 15 minutes; 25 to 35 cycles at 94°C for 30 seconds, to 57°C for 30 seconds, and 72°C for 30 seconds; and a final extension at 72°C for 10 minutes. PCR products were resolved on 1.5 % agarose gels and the amount of mRNA was determined by scanning densitometry of resulting photographs, and then was normalized to that of GAPDH. Quantitative Real-Time PCR Quantitative Real-Time PCR was performed with using 7500 Real-Time PCR System from Applied Biosystems. SYBR green master mix was supplied by Qiagen. . Results IGF1R is expressed in all cell lines with three different phenotypes at a similar level First, the expression of the IGF receptor, IGF1R, was examined with RT-PCR. RNA samples from seven neuroblastoma cell lines with three phenotypes (I-type: BE(2)-C, CB-JMN; N-type: SH-SY5Y, IMR32; S-type: LA1-5s, KCNs, and SH-EP1) were tested. The result showed similar IGF1R mRNA levels in all seven NB cell lines from three phenotypes (figure 1). This suggested that IGF signal pathway may be essential for neuroblastoma since every cell lines from all three phenotypes expresses the mRNA. Also, if there is a phenotype-specific regulatory mechanism of this signal pathway, it is not at the transcriptional level of IGF receptor gene in neuroblastoma. IGF2R expression is not related with phenotype in neuroblastoma cell lines IGF2R is the receptor of IGF2 which lacks the tyrosine kinase domain. Binding IGF2 by IGF2R can not promote any cellular signal. Therefore, IGF2R is a negative regulator of IGF signaling pathway. Here, the expression of this gene was also examined in these seven neuroblastoma cell lines by RT-PCR. The result showed that the mRNA level of IGF2R was similar in all cell lines and was not related with phenotype of the cell lines (figure 2). It indicates that in neuroblastoma phenotype-specific IGF signaling regulation is not at the transcriptional step of IGF2R gene. IGF2 is differentially expressed in three phenotypes The next question is that if the expression of the IGF ligands is different among three phenotypes. RT-PCR was used to detect the mRNA of IGF1 and IGF2 in the same seven neuroblastoma cell lines with three phenotypes. The result showed that the two I-type cell lines both express the highest level of IGF2 mRNA followed by N-type cell lines with low level of IGF2 mRNA and S-type cell lines with very low expressed IGF2 mRNA level, expect for one S-type cell line outliner, LA1-5s, which expressed high IGF2 mRNA level as the I-type cell lines. I-type is the most malignant phenotype with much higher tumor forming ability in nude mice and colony forming efficiency in soft ager than N- and S-type. IGF signal pathway is involved with activating PI3K and RAS-MAP cascade and promoting cell survive and growth. Highly expressed IGF2 ligand in I-type cells is consist with the previous study of IGF function, indicating I-type cells, but not Nand S-type cells, activate IGF signaling pathway by autocrine IGF2 and promote its own proliferation. The outlier expressing high level of IGF2 mRNA, S-type LA1-5s cell line, represents a high growth rate and lack of non-contact inhibition. Those properties are shared with I-type cell lines but not other S-type cell lines, further suggesting that IGF signaling is related with cell growth. IGF1 mRNA was tested with RT-PCR also. With two different sets of well-designed IGF1 primer and a 50-cycle RT-PCR in thermal cycler, no product can by detected (data not shown). This result suggested that IGF1 is not express by neuroblastoma cells. But further support of the result was definitely required since there was no positive control to show the PCR condition and the primers were working. Phenotype-related IGF2 expression is supported by differentiation experiment I-type neuroblastoma cells can be induced to differentiate into N- and S-phenotype. Previous study showed that I-type cells treated with retinoid acid (RA) can induce N- phenotype and treated with Bromodeoxyuridine (BU) can induce S-phenotype. I-type cell line BE(2)-C was treated with RA and BU to induce differentiation. After differentiated phenotype was observed under the microscope, the cells were collected and subject to RT-PCR and quantitative real-time PCR. The result showed that BU-induced S-type phenotype greatly decreased IGF2 mRNA level, which consisted with the previous finding. Surprisingly, RA-induced N-type phenotype did not decrease but increased IGF2 mRNA level (data not shown). This consists with a previous study that in neuroblastoma cell line SK-N-SH, short term RA treatment increases IGF2 mRNA level, indicating that in IGF2 expression in related with RA independent of phenotype changes. Figure 1. IGF1R mRNA level in NB cell lines. (A). RT-PCR showing that IGF1R mRNA level expressed in all cell lines, and the mRNA levels are similar (B). Gel pictures are scanned. Density of each band is measured by Kodak gel imaging system. IGF1R mRNA level is normalized to GAPDH. Three independent experiments are done. Average and standard error are shown. Figure 2. IGF2R mRNA level in NB cell lines. (A). RT-PCR showing that IGF2R mRNA levels are similar in all cell lines (B). Gel pictures are scanned. Density of each band is measured by Kodak gel imaging system. IGF1R mRNA level is normalized to GAPDH. Three independent experiments are done. Average and standard error are shown. Figure 3. IGF2 mRNA level in NB cell lines. (A). RT-PCR showing that IGF2 mRNA level is high in both I-type cell line, intermediate in both N-type cell lines, and low in Stype cell lines, except for LA1-5s. (B). Gel pictures are scanned. Density of each band is measured by Kodak gel imaging system. IGF2 mRNA level is normalized to GAPDH. Three independent experiments are done. Average and standard error are shown. A B Figure 4. IGF2 mRNA level in BE(2)-C cell line treated with BU. (A). BU treatment induces S-type like differentiation of I-type BE(2)-C cell and decreases IGF2 mRNA level. IGF2R mRNA level is not changed with BU treatment. (B). Differentiation induced by BU causes IGF2 mRNA level change is further supported by quantitative real-time PCR. Summary IGF signaling pathway plays key roles in cell cycle progression, cell proliferation and tumor progression. In the study three important genes: IGF2, IGF1R, and IGF2R in IGF signaling were examined in seven neuroblastoma cell lines with three different phenotypes. IGF1R and IGF2R were found expressed in all seven cell lines at the same level regardless the phenotype. Interestingly, IGF2 was found expressed at the highest level in the most malignant phenotype, I-type neuroblastoma cell lines, indicating a possible important role of this signaling pathway in the malignancy of these neuroblastoma cancer stem cells. Discussion IGF signaling pathway is shown to play important roles in neuroblastoma. IGF1R inhibition induces established neuroblastoma tumor regression in mice. IGF1R overexpression enhances neuroblastoma tumorigenesis. IGF can also induce N-myc overexpression, one key player in neuroblastoma. And, IGF is related with the metastasis. It is shown that high level expression of IGF in bone marrow induces colony-forming by migrated tumor cells. In this study the expression of three genes related with IGF signaling pathway: IGF2, IGF1R, and IGF2R is examined at the mRNA level. The observation that ligand IGF2 mRNA is expressed at the highest level in I-type neuroblastoma cancer stem cell lines compared with the other two NB phenotype cell lines suggests the possibility that IGF signaling is more activated in I-type cells. The result indicates the potential function of IGF signaling in the malignant property of I-type cells. However, to further test such possibility, this study at the mRNA level is not sufficient. Future study concerning the expression of these genes at protein level is necessary. Furthermore, other important players such as IGF binding proteins, IGF receptor substrates, and downstream Ras signal pathway regulators, GEF, and GAP can also be critical steps regulating IGF signaling. Further study about these steps may help us to better understand the IGF signaling pathway and its function in neuroblastoma. Acknowledgement I would like to thank Dr. Robert Ross for providing neuroblastoma cell lines, and thank Leleesha Samaraweera and Bo Liu for the help in the lab work of this project. I also would like to thank Barbara Spengler for her valuable advices. I appreciate Dr. Berish Rubin for his guidance. Finally, I would like to thank my husband, Dan Han for he gives me so much help and encouragement during this year. References Baserga R. (1995), Cancer Research, 55: 249-252. Czech MP. (1989), Cell, 59: 235-238. Kim B, Leventhal PS, Saltiel AR, and Feldman EL. (1997), Journal of Biological Chemistry, 272: 21268-21273. Kim B, van Golen CM, and Feldman EL. (2004). Oncogene, 23: 130-141. Liu X, Turbyville T, Fritz A, and Whitesell L. (1998), Cancer Research, 58: 5432-5438. Misawa A, Hosoi H, Arimoto A, Shikata T, Akioka S, Matsumura T, Houghton PJ, and Sawada T. (2000), Cancer Research, 60: 64-69. Pollak MN, Schernhammer ES, and Hankinson SE. (2004), Nature Reviews (Cancer), 4: 505-518. Ross R, Spengler B, Domenech C, Porubcin M, Rettig W, and Biedler J. (1995) Cell Growth and Differentiation, 6: 449-456. Ross R, and Spengler B. (2007), Seminar in Cancer Biol, 27: 241-247 Satyamoorthy K, Li G, Vaidya B, Patel D, and Herlyn M. (2001), Cancer Research, 61: 7318-7324. Singleton JR, Randolph AE, and Feldman EL. (1996), Cancer Research, 56(19): 4522-9. Sullivan KA, Castle VP, Hanash SM, and Feldman EL. (1995), American Journal of Pathology, 147: 1790-1798. van Golen CM, and Feldman EL. (2000), Journal of Cellular Physiology, 182: 24-32. Walton J, Kattan D, Thomas S, Spengler B, Guo H, Biedler J, Cheung N, and Ross R. (2004), Neoplasia 6: 838–845. Wu Y, Yakar S, Zhao L, Hennighausen L, and LeRoith D. (2002), Cancer Research, 62: 1030-1035. Zumkeller W, and Schwab M. (1999), Hormone and Metabolic Research, 31: 138-141