Download Tutorial "Computational intelligence for data mining"

Document related concepts

Data analysis wikipedia , lookup

Computational phylogenetics wikipedia , lookup

Pattern recognition wikipedia , lookup

Data assimilation wikipedia , lookup

Error detection and correction wikipedia , lookup

Types of artificial neural networks wikipedia , lookup

K-nearest neighbors algorithm wikipedia , lookup

Corecursion wikipedia , lookup

Transcript
Computational Intelligence
for Data Mining
Włodzisław Duch
Department of Informatics
Nicholas Copernicus University
Torun, Poland
With help from
R. Adamczak, K. Grąbczewski
K. Grudziński, N. Jankowski, A. Naud
http://www.phys.uni.torun.pl/kmk
WCCI 2002, Honolulu, HI
Group members
Plan
What this tutorial is about ?
•
•
•
How to discover knowledge in data;
how to create comprehensible models of data;
how to evaluate new data.
1.
2.
3.
4.
5.
6.
7.
8.
9.
AI, CI & Data Mining
Forms of useful knowledge
GhostMiner philosophy
Exploration & Visualization
Rule-based data analysis
Neurofuzzy models
Neural models
Similarity-based models
Committees of models
AI, CI & DM
Artificial Intelligence: symbolic models of knowledge.
• Higher-level cognition: reasoning, problem solving,
planning, heuristic search for solutions.
• Machine learning, inductive, rule-based methods.
• Technology: expert systems.
Computational Intelligence, Soft Computing:
methods inspired by many sources:
• biology – evolutionary, immune, neural computing
• statistics, patter recognition
• probability – Bayesian networks
• logic – fuzzy, rough …
Perception, object recognition.
Data Mining, Knowledge Discovery in Databases.
• discovery of interesting patterns, rules, knowledge.
• building predictive data models.
Forms of useful knowledge
AI/Machine Learning camp:
Neural nets are black boxes.
Unacceptable! Symbolic rules forever.
But ... knowledge accessible to humans is in:
• symbols,
• similarity to prototypes,
• images, visual representations.
What type of explanation is satisfactory?
Interesting question for cognitive scientists.
Different answers in different fields.
Forms of knowledge
• Humans remember examples of each category
and refer to such examples – as similaritybased or nearest-neighbors methods do.
• Humans create prototypes out of many
examples – as Gaussian classifiers, RBF
networks, neurofuzzy systems do.
• Logical rules are the highest form of
summarization of knowledge.
Types of explanation:
• exemplar-based: prototypes and similarity;
• logic-based: symbols and rules;
• visualization-based: maps, diagrams,
relations ...
GhostMiner Philosophy
GhostMiner, data mining tools from our lab.
• Separate the process of model building and
knowledge discovery from model use =>
GhostMiner Developer & GhostMiner Analyzer
• There is no free lunch – provide different
type of tools for knowledge discovery.
Decision tree, neural, neurofuzzy, similaritybased, committees.
• Provide tools for visualization of data.
• Support the process of knowledge
discovery/model building and evaluating,
organizing it into projects.
Wine data example
Chemical analysis of wine from grapes grown in
the same region in Italy, but derived from three
different cultivars.
Task: recognize the source of wine sample.
13 quantities measured, continuous features:
•
•
•
•
•
alcohol content
ash content
magnesium content
flavanoids content
proanthocyanins
phenols content
• OD280/D315 of diluted
wines
•
•
•
•
malic acid content
alkalinity of ash
total phenols content
nonanthocyanins
phenols content
• color intensity
• hue
• proline.
Exploration and visualization
General info about the data
Exploration: data
Inspect the data
Exploration: data statistics
Distribution of feature values
Proline has very large values, the data should be standardized
before further processing.
Exploration: data standardized
Standardized data: unit standard deviation, about 2/3 of all
data should fall within [mean-std,mean+std]
Other options: normalize to fit in [-1,+1], or normalize
rejecting some extreme values.
Exploration: 1D histograms
Distribution of feature values in clasess
Some features are more useful than the others.
Exploration: 1D/3D histograms
Distribution of feature values in clasess, 3D
Exploration: 2D projections
Projections on selected 2D
Projections on selected 2D
Visualize data
Hard to imagine relations in more than 3D.
SOM mappings: popular for visualization, but
rather inaccurate, no measure of distortions.
Measure of topographical distortions: map all Xi
points from Rn to xi points in Rm, m < n, and ask:
how well are Rij = D(Xi, Xj) distances reproduced by
distances rij = d(xi,xj) ?
Use m = 2 for visualization,
use higher m for dimensionality reduction.
Visualize data: MDS
Multidimensional scaling: invented in psychometry
by Torgerson (1952), re-invented by Sammon
(1969) and myself (1994) …
Minimize measure of topographical distortions
moving the x coordinates.
1
S1  x  
2
R
 ij
R
i j
ij
 rij  x  
2
MDS
i j
1  r  x  
1
S2  x  
 Rij

1
S3  x  
 Rij
 1  r  x 
i j
i j
i j
i j
2
ij
Sammon
Rij
ij
Rij 
2
MDS, more local
Visualize data: Wine
3 clusters are clearly distinguished, 2D is fine.
The green outlier can be identified easily.
Decision trees
Simplest things first:
use decision tree to find logical rules.
Test single attribute, find good point to split the
data, separating vectors from different classes.
DT advantages: fast, simple, easy to understand,
easy to program, many good algorithms.
Decision borders
Univariate trees:
test the value of a single attribute x < a.
Multivariate trees:
test on combinations of attributes.
Result: feature space is divided in hyperrectangular
areas.
SSV decision tree
Separability Split Value tree:
based on the separability criterion.
Define left and right sides of the splits:
 x  D : f ( x)  s , f continuous
LS  s, f , D   
 x  D : f ( x)  s , f discrete
RS  s, f , D   D  LS  s, f , D 
SSV criterion: separate as many pairs of vectors
from different classes as possible; minimize the
number of separated from the same class.
SSV ( s)  2 LS  s, f , D 
cC

Dc  RS  s, f , D 
 min LS  s, f , D 
cC
 D  Dc 
Dc , RS  s, f , D  Dc

SSV – complex tree
Trees may always learn to achieve 100% accuracy.
Very few vectors are left in the leaves!
SSV – simplest tree
Pruning finds the nodes that should be removed to
increase generalization – accuracy on unseen data.
Trees with 7 nodes left: 15 errors/178 vectors.
SSV – logical rules
Trees may be converted to logical rules.
Simplest tree leads to 4 logical rules:
1.
2.
3.
4.
if proline > 719 and flavanoids > 2.3 then class 1
if proline < 719 and OD280 > 2.115 then class 2
if proline > 719 and flavanoids < 2.3 then class 3
if proline < 719 and OD280 < 2.115 then class 3
How accurate are such rules?
Not 15/178 errors, or 91.5% accuracy!
Run 10-fold CV and average the results.
85±10%? Run 10X!
SSV – optimal trees/rules
Optimal: estimate how well rules will generalize.
Use stratified crossvalidation for training;
use beam search for better results.
1. if OD280/D315 > 2.505 and proline > 726.5 then class 1
2. if OD280/D315 < 2.505 and hue > 0.875 and malic-acid <
2.82 then class 2
3. if OD280/D315 > 2.505 and proline < 726.5 then class 2
4. if OD280/D315 < 2.505 and hue > 0.875 and malic-acid >
2.82 then class 3
5. if OD280/D315 < 2.505 and hue < 0.875 then class 3
Note 6/178 errors, or 91.5% accuracy!
Run 10-fold CV: results are 90.4±6.1%? Run 10X!
Logical rules
Crisp logic rules: for continuous x use linguistic
variables (predicate functions).
sk(x)  True [Xk x  X'k], for example:
small(x)
= True{x|x < 1}
medium(x) = True{x|x  [1,2]}
large(x)
= True{x|x > 2}
Linguistic variables are used in crisp
(prepositional, Boolean) logic rules:
IF small-height(X) AND has-hat(X) AND hasbeard(X)
THEN (X is a Brownie)
ELSE IF ... ELSE ...
Crisp logic decisions
Crisp logic is based on rectangular
membership functions:
True/False values jump from 0 to 1.
Step functions are used for
partitioning of the feature space.
Very simple hyper-rectangular
decision borders.
Sever limitation on the expressive
power of crisp logical rules!
Logical rules - advantages
Logical rules, if simple enough, are preferable.
• Rules may expose limitations of black box
•
•
•
•
solutions.
Only relevant features are used in rules.
Rules may sometimes be more accurate than
NN and other CI methods.
Overfitting is easy to control, rules usually
have small number of parameters.
Rules forever !?
A logical rule about logical rules is:
IF
the number of rules is relatively small
AND the accuracy is sufficiently high.
THEN rules may be an optimal choice.
Logical rules - limitations
Logical rules are preferred but ...
• Only one class is predicted p(Ci|X,M) = 0 or 1
•
•
•
•
black-and-white picture may be inappropriate in
many applications.
Discontinuous cost function allow only nongradient optimization.
Sets of rules are unstable: small change in the
dataset leads to a large change in structure of
complex sets of rules.
Reliable crisp rules may reject some cases as
unclassified.
Interpretation of crisp rules may be misleading.
• Fuzzy rules are not so comprehensible.
How to use logical rules?
Data has been measured with unknown error.
Assume Gaussian distribution:
x  Gx  G( y; x, sx )
x – fuzzy number with Gaussian membership function.
A set of logical rules R is used for fuzzy input vectors:
Monte Carlo simulations for arbitrary system => p(Ci|X)
Analytical evaluation p(C|X) is based on cumulant:
 a  x 
1
  a  x    G  y; x, sx  dy  1  erf 
      (a  x) 
2 

 sx 2  
a
  2.4 / 2sx
Error function is identical
to logistic f. < 0.02
Rules - choices
Simplicity vs. accuracy.
Confidence vs. rejection rate.
 p
p  true | predicted   
 p
p
p
p r  p
p r  p
p is a hit; p false alarm; p is a miss.
Accuracy (overall) A(M) = p+ p
Error rate
Rejection rate
Sensitivity
Specificity
L(M) = p+ p
R(M)=p+r+pr= 1L(M)A(M)
S+(M)= p+|+ = p++ /p+
S(M)= p| = p /p
Rules – error functions
The overall accuracy is equal to a combination of sensitivity
and specificity weighted by the a priori probabilities:
A(M) = pS(M)+pS(M)
Optimization of rules for the C+ class;
large g means no errors but high rejection rate.
E(M;g)= gL(M)A(M)= g (p+p)  (p+p)
minM E(M;g)  minM {(1+g)L(M)+R(M)}
Optimization with different costs of errors
minM E(M;a) = minM {p+ a p} =
minM {p1S(M))  pr(M) + a [p1S(M))  pr(M)]}
ROC (Receiver Operating Curve):
p (p, hit(false alarm).
Fuzzification of rules
Rule Ra(x) = {xa} is fulfilled by Gx with probability:

p  Ra (Gx )  T    G  y; x, sx  dy     ( x  a) 
a
Error function is approximated by logistic function;
assuming error distribution (x)1 x)),
for s2=1.7 approximates Gauss < 3.5%
Rule Rab(x) = {b> x a} is fulfilled by Gx with
probability:
b
p  Rab (Gx )  T    G  y; x, sx  dy     ( x  a )      ( x  b) 
a
Soft trapezoids and NN
The difference between two sigmoids makes a
soft trapezoidal membership functions.
Conclusion: fuzzy logic with (x)  (x-b) m.f. is
equivalent to crisp logic + Gaussian uncertainty.
Optimization of rules
Fuzzy: large receptive fields, rough estimations.
Gx – uncertainty of inputs, small receptive fields.
Minimization of the number of errors – difficult, nongradient, but now Monte Carlo or analytical p(C|X;M).
2
1
E { X }; R, sx     p  Ci | X ; M     C ( X ), Ci  
2 X i
• Gradient optimization works for large number of parameters.
• Parameters sx are known for some features, use them as
optimization parameters for others!
• Probabilities instead of 0/1 rule outcomes.
• Vectors that were not classified by crisp rules have now nonzero probabilities.
Mushrooms
The Mushroom Guide: no simple rule for mushrooms; no rule
like: ‘leaflets three, let it be’ for Poisonous Oak and Ivy.
8124 cases, 51.8% are edible, the rest non-edible.
22 symbolic attributes, up to 12 values each, equivalent to
118 logical features, or 2118=3.1035 possible input vectors.
Odor: almond, anise, creosote, fishy, foul, musty, none,
pungent, spicy
Spore print color: black, brown, buff, chocolate, green,
orange, purple, white, yellow.
Safe rule for edible mushrooms:
odor=(almond.or.anise.or.none)  spore-print-color =  green
48 errors, 99.41% correct
This is why animals have such a good sense of smell!
What does it tell us about odor receptors?
Mushrooms rules
To eat or not to eat, this is the question! Not any more ...
A mushroom is poisonous if:
R1) odor =  (almond  anise  none);
120 errors, 98.52%
R2) spore-print-color = green
48 errors, 99.41%
R3) odor = none  stalk-surface-below-ring = scaly
 stalk-color-above-ring =  brown
8 errors, 99.90%
R4) habitat = leaves  cap-color = white
no errors!
R1 + R2 are quite stable, found even with 10% of data;
R3 and R4 may be replaced by other rules, ex:
R'3): gill-size=narrow  stalk-surface-above-ring=(silky  scaly)
R'4): gill-size=narrow  population=clustered
Only 5 of 22 attributes used! Simplest possible rules?
100% in CV tests - structure of this data is completely clear.
Recurrence of breast cancer
Institute of Oncology, University Medical Center, Ljubljana.
286 cases, 201 no (70.3%), 85 recurrence cases (29.7%)
9 symbolic features: age (9 bins), tumor-size (12 bins),
nodes involved (13 bins), degree-malignant (1,2,3), area,
radiation, menopause, node-caps.
no-recurrence,40-49,premeno,25-29,0-2,?,2, left, right_low, yes
Many systems tried, 65-78% accuracy reported. Single rule:
IF (nodes-involved  [0,2]  degree-malignant = 3 THEN
recurrence ELSE no-recurrence
77% accuracy, only trivial knowledge in the data: highly
malignant cancer involving many nodes is likely to strike back.
Neurofuzzy system
Fuzzy: mx0,1 (no/yes) replaced by a degree
mx[0,1].
Triangular, trapezoidal, Gaussian or other
membership f.
M.f-s in many
dimensions:
Feature Space Mapping (FSM) neurofuzzy system.
Neural adaptation, estimation of probability density
distribution (PDF) using single hidden layer network
(RBF-like) with nodes realizing separable functions:
G  X ; P    Gi  X i ; Pi 
i 1
FSM
Initialize using clusterization or decision trees.
Triangular & Gaussian f. for fuzzy rules.
Rectangular functions for crisp rules.
Between 9-14 rules with triangular membership functions
are created; accuracy in 10xCV tests about 96±4.5%
Similar results obtained with Gaussian functions.
Rectangular functions: simple rules are created, many nearly
equivalent descriptions of this data exist.
If proline > 929.5 then class 1 (48 cases, 45 correct
+ 2 recovered by other rules).
If color < 3.79285 then class 2 (63 cases, 60 correct)
Interesting rules, but overall accuracy is only 88±9%
Prototype-based rules
C-rules (Crisp), are a special case of F-rules (fuzzy rules).
F-rules (fuzzy rules) are a special case of P-rules (Prototype).
P-rules have the form:
IF P = arg minR D(X,R) THAN Class(X)=Class(P)
D(X,R) is a dissimilarity (distance) function, determining
decision borders around prototype P.
P-rules are easy to interpret!
IF
X=You are most similar to the P=Superman
THAN You are in the Super-league.
IF
X=You are most similar to the P=Weakling
THAN You are in the Failed-league.
“Similar” may involve different features or D(X,P).
P-rules
Euclidean distance leads to a Gaussian fuzzy membership
functions + product as T-norm.
D  X, P    d  X i , Pi   Wi  X i  Pi 
i
mP  X  e
 D X,P 
2
i
e

 d  X i , Pi 
i
 e
Wi  X i  Pi 
2
  mi  X i , Pi 
i
i
Manhattan function => m(X;P)=exp{|X-P|}
Various distance functions lead to different MF.
Ex. data-dependent distance functions, for symbolic data:


DVDM  X, Y      p  C j | X i   p  C j | Yi  
i  j



DPDF  X, Y      p  X i | C j   p  C j | Yi  
i  j

Promoters
DNA strings, 57 aminoacids, 53 + and 53 - samples
tactagcaatacgcttgcgttcggtggttaagtatgtataatgcgcgggcttgtcgt
Euclidean distance, symbolic
s =a, c, t, g replaced by
x=1, 2, 3, 4
PDF distance, symbolic s=a,
c, t, g replaced by p(s|+)
P-rules
New distance functions from info theory => interesting MF.
MF => new distance function, with local D(X,R) for each
cluster.
Crisp logic rules: use L norm:
DCh(X,P) = ||XP|| = maxi Wi |XiPi|
DCh(X,P) = const => rectangular contours.
Chebyshev distance with thresholds P
IF DCh(X,P)  P THEN C(X)=C(P)
is equivalent to a conjunctive crisp rule
IF X1[P1P/W1,P1P/W1] …XN [PN P/WN,PNP/WN]
THEN C(X)=C(P)
Decision borders
D(P,X)=const and decision borders D(P,X)=D(Q,X).
Euclidean distance from 3
prototypes, one per class.
Minkovski a=20 distance
from 3 prototypes.
P-rules for Wine
Manhattan distance:
6 prototypes kept,
4 errors, f2 removed
Chebyshev distance:
15 prototypes kept, 5
errors, f2, f8, f10 removed
Euclidean distance:
11 prototypes kept,
7 errors
Many other solutions.
Neural networks
• MLP – Multilayer Perceptrons, most popular NN models.
Use soft hyperplanes for discrimination.
Results are difficult to interpret, complex decision borders.
Prediction, approximation: infinite number of classes.
•
RBF – Radial Basis Functions.
RBF with Gaussian functions are equivalent to fuzzy
systems with Gaussian membership functions, but …
No feature selection => complex rules.
Other radial functions => not separable!
Use separable functions, not radial => FSM.
•
Many methods to convert MLP NN to logical rules.
Rules from MLPs
Why is it difficult?
Multi-layer perceptron (MLP) networks: stack many
perceptron units, performing threshold logic:
M-of-N rule: IF (M conditions of N are true) THEN ...
Problem: for N inputs number of subsets is 2N.
Exponentially growing number of possible conjunctive rules.
MLP2LN
Converts MLP neural networks into a network
performing logical operations (LN).
Input
layer
Output:
one node
per class.
Aggregation:
Linguistic units:
better features windows, filters
Rule units:
threshold logic
MLP2LN training
Constructive algorithm: add as many nodes as needed.
Optimize cost function:
1
p
p 2
E ( W)   ( F ( Xi ; W)  ti )  minimize errors +
2 p i
1
2
2
W
 ij 
i j
2
W

2
i j
2
ij
(Wij  1) 2 (Wij  1) 2
enforce zero connections +
leave only +1 and -1
weights
makes interpretation easy.
L-units
Create linguistic variables.
Numerical representation for R-nodes
Vsk=(1,1,1,...) for sk=low
Vsk=(1,1,1,...) for sk=normal
L-units: 2 thresholds as
adaptive parameters;
logistic (x), or tanh(x)[1, 1]
L( X )  S1 W1x  b   S2 W2 x  b '
Product of bi-central functions is
logical rule, used by IncNet NN.
Soft trapezoidal functions
change into rectangular filters
(Parzen windows).
4 types, depending on signs Si.
Iris example
Network after training:
iris setosa: q=1
(0,0,0;0,0,0;+1,0,0;+1,0,0)
iris versicolor: q=2
(0,0,0;0,0,0;0,+1,0;0,+1,0)
iris virginica: q=1
(0,0,0;0,0,0;0,0,+1;0,0,+1)
Rules:
If (x3=sx4=s) setosa
If (x3=mx4=m) versicolor
If (x3=l  x4=l) virginica
3 errors only (98%).
Learning dynamics
Decision regions shown every 200 training epochs in x3, x4
coordinates; borders are optimally placed with wide margins.
Thyroid screening
Clinical
findings
Garavan Institute,
Sydney, Australia
15 binary, 6 continuous
Training: 93+191+3488
Validate: 73+177+3178


Determine important
clinical factors
Calculate prob. of
each diagnosis.
Age
sex
…
…
Hidden
units
Final
diagnoses
Normal
Hypothyroid
TSH
T4U
T3
TT4
TBG
Hyperthyroid
Thyroid – some results.
Accuracy of diagnoses obtained with several
systems – rules are accurate.
Method
Rules/Features Training % Test %
MLP2LN optimized
4/6
99.9
99.36
CART/SSV Decision Trees
3/5
99.8
99.33
Best Backprop MLP
-/21
100
98.5
Naïve Bayes
-/-
97.0
96.1
k-nearest neighbors
-/-
-
93.8
Psychometry
Use CI to find knowledge, create Expert System.
MMPI (Minnesota Multiphasic Personality
Inventory) psychometric test.
Printed forms are scanned or computerized
version of the test is used.
• Raw data: 550 questions, ex:
I am getting tired quickly: Yes - Don’t know - No
• Results are combined into 10 clinical scales and 4
validity scales using fixed coefficients.
• Each scale measures tendencies towards
hypochondria, schizophrenia, psychopathic
deviations, depression, hysteria, paranoia etc.
Psychometry: goal
• There is no simple correlation between single
values and final diagnosis.
• Results are displayed in form of a histogram,
called ‘a psychogram’. Interpretation depends
on the experience and skill of an expert, takes
into account correlations between peaks.
Goal: an expert system providing evaluation and
interpretation of MMPI tests at an expert level.
Problem: agreement between experts only about
70% of the time; alternative diagnosis and
personality changes over time are important.
Psychometric data
1600 cases for woman, same number for men.
27 classes:
norm, psychopathic, schizophrenia, paranoia,
neurosis, mania, simulation, alcoholism, drug
addiction, criminal tendencies, abnormal
behavior due to ...
Extraction of logical rules: 14 scales = features.
Define linguistic variables and use FSM,
MLP2LN, SSV - giving about 2-3 rules/class.
Psychometric results
Method
Data
N. rules
Accuracy
+Gx%
C 4.5
♀
55
93.0
93.7
♂
61
92.5
93.1
♀
69
95.4
97.6
♂
98
95.9
96.9
FSM
10-CV for FSM is 82-85%, for C4.5 is 79-84%.
Input uncertainty +Gx around 1.5% (best ROC)
improves FSM results to 90-92%.
Psychometric Expert
Probabilities for different classes.
For greater uncertainties more
classes are predicted.
Fitting the rules to the conditions:
typically 3-5 conditions per rule,
Gaussian distributions around
measured values that fall into the
rule interval are shown in green.
Verbal interpretation of each case,
rule and scale dependent.
Visualization
Probability of classes versus
input uncertainty.
Detailed input probabilities
around the measured values
vs. change in the single scale;
changes over time define
‘patients trajectory’.
Interactive multidimensional
scaling: zooming on the new
case to inspect its similarity to
other cases.
Summary
Computational intelligence methods: neural, decision trees,
similarity-based & other, help to understand the data.
Understanding data: achieved by rules, prototypes,
visualization.
Small is beautiful => simple is the best!
Simplest possible, but not simpler - regularization of models;
accurate but not too accurate - handling of uncertainty;
high confidence, but not paranoid - rejecting some cases.
• Challenges:
hierarchical systems,
discovery of theories rather than data models,
integration with image/signal analysis,
reasoning in complex domains/objects, applications in
bioinformatics, text analysis ...
References
We are slowly getting there. All this and more is
included in the Ghostminer, data mining software
(in collaboration with Fujitsu) just released …
http://www.fqspl.com.pl/ghostminer/
Many papers, comparison of results for numerous
datasets are kept at:
http://www.phys.uni.torun.pl/kmk
See also my homepage at:
http://www.phys.uni.torun.pl/~duch
for this and other presentations and some papers.