Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Improved Fluoropyrimidine Chemotherapy William H. Gmeiner, Ph.D. Professor and Chairman Department of Biochemistry, WFUSM Colon Cancer: 2nd Leading Cause of Cancer Deaths in U.S. 56,000 deaths in U.S. each year Highly treatable if detected early Poor prognosis if diagnosed at late stages Treatment: Surgery, Radiation and/or Chemotherapy Most frequently used chemotherapy: 5-Fluorouracil + Leucovorin (5FU/LV) Web Sites For Reliable Information About Cancer National Cancer Institute (www.cancer.gov) American Cancer Society (www.cancer.org) American Institute of Cancer Research (www.aicr.org) Wake Forest University Cancer Center (www.wfubmc.edu/cancer) Cancer Drug Development Identify Molecular Target: Must Differ Between Malignant and non-Malignant Cells (e.g. involved in cell division). Determine which types of tumor are most sensitive Cell culture studies to investigate mechanism of action Animal studies to demonstrate efficacy in vivo and to determine PK and PD profile. Clinical studies: Phase I – Safety; Phase II – Optimal Dose; Phase III – Efficacy. 5FUra - A Clinically Useful Anticancer Drug For More Than 40 Years O F HN O N H Widespread Clinical Experience Active Against Many Solid Tumors Among the Most Effective Drugs Dose-Limiting Toxicities Rarely Curative New Strategies Required Malignant and Non-Malignant Cells Often Differ in Cell Division Malignant Cells Non-Malignant Cells The Cell Cycle: Identifying Drug Targets Fluoropyrimidines Ara-C, Hydroxyurea DNA Synthesis S Pre-Mitotic Interval G2 Mitosis G1 M Preparation for Cell Division Vincrisitine, Vinblastine G0 Resting Phase TS & RR Are Targets For S-Phase Blocking Anticancer Drugs G1 S-Phase O F HN O O OH P -O O F H H O HO H HH N H N O NH O FdUMP TS DNA G2 dUMP dTMP ADP ADP GDP dUDP GDP RR CDP CDP UDP O HOHN Hydroxyurea NH2 Toxicities Associated With 5-FU GI-Tract Toxicity O F HN O FUTP N H 5-FU Cardio- & Neurotoxicity FBAL RNA FdUMP[N] Serves As A ProDrug of FdUMP Recursion Applied to Factorials recursion n. 1 the act of returning. 2 (Math) the repeated application of a mathematical procedure to a 10! = 10(9!) However, 9 factorial is 9 times 8 factorial: 9! = 9(8!) preceding result to generate a sequence of values. Using the recursive concept: 8! = 8(7!) 7! = 7(6!) 6! = 6(5!) 5! = 5(4!) 4! = 4(3!) 3! = 3(2!) 2! = 2(1) ((((( ))))) 10! = 10 9 8 7 6 5(4(3(2(1)))) Important Initial Questions About FdUMP[10] Does it work? (i.e. is FdUMP[10] either cytotoxic or cytostatic?). Is there selectivity for certain malignancies? Is it safe? (i.e. can FdUMP[10] be used in vivo?) Is it efficacious? (i.e. can FdUMP[10] inhibit growth of a human tumor?) Does FdUMP[10] Work? GI50 Values and Relative Potency in the NCI 60 Cell Line Screen Drug IC50 Relative 5FU 2.4 x 10-5 1 FdU 1.8 x 10-6 13.3 FdUMP[10] 7.1 x 10-8 338.0 Is FdUMP[10] Selective For Certain Malignancies? Ovarian, NSCLC Cell Line FdUMP[10] 5FU 1.00 x 10-8 3.98 x 10-6 5.01 x 10-7 6.31 x 10-6 COLO205 1.25 x 10-7 6.31 x 10-6 SW620 5.01 x 10-5 2.51 x 10-5 especially sensitive to FdUMP[10] HCT116 Colorectal less sensitive to HT29 FdUMP[10] FdUMP[10] Efficiently Inhibits TS in HT29 Colon Cancer Cells 24 h 48 h 72 h 5FU (4 x10-6) 5.3% 11.5% 23.4% FdUMP[10] (4 x 10-8) 0.01% 2.2% 14.2% Inhibition of TS by FdUMP[10] Results in DNA Damage -O 3'-OH H HO H H H H O N O N H O -O P O H H H F O O -O H N H H F O O H O -O N H O H O N O H F N H O -O H H OH H O H F N O H O N O O P OH H H H O H F O P O H H N O O P O H H H O N O O P O H N H O O N H FdUMP[6] O OH P -O DSBs O H H O HO H HH N O NH O FdUMP TS replication DNA F dUMP dTMP 5'-OH OH F O COMET Assay of HT29 Cells FdUMP[10] Causes Substantially Greater DNA Damage Than 5FU A FdUMP[10] 1 x 10-7 M B 5FU 1 x 10-6 M FdUMP[10] Causes S-Phase Arrest of HT29 Cells Fluoropyrimidines Ara-C, Hydroxyurea DNA Synthesis S Pre-Mitotic Interval G2 Mitosis G1 M Preparation for Cell Division Vincrisitine, Vinblastine G0 Resting Phase FdUMP[10] Inhibits Proliferation and Induces Apoptosis Apoptotic and Proliferative Activity From 40 HT29 Cells Experiment Control 5FU 4 x 10-6 M FdUMP[10] 4 x 10-8 M Apoptotic activity 0 apoptotic events 3 apoptotic events 20 apoptotic events Proliferation 111 cell divisions 20 cell divisions 2 cell divisions Is FdUMP[10] Safe? MTD for FdUMP[10] > 200 mg/kg/dose MTD for 5-FU ~ 40 mg/kg/dose FdUMP[10] Inhibits Growth of Human Tumor Xenografts Tumor Size (mm3) 1600 Control 5-FU FdUMP10 FdUMP10 + 5-FU 1200 800 400 0 0 7 14 21 28 35 42 Days After Tumor Inoculation 49 56 FdUMP[10] Causes Less Damage to GI-Tract Than 5FU Control FdUMP[10] 5FU FdUMP[10] + 5FU Pre-Clinical Studies With FdUMP[10]: Current Research Objectives Maximize cellular uptake and target specifically to tumor cells. Validate TS-Inhibition and DNA Damage as Mechanisms Responsible For Activity. Determine the Pathway Responsible For Apoptotic Cell Death Demonstrate Efficacy Towards TSOverexpressing, 5FU-Resistant Tumors. Establishing the Link Between TS Inhibition and DNA Damage TS Inhibition Results in Elevated dUTP/dTTP Ratios dUTP Misincorporation Initiates Futile Cycles of DNA Repair (UDG; BER) Direct FdUTP Misincorporation May Also Be Important Involvement of Topoisomerase I? Top I Regulates Topological State of DNA For Transcription & Replication Circular DNA is supercoiled for compaction Supercoils relieved for access, regenerated for compaction Top1 Breaks One Strand, Passes Intact Strand Through Break Alters Linking Number by +/- 1 Topoisomerase I: Target for Nucleoside Analogs? Top1 is the cellular target for camptothecins (CPTs). CPTs Stabilize Top1 Cleavage Complexes DNA Damage Occurs When Stabilized Cleavage Complexes Interact With Replication or Transcription Apparatus Do Nucleoside Analogs Affect the Stability of Top1 Cleavage Complexes? AraC and dFdC: 2’-Deoxycytidine Analogs with Distinct Mechanisms and Spectrums of Activity NH2 N O5' H2' H3' N N N OH O N O5' O O5' N H3' H3' O O O H2'' H2'' O3' NH2 NH2 O3' F O3' F O Nucleoside Analogs Inhibit Key Enzymes And Are Incorporated Into DNA FdUMP dFdCDP UDP CDP GDP ADP RR TS dUDP dCDP dGDP dADP dUMP dTMP dTTP dCTP dGTP dATP S-Phase AraCTP dFdCTP FdUTP Fluoropyrimidines Ara-C, Hydroxyurea DNA Synthesis DNA S Pre-Mitotic Interval Polymerase Pausing G2 Mitosis G1 M Preparation for Cell Division Vincrisitine, Vinblastine G0 Resting Phase Top1 Inhibition Relevance of Top1 Inhibition For Efficacy of dFdC, AraC Top1 Cleavage Complexes Detected in Human Leukemia CEM Cells Treated With dFdC, AraC P388/CPT45 Top1-Deficient Cells 5-fold resistant to dFdC, 7-10 fold resistant to AraC Induction of Top1 Cleavage Complexes In Vitro 37mer 14mer 23mer 5' - GATCTAAAAGACTTGGAAAAATTTTTAAAAAAGATCA* 3' - CTAGATTTTCTGAACCTTTTTAAAAATTTTTTCTAGT +1 +2 A – DNA alone B - top1 C - top1, CPT Site-Specific Effects of AraC and dFdC on Top1 Cleavage 4-6 Fold Enhancement of Top1 Cleavage Complexes When AraC in +1 Position AraC Enhancement Primarily Due to Inhibition of Top1-Mediated DNA Religation 5-7 Fold Enhancement of Top1 Cleavage Complexes When dFdC in +1 Position dFdC Enhances Formation of Top1 Cleavage Complexes dFdC Induced One New Top1 Cleavage Site Observed In Presence of CPT Structure of Top1 Cleavage Complex With AraC in +1 Position of the NonScissile Strand RO OP O O -1 OH O Top1 N N O NH2 +1 N OR P O -O N HN OH OP O O NH2 O O O H3' O NH2 H2'' N O N N H3' O H2'' O3' -O P O OR -1 O H2' O5' N HN N O3' -O P OP O O N O5' O +1 OR Structural Basis For Effects of AraC and dFdC On Top1 Cleavage NMR Structures of AraC- and dFdCSubstituted Model Okazaki Fragments NMR Studies of 31mer DNA Hairpin Containing a Single Top1 Cleavage Site Preparation of 31mer DNA Hairpin With dFdC and AraC Substitution AraC-, dFdC-Substituted Model Okazaki Fragments NMR Structures of dFdC-, and AraCSubstituted Model Okazaki Fragments AraC-, dFdC-Substitution Destabilizes Duplex Structure [OKA] Tm 46.8 oC [AraC] Tm 42.4 oC [GEM] Tm 41.2 oC AraC Sugar Pucker Differs From dC in Model Okazaki Fragment P ~ 110o P ~ 160o AraC Sugar Pucker Disrupts Base Stacking in Adjacent Strand Structural Effects of AraC: Implications For Top1 Cleavage AraC Adopts C2’-endo Sugar Pucker Stereoelectronic Effects Cause Arabinosyl Sugar to be More Rigid Than 2’Deoxyribose Rigidity of Arabinosyl Sugar May Inhibit Religation of Top1 Cleavage Complexes dFdC Adopts C3’-endo Sugar Pucker With Altered Electrostatic Surface Relative to dC P ~ 30o P ~ 110o Electrostatic Surface of dFdC and dC in [GEM] and [OKA] Structural Effects of dFdC: Implications For Top1 Cleavage dFdC Adopts C3’-endo sugar pucker with altered electrostatic surface relative to dC Electronegativity of Fluorines in dFdC may contribute to Enhanced Formation of Top1 Cleavage Complexes Relative Flexibility of dFdC Allows Facile Re-Ligation to Occur Top1: Target for FdUMP[10]? Conclusions FdUMP[10] Is a Prototype of a New Fluoropyrimidine That Is Safer and More Effective Than 5FU FdUMP[10] Blocks HT29 Cells in S-Phase and Causes DNA Damage Top1 May Be Involved in Mediating Damage Resulting From FdUMP[10] Exposure Acknowledgements Current Group: Cui Wei, Xi-an Mao, Debbie Boles. Former Group: Jinqian Liu, Changnian Liu, Parag Sahasrabudhe. Top1: Yves Pommier (NCI); Phillipe Pourquier (Bordeaux). Structural Biology: Tom James (UCSF); Dave Konerding UCSF. Funding: WFUSM; CCCWFU