Download v13a1234-lu pgmkr - Molecular Vision

Molecular Vision 2007; 13:2066-72 <http://www.molvis.org/molvis/v13/a234/>
Received 29 July 2007 | Accepted 26 October 2007 | Published 3 November 2007
©2007 Molecular Vision
Expression of melanin-related genes in cultured adult human
retinal pigment epithelium and uveal melanoma cells
Fan Lu,1,2 Dongsheng Yan,1,2 Xiangtian Zhou,1,2 Dan-Ning Hu,3,4 Jia Qu 1,2
1
Eye Hospital, School of Ophthalmology and Optometry, Wenzhou Medical College, Wenzhou, China; 2Key Laboratory of Vision
Science, Ministry of Health P. R. China, Wenzhou, China; 3Myopia Research Institute, Wenzhou Medical College, Wenzhou, China;
4
Tissue Culture Center, The New York Eye and Ear Infirmary, New York Medical College, New York
Purpose: Controversy exists over melanogenesis of adult human RPE cells in vitro. This study investigated melanin
content and production and expression of tyrosinase (TYR), tyrosinase-related-protein-1 (TRP1), tyrosinase-related-protein-2 (TRP2), and P gene in cultured human RPE cells and uveal melanoma cells.
Methods: RPE cells were isolated and cultured from three adult donor eyes. A continuous human uveal melanoma cell
line was established from primary choroidal melanoma. Melanin content and production were measured, and the expression of TYR, TRP1, TRP2, and P gene at the mRNA and protein levels were detected by RT-PCR and western blot,
respectively.
Results: Melanin content per cell of cultured RPE decreased rapidly and in proportion to cell division. No melanin
production could be demonstrated in any passages. In cultured RPE cells, mRNA expression of TYR, TRP1, TRP2, and Pgene and protein expression of TYR, TRP1, and TRP2 could not be detected. In uveal melanoma cells, melanin content
per cell remained stable, and melanin production could be detected in each passage. Expression of mRNA of TYR, TRP1,
TRP2, and P-gene and protein of TYR, TRP1, and TRP2 could be detected in melanoma cells.
Conclusions: Human RPE cells under standard culture circumstances do not produce melanin and do not express the four
key genes required in melanin biosynthesis pathway. In contrast, human uveal melanoma cells produce melanin and
express all of these melanogenic genes in vitro.
Melanin can be found in various types of pigment cells
in the skin, eye, and other tissues. In the eye, there are two
different types of pigment cells: the pigment epithelium originated from neural ectoderm and uveal melanocytes from neural crest. Both pigment epithelium and uveal melanocytes produce and store melanin in the melanosomes.
Young, unbleached melanin is an antioxidant, a free radical scavenger and has an affinity for various chemical substances [1-4]. Young melanin in the retinal pigment epithelium (RPE) filters toxic substances from the choroid and protects the retina from oxidative and chemical stress [5-7]. Aging processes in the RPE may diminish the protective properties of melanin [8,9]. In turn, this may lead to damage of the
retina, initiating various ocular diseases, including age-related
macular degeneration [10-12].
Studies on epidermal melanocytes found that there are at
least two different types of melanin: eumelanin, which is a
black or brown color, and pheomelanin, which is a yellow to
reddish color. Melanins in the RPE are mainly eumelanin [13].
Enzymes involved in eumelanin biosynthesis include tyrosinase, tyrosinase-related-protein-1 (TRP1) and tyrosinase-related-protein-2 (TRP2) [14]. In addition to the tyrosinase family, pink-eyed dilution locus in mice also plays an important
Correspondence to: Dan-Ning Hu, Myopia Research Institute,
Wenzhou Medical College, Wenzhou, China; and Tissue Culture
Center, The New York Eye and Ear Infirmary, New York Medical
College, New York, NY; Phone: (212) 979-4148; FAX: (212) 6771284; email: [email protected]
2066
role in melanin biosynthesis. It has been reported that most
eye color variations in Europeans are due to polymorphism in
the P gene, which is the human homolog of pink-eyed dilution locus [15,16].
All of these genes and gene products have been discovered from studies in epidermal melanocytes and cutaneous
melanoma cells. Little is known about the expression of these
genes in ocular pigment cells [17-20]. Human RPE cells contain a large amount of melanin, which is produced mainly
during the prenatal period. There is controversy over the melanogenic activity of adult human RPE cells. Although a number of authors have said adult human RPE cells do not produce melanin in vitro under standard culture circumstances,
there has yet to be published quantitative studies on melanin
content and production in cultured human RPE cells [2,10,2123]. In addition, the expression of P gene in cultured RPE
cells as well as the expression of tyrosinase, TRP-1, and TRP2 key genes involved in melanin biosynthesis in cultured human RPE cells has not been studied thoroughly [17-19].
While the expression of the tyrosinase gene family has
been systematically studied in cutaneous melanoma cell lines,
but not in human uveal melanoma cell lines, a few studies
have indicated these cells perhaps likely produce melanin and
possess tyrosinase activity in vitro [24-28].
The present study examined the expression of tyrosinase,
TRP-1, TRP-2, and P gene in melanin biosynthesis in cultured adult human RPE cells and human uveal melanoma cell
lines. RT-PCR and western blotting analysis was combined
Molecular Vision 2007; 13:2066-72 <http://www.molvis.org/molvis/v13/a234/>
©2007 Molecular Vision
with melanin content measurement and melanin production
studies to obtain a more precise clarification of melanogenesis in these two different ocular pigment cells.
METHODS
Tissue source: This study was approved by the Ethics Committee of Wenzhou Medical College, and it complied with the
tenets of the Declaration of Helsinki for Research Involving
Human Tissue. Three adult human eyes were obtained from
the Wenzhou Eye Bank. All donors age 23-28 were free of
ocular diseases. Prior to their death, donors had signed informed consent in regard to the voluntary donation of eyeballs for organ transplantation and medical research.
Cell culture: Donor eyeballs were enucleated within 4 h
after death and were used immediately for cell culture once
corneas were removed for corneal transplantation. RPE were
isolated and cultured as follows [2]. A circumferential incision was made in the sclera of the donor eye 8 mm behind the
limbus. The posterior segment, including the vitreous, retina,
choroid and the posterior sclera was placed in a culture dish.
The vitreous and the retina were excised under a dissecting
microscope. RPE were immersed in a trypsin (0.05%)-EDTA
(0.02%) solution (Sigma, St. Louis, MO) at 37 °C for 1 h.
Culture medium with 10% serum was added and the RPE were
isolated and collected with a fire-blown Pasteur pipette under
direct observation using a dissecting microscope. Isolated cells
were centrifuged, re-suspended and seeded to a culture flask.
The culture medium used for culturing the RPE was Nutrient
Mixture Ham’s F12 medium supplement with 10% fetal bovine serum (FBS), 2 mM glutamine and 50 µg/ml gentamicin
(Invitrogen, Carsbad, CA). Cells were cultured in a humidified, CO2-regulated incubator (95% air/5% CO2) atmosphere.
The culture medium was changed three times a week. Once
cells reached confluence, they were detached from the culture
dish using the trypsin-EDTA solution. The cell suspension was
diluted at 1:3 and seeded into culture flasks for subculture [2].
Cell lines of passages three to five were used in the studies.
Uveal melanoma cell line SP6.5 was supplied by Dr. G.
Pelletier (Research Center of Immunology, Quebec, Canada).
This cell line was isolated from a choroidal melanoma patient
(melanotic melanoma) and was tumorigenic to immune-nude
mice [29]. This cell line were cultured for 20 generations in
Canada, and have been subsequently cultured in Dulbecco’s
Modified Eagle Medium (Invitrogen, Carsbad, CA) with 10%
FBS in New York Eye and Ear Infirmary laboratory. This cell
line has been cultured in New York Eye and Ear Infirmary
laboratory for more than 5 years, having been passaged for
over 200 generations with more than 300 divisions, indicating
this is a continuous cell line.
Measurement of melanin content and production: Melanin content per cell and melanin production were measured as
follows [20]. Cultured RPE or melanoma cells were detached
by trypsin-EDTA solution from the culture flask and counted
in a hemocytometer. Cell suspensions were centrifuged, and
the pellet was dissolved in 1 N NaOH. Melanin concentration
of the NaOH-melanin solution was determined by measurement of optic density at 475 nm by a spectrophotometer and
compared with a standard conversion curve (with reading as
the vertical axis and melanin content as the horizontal axis)
obtained using melanin from septa (Sigma, St. Louis, MO).
Melanin content was expressed as ng/cell [20].
Melanin production was calculated by determining the
melanin content and the cell counts at the beginning and the
end of each generation by the following formula:
Cp=CtP-Co/1.3 D(P-1)
where Co and Ct represent the melanin content per cell at
times 0 and time t, respectively; P is the population increase
during time t, D is the doubling time of the UM; and Cp is
melanin production per cell per day during time t [20].
Reverse transcription polymerase chain reaction: Total
RNA was extracted from both RPE cells (at third to fifth passages) and melanoma cells with Trizol reagent (Invitrogen)
and confirmed using spectrophotometry and formaldehyde/
agarose gel electrophoresis. Contaminated genomic DNA, was
removed by treating total RNA with 2.5 U RNAse-free
DNAase I (Invitrogen) at 37 °C for 30 min and then heating
with 4 mM EDTA at 65 °C for 10 min. The reverse transcription step was performed at 42 °C for 60 min in 20 µl solution
containing 5 µg DNAse-treated RNA, 50 mM Tris-HCl (pH
8.3), 75 mM KCl, 3 mM MgCl2, 5 mM dithiothreitol, 20 U of
RNAse inhibitor, 0.5 µg oligo(dT) [12-18], 0.5 mM dATP, 0.5
mM dCTP, 0.5 mM dGTP, 0.5 mM dTTP, and 200 U RNAse
H-free reverse transcriptase (Invitrogen).
Specific primers were designed based on published nucleotide sequences for tyrosinase, TYRP1, TYRP 2, and P gene
(Table 1) [30,31]. PCR was performed in a 50 µl solution containing 2 µl of RT reaction products, 20 mM Tris-HCl (pH
8.4), 50 mM KCl, 1.5 mM MgCl2, 0.2 mM dATP, 0.2 mM
dCTP, 0.2 mM dGTP, 0.2 mM dTTP, 0.2 µM of upstream
primer, 0.2 µM of downstream primer, and 2.5 U Taq DNA
polymerase. The PCR product were electrophoresed on 1.5%
agarose gels, which contained 1 µg/ml ethidium bromide, and
then photographed under ultra-violet illumination. Product
lenght was estimated using a standard 250 bp DNA ladder as
a size marker. Each PCR product was identified by DNA sequencing.
Western blot analysis: The RPE cells at third fifth passages and melanoma cells were harvested under centrifugation. Cells were boiled in a sample buffer that contained 50
mM Tris-HCl, (pH 6.8), 10% glycerol, 2% SDS, 0.1 M
TABLE 1. SEQUENCES OF THE PRIMERS FOR THE TARGET GENES
Gene
---------Tyrosinase
Primer name and sequence
(5'-3')
-----------------------F: TTGGCAGATTGTCTGTAGCC
R: AGGCATTGTGCATGCTGCTT
Size of
PCR product
-----------
GenBank database
----------------
438 bp
X15264
TYRP1
F: GGAAAATGCCCCTATTGGAC
R: AAAGGGTCTTCCCAGCTTTG
496 bp
U29589
TYRP 2
F: GATCACCACACAACACTGGC
R: AGAGTCGGATCGTCTGGTCT
430 bp
X15265
F: TCCTACACCTGGGACTTTGG
R: GTGGTCTCCACCCACTCTGT
397 bp
M80333
P gene
2067
Primers used to direct RT-PCR amplification of human tyrosinase,
TYRP1, TYRP 2 and P gene.
Molecular Vision 2007; 13:2066-72 <http://www.molvis.org/molvis/v13/a234/>
©2007 Molecular Vision
dithiothreitol, 0.001% bromphenol blue, 2 mM EDTA along
with a protease inhibitor cocktail (Roche Molecular
Biochemicals, Mannheim, Germany). Cell lysates were quantified with Bio-Rad Protein Assay kit (Bio-Rad Lab., Hercules,
CA) using bovine serum albumin as the standard. Next, 30 µg
of the lysates were loaded in each lane of 12% SDS- polyacrylamide gels, transferred to a polyvinylidene difluoride
membrane (Amersham Life Science, Arlington Heights, IL)
for electrophoresis and then blocked overnight in 5% fat-free
dry milk, 0.1% Tween 20, 150 mM NaCl, and 50 mM Tris
(pH 7.5). Three antibodies, anti-tyrosinase, anti-TYRP1 and
anti-TYRP 2 antibodies (Santa Cruz Biotechnology, Santa
Cruz, CA), were used in western blot. The specificity of the
antibodies had been confirmed by the manufacturer using
preabsorption control. Blots were incubated with primary antibodies diluted at 1:500 in tris-buffered saline with Tween for
2 h at room temperature and then incubated with horseradish
peroxidase-conjugated goat anti-rabbit IgG antibodies (diluted
at 1:3000). The target proteins were detected using enhanced
chemiluminescence.
during 15 consecutive passages (Figure 2).
mRNA expression of tyrosinase, TYRP1, TYRP2, and P
gene: Results of the RT-PCR analysis of total RNA isolated
from RPE and melanma cell lines of human eyes are shown in
Figure 3. mRNA expression of tyrosinase, TYRP1, TYRP2,
and P gene were present in uveal melanoma cells, and the size
of the products amplified by the PCR primers matched the
predicted size of the individual gene (Figure 3). All PCR products were further confirmed by DNA sequencing. None of these
four genes were detected in RPE cells.
Presence of the proteins of tyrosinase, TYRP1, and
TYRP2: Western blot analysis indicated clearly that there was
no expression of tyrosinase, TYRP1, and TYRP2 in RPE when
compared with melanoma cells (Figure 4). These three proteins were expressed strongly in melanoma cells. Western blot
of P protein was not performed due to the lack of availability
of a P protein antibody.
RESULTS
Melanin content and melanin production: Cultured RPE cells
grew well with a doubling time of 48-60 h. Melanin content
per cell decreased rapidly and in proportion to cell division in
the first eight passages (Figure 1). No melanin production could
be demonstrated in any passages (from primary culture to
eighth subculture).
In contrast to RPE cells, melanin content per cell in uveal
melanoma cells remained stable despite the dilutional effect
of cell division (Figure 2). Melanin content of cultured uveal
melanoma cells during 15 consecutive passages varied from
0.0173 to 0.0204 ng/cell (0.0186±0.0011 ng/cell, mean±SD).
Melanin production could be detected in cultured melanoma cells in each passage. Melanin production also remained
stabilized and was 0.00516±0.00037 ng/cell/day (mean±SD)
DISCUSSION
At the time of birth, humans have a substantial amount of
melanin in their RPE cells. Melanogenesis occurs in the RPE
early in the fetus, with immature melanosomes visible as early
as seven weeks of gestation. Between the eighth and 14th week
of gestation, melanosomes at all stages of maturation can be
observed. Within a few weeks, melanin production ceases.
Polymerization of melanin continues to occur in melanosomes
until humans reach approximately two years old, when the
RPE contains only mature melanosomes [10]. There is controversy over melanogenesis of RPE after birth [32]. Very little
or no tyrosinase activity could be detected in adult bovine RPE
cells [33,34]. Melanin content of RPE decreases significantly
in aged eyes [3-5]. Therefore, melanin biosynthesis is either
absent in adult human RPE cells or occurs only at a slow rate.
In the RPE, eumelanin is the main type of melanin [13].
Enzymes and proteins involved in eumelanin biosynthesis include tyrosinase, TRP-1, TRP-2, and P protein.
Figure 1. Cell division and melanin content of cultured human retinal pigment epithelium cells. Melanin content (ng/cell) and reciprocal of cell numbers were measured after a specific number of cell
divisions in a cultured adult human retinal pigment epithelium cell
line from first to eighth passages. The results are expressed as the
percentage of numbers in the primary cultures (logarithm).
Figure 2. Melanin content and production of cultured human uveal
melanoma cells. Melanin content (Mc, ng/cell) and melanin production (MP, ng/cell per day) were measured in cultured human uveal
melanoma cells in 15 consecutive passages.
2068
Molecular Vision 2007; 13:2066-72 <http://www.molvis.org/molvis/v13/a234/>
Tyrosinase locus (TRP) maps to human chromosome
11q14-21. Tyrosinase gene codes tyrosinase, which is a rate
limiting enzyme in melanin synthesis. Tyrosinase is able to
catalyze the oxylation of tyrosine to dopaquinone directly [35].
Mutation in the TRP gene has been found to be associated
with oculocutaneous albinism type 1 [14]. TRP1 maps to human chromosome 9p23 and encodes 5,6-dihydroxyindole-2carboxylic acid (DHICA) oxidase, which promotes the DHICA
oxidization and finally converts to eumelanin in murine but
not in human melanocytes. It is thought that the main function
of TRP1 in humans is to stabilize and to maintain tyrosinase
protein levels [36,37]. Mutation in the TRP1 gene has been
associated with oculocutaneous albinism type 3 [14]. TRP2
gene maps to human chromosome 13q32 and codes for an
enzyme TRP2 with dopachrome tautomerase activity, which
catalyzes the conversion of dopachrome to DHICA. Mutation
of TRP2 in mice results in a dilution of the coat color and
slightly yellowish ear (slaty mice). At present, there has been
no reported mutation of the human TRP2 gene.
The pink-eyed dilution locus and its human homolog, P
(maps to human chromosome 15q11.2-q12), encodes a protein of 110 kDa with 12 membrane-spanning domains localized to the melanosome membrane. The P protein is required
for normal melanin (primarily eumelanin) biosynthesis. Mutation in the human P gene is associated with oculocutaneous
albinism type 2 [14,38,39]. Most normal variations in eyecolor in Europeans are due to polymorphism of the P gene
[15,16].
Adult human RPE cells do not produce melanin in vitro
under ordinary culture circumstances [2,10,17,21-23]. Methodology for the measurement of melanin content and production of ocular melanocytes was established ten years ago [20].
However, measurement of melanin content of RPE cells in
©2007 Molecular Vision
consecutive generations and quantitative study of production
of melanin by cultured RPE cells have not been reported previously. The expression of the tyrosinase gene family in cultured adult human RPE cells has not been studied thoroughly.
Abe et al. reported that tyrosinase and TRP1 mRNA could not
be detected in established adult human RPE cells in vitro.
However, Abe et al. did not study the protein expression of
these two enzymes and the expression of TRP2 [18,19]. SmithThomas et al. reported that protein of TRP1 and TRP2 could
not be detected in cultured human RPE cells, but they used
only the non-quantitative immunostaining method in their studies [17]. The expression of the P gene, which is the main factor determining most human eye-color variation, has never
been reported.
It is not sufficient to verify the presence of a specific gene
in cells using a single method, because each method has its
own limitation. Therefore, this study was designed to detect
the presence of a group of key genes related to melanogenesis
in cultured human RPE cells at mRNA and protein levels by
standard molecular biology methods. Quantitative study of
melanin content and production in these cells over many consecutive generations were measured and calculated to reveal
melanogenic activity of adult human RPE cells in vitro.
In the present study, melanin content per cell in cultured
RPE cells decreased rapidly and in proportion to cell division.
No melanin production could be demonstrated in vitro. RTPCR showed that there was no mRNA expression of tyrosinase, TRP1, TRP2 and P-genes in cultured adult human RPE
cells. Western blot analysis demonstrated the absence of the
proteins of tyrosinase, TRP1 and TRP2 in these cells. In contrast to the RPE cells, the mRNA and proteins of these genes
could be detected in uveal melanoma cells by RT-PCR and
western-blot analysis.
Our study showed no melanin biosynthesis activity could
be detected in cultured human RPE cells under standard culture circumstances. Therefore, cultured RPE cells are not adequate for studying melanogenesis of RPE or for performing
experiments requiring pigmented RPE cells. Several authors
reported cultured adult human RPE may produce melanin
under special circumstances or induced by certain stimulators
[40-45]. Dorey observed, several weeks after cultured RPE
cells attained confluence, the appearance of brown foci that
might indicate melanogenesis occurred in cultured RPE cells.
Figure 3. Reverse transcriptase-polymerase chain reaction study of
expression of various melanin related genes in cultured RPE and uveal
melanoma cells. Reverse transcriptase-polymerase chain reaction
products of tyrosinase, TYRP1, TYRP 2, and P gene in cultured retiFigure 4. Western blot analysis of various melanin related proteins in
nal pigment epithelium cells and uveal melanoma cells were detected
cultured RPE and uveal melanoma cells. Three melanin related proon agarose gels with a standard 250 bp DNA ladder as a reference for
teins were measured in cultured RPE by antibodies specific to tyrosizes (left). The four reverse transcriptase-polymerase chain reaction
sinase, TYRP1, and TYRP2. The same experiment was performed in
products products can be detected in melanoma cell line but not in
uveal melanoma cells using the same antibodies as a positive conretinal pigment epithelium cells.
trol.
2069
Molecular Vision 2007; 13:2066-72 <http://www.molvis.org/molvis/v13/a234/>
©2007 Molecular Vision
However, porcine RPE cells were used in this experiment [44].
Pfeffer reported that human and monkey RPE cells maintained
as a stable monolayer in medium containing elevated Ca++ will
undergo gradual melanization [42]. On the contrary, Rak reported that adult human RPE cells cultured with Ca++-switch
method (low Ca++) expressed tyrosinase and produced melanin [43]. Champochiaro found when human RPE cells were
cultured on a special extracellular matrix surface produced by
bovine corneal endothelial cells, they might produce melanin
[41]. None of these results have been replicated by the other
researchers. If these results could be documented by a quantitative study on melanin production combined with a study on
the expression of various enzymes relevant to melanogenesis,
they may provide the in vitro models for studying melanogenesis of human RPE cells and could be used for various experiments that require pigmented RPE cells.
The expression of tyrosinase family genes in cutaneous
melanomas depends on the types of melanoma. Melanotic tumors express tyrosinase, TRP1, and TRP2. In contrast, the
amelanotic tumors lack detectable levels of one or more of
these proteins. Tyrosinase was most often deficient in
amelanotic tumors, whereas TRP2 was most often persistently
expressed [46].
Little is known about melanogenesis of uveal melanoma
cells. Several immortal human uveal melanoma cell lines (most
of them are melanotic tumors) have been established. Cells
contain melanin granules and premelanosomes after numerous divisions, indicating that these cells produce melanin in
vitro [24,25]. However, no quantitative studies on melanin
content and melanin production in human uveal melanoma
cells in vitro have been reported. Immunocytochemical studies on pathological slides of uveal melanoma found the presence of tyrosinase and TRP1 [27,28]. Several human uveal
melanoma cell lines show tyrosinase activity in vitro [26].
However, there has yet to be published a systemic study on
the expression of tyrosinase gene family and P gene.
In the present study, a cultured human uveal melanoma
cell line (melanotic tumors) maintained a consistent level of
melanin/cell and produced a detectable amount of melanin,
indicating that these cells still possess melanogenic activity in
vitro. RT-PCR and western blot analysis was used to demonstrate the expression of tyrosinase, TRP1, TRP2, and P gene
in human uveal melanoma cells at mRNA and protein levels
Our research showed human uveal melanoma cells express
genes that are essential for melanin biosynthesis in epidermal
melanocytes and cutaneous melanoma cells, possibly meaning that uveal melanoma cells utilize a similar melanin biosynthesis pathway like their cutaneous counterparts.
A melanoma treatment strategy has been designed to combat tumor load using T cells that are sensitized with peptides
derived from melanoma antigens, such as tyrosinase and other
members of the tyrosinase family [28,46-48]. The presence of
tyrosinase, TRP1, TRP2 and P protein in human uveal melanoma indicates that human uveal melanoma express these
immunotherapy candidate proteins abundantly. Uveal melanoma may be a suitable candidate tumor for immunothera-
peutic approaches, and tyrosinase, TRP1, TRP2, and P proteins may be the candidate proteins for immunotherapy.
In summary, this study showed adult human RPE cells do
not produce melanin in vitro. The expression of four key genes
involved in eumelanin biosynthesis pathway (tyrosinase,
TRP1, TRP2 and P-gene) could not be detected in cultured
adult human RPE cells at both mRNA and protein levels. This
may explain why melanin content of RPE cells decreases significantly in the aging process and why it may be related to
the occurrence of various retinal diseases, e.g. age-related
macular degeneration, the leading cause of irreversible blindness among the elderly in industrialized nations. In contrast,
human uveal melanoma cells still produce melanin in vitro
and express all of these melanogenic genes, indicating they
may possess a similar melanin biosynthesis pathway as cutaneous melanocytes and melanoma cells. Furthermore, the presence of tyrosinase, TRP1, TRP2, and P protein in uveal melanoma cells indicates that these proteins might be the candidate antigens for immunotherapy of uveal melanoma.
ACKNOWLEDGEMENTS
The authors thank Dr. G. Pelletier (Research Center of Immunology, Quebec, Canada) for providing SP6.5 melanoma
cell line. This study was sponsored by The National Natural
Science Foundation of China (30471857), and Zhejiang Provincial Natural Science Foundation of China (M303876 and
Y204400).
REFERENCES
2070
1. Sarna T, Swartz HA, The physical properties of melanin. In
Nordland JJ, ed. The Pigment System: Physiology and Pathophysiology. Oxford: Oxford Univ Press; 1998. p.333-58.
2. Boulton M. Melanin and the retinal pigment epithelium. In Marmor
MF, Wolfensberger T, ed. The Pigment Epithelium: Function
and Disease, Oxford: Oxford Univ. Press; 1998. p.68-85.
3. Larsson BS. The toxicology and pharmacology of melanins. In
Nordland JJ, ed. The Pigment System: Physiology and Pathophysiology. Oxford: Oxford Univ Press; 1998. p.373-89.
4. Wolfensberger TJ. Toxicology of the retinal pigment epithelium.
In Marmor MF, Wolfensberger T, ed. The Pigment Epithelium:
Function and Disease, Oxford: Oxford Univ Press; 1998. p. 621650.
5. Sarna T. Properties and function of the ocular melanin—a
photobiophysical view. J Photochem Photobiol B 1992; 12:21558.
6. Hu DN, Savage HE, Roberts JE. Uveal melanocytes, ocular pigment epithelium, and Muller cells in culture: in vitro toxicology. Int J Toxicol 2002 Nov-Dec; 21:465-72.
7. Peters S, Lamah T, Kokkinou D, Bartz-Schmidt KU, Schraermeyer
U. Melanin protects choroidal blood vessels against light toxicity. Z Naturforsch [C] 2006 May-Jun; 61:427-33.
8. Schmidt SY, Peisch RD. Melanin concentration in normal human
retinal pigment epithelium. Regional variation and age-related
reduction. Invest Ophthalmol Vis Sci 1986; 27:1063-7.
9. Weiter JJ, Delori FC, Wing GL, Fitch KA. Retinal pigment epithelial lipofuscin and melanin and choroidal melanin in human eyes.
Invest Ophthalmol Vis Sci 1986; 27:145-52.
10. Boulton M, Dayhaw-Barker P. The role of the retinal pigment
epithelium: topographical variation and ageing changes. Eye
Molecular Vision 2007; 13:2066-72 <http://www.molvis.org/molvis/v13/a234/>
©2007 Molecular Vision
2001; 15:384-9.
11. Sarna T, Burke JM, Korytowski W, Rozanowska M, Skumatz
CM, Zareba A, Zareba M. Loss of melanin from human RPE
with aging: possible role of melanin photooxidation. Exp Eye
Res 2003; 76:89-98.
12. Wang Z, Dillon J, Gaillard ER. Antioxidant properties of melanin in retinal pigment epithelial cells. Photochem Photobiol 2006
Mar-Apr; 82:474-9.
13. Prota G, Hu DN, Vincensi MR, McCormick SA, Napolitano A.
Characterization of melanins in human irides and cultured uveal
melanocytes from eyes of different colors. Exp Eye Res 1998;
67:293-9.
14. Oetting WS. Anatomy of pigment genes acting at the subcellular
level. In Nordland JJ, ed. The Pigment System: Physiology and
Pathophysiology. Oxford: Oxford Univ Press; 1998. p. 231-50
15. Zhu G, Evans DM, Duffy DL, Montgomery GW, Medland SE,
Gillespie NA, Ewen KR, Jewell M, Liew YW, Hayward NK,
Sturm RA, Trent JM, Martin NG. A genome scan for eye color
in 502 twin families: most variation is due to a QTL on chromosome 15q. Twin Res 2004; 7:197-210.
16. Duffy DL, Montgomery GW, Chen W, Zhao ZZ, Le L, James
MR, Hayward NK, Martin NG, Sturm RA. A three-single-nucleotide polymorphism haplotype in intron 1 of OCA2 explains
most human eye-color variation. Am J Hum Genet 2007; 80:24152.
17. Smith-Thomas L, Richardson P, Thody AJ, Graham A, Palmer I,
Flemming L, Parsons MA, Rennie IG, MacNeil S. Human ocular melanocytes and retinal pigment epithelial cells differ in their
melanogenic properties in vivo and in vitro. Curr Eye Res 1996;
15:1079-91.
18. Abe T, Durlu YK, Tamai M. The properties of retinal pigment
epithelial cells in proliferative vitreoretinopathy compared with
cultured retinal pigment epithelial cells. Exp Eye Res 1996;
63:201-10.
19. Abe T, Sato M, Tamai M. Dedifferentiation of the retinal pigment
epithelium compared to the proliferative membranes of proliferative vitreoretinopathy. Curr Eye Res 1998; 17:1103-9.
20. Hu DN, McCormick SA, Orlow SJ, Rosemblat S, Lin AY, Wo K.
Melanogenesis by human uveal melanocytes in vitro. Invest
Ophthalmol Vis Sci 1995; 36:931-8.
21. Flood MT, Gouras P, Kjeldbye H. Growth characteristics and
ultrastructure of human retinal pigment epithelium in vitro. Invest Ophthalmol Vis Sci 1980; 19:1309-20.
22. Newsome DA. Retinal pigmented epithelium culture: current
applications. Trans Ophthalmol Soc U K 1983; 103 (Pt 4):45866.
23. Albert DM, Ruzzo MA, McLaughlin MA, Robinson NL, Craft
JL, Epstein J. Establishment of cell lines of uveal melanoma.
Methodology and characteristics. Invest Ophthalmol Vis Sci
1984; 25:1284-99.
24. Albert DM, Ruzzo MA, McLaughlin MA, Robinson NL, Craft
JL, Epstein J. Establishment of cell lines of uveal melanoma.
Methodology and characteristics. Invest Ophthalmol Vis Sci
1984; 25:1284- 99.
25. Kan-Mitchell J, Mitchell MS, Rao N, Liggett PE. Characterization of uveal melanoma cell lines that grow as xenografts in
rabbit eyes. Invest Ophthalmol Vis Sci 1989; 30:829-34.
26. Dutkiewicz R, Albert DM, Levin LA. Effects of latanoprost on
tyrosinase activity and mitotic index of cultured melanoma lines.
Exp Eye Res 2000; 70:563-9.
27. Luyten GP, van der Spek CW, Brand I, Sintnicolaas K, de WaardSiebinga I, Jager MJ, de Jong PT, Schrier PI, Luider TM. Ex2071
pression of MAGE, gp100 and tyrosinase genes in uveal melanoma cell lines. Melanoma Res 1998; 8:11-6.
28. de Vries TJ, Trancikova D, Ruiter DJ, van Muijen GN. High
expression of immunotherapy candidate proteins gp100, MART1, tyrosinase and TRP-1 in uveal melanoma. Br J Cancer 1998;
78:1156-61.
29. Beliveau A, Berube M, Rousseau A, Pelletier G, Guerin SL. Expression of integrin alpha5beta1 and MMPs associated with
epithelioid morphology and malignancy of uveal melanoma.
Invest Ophthalmol Vis Sci 2000; 41:2363-72.
30. Fang D, Setaluri V. Role of microphthalmia transcription factor
in regulation of melanocyte differentiation marker TRP-1.
Biochem Biophys Res Commun 1999; 256:657-63.
31. Watabe H, Valencia JC, Yasumoto K, Kushimoto T, Ando H,
Muller J, Vieira WD, Mizoguchi M, Appella E, Hearing VJ.
Regulation of tyrosinase processing and trafficking by organellar
pH and by proteasome activity. J Biol Chem 2004; 279:797181.
32. Schraermeyer U. Does melanin turnover occur in the eyes of
adult vertebrates? Pigment Cell Res 1993; 6:193-204.
33. Nakazawa M, Tsuchiya M, Hayasaka S, Mizuno K. Tyrosinase
activity in the uveal tissue of the adult bovine eye. Exp Eye Res
1985; 41:249-58.
34. Dryja TP, O’Neil-Dryja M, Pawelek JM, Albert DM. Demonstration of tyrosinase in the adult bovine uveal tract and retinal
pigment epithelium. Invest Ophthalmol Vis Sci 1978; 17:5114.
35. Cooksey CJ, Garratt PJ, Land EJ, Pavel S, Ramsden CA, Riley
PA, Smit NP. Evidence of the indirect formation of the catecholic
intermediate substrate responsible for the autoactivation kinetics of tyrosinase. J Biol Chem 1997; 272:26226-35.
36. Kobayashi T, Imokawa G, Bennett DC, Hearing VJ. Tyrosinase
stabilization by Tyrp1 (the brown locus protein). J Biol Chem
1998; 273:31801-5.
37. Manga P, Sato K, Ye L, Beermann F, Lamoreux ML, Orlow SJ.
Mutational analysis of the modulation of tyrosinase by tyrosinase-related proteins 1 and 2 in vitro. Pigment Cell Res 2000;
13:364-74.
38. Puri N, Gardner JM, Brilliant MH. Aberrant pH of melanosomes
in pink-eyed dilution (p) mutant melanocytes. J Invest Dermatol
2000; 115:607-13.
39. Brilliant MH. The mouse p (pink-eyed dilution) and human P
genes, oculocutaneous albinism type 2 (OCA2), and
melanosomal pH. Pigment Cell Res 2001; 14:86-93.
40. Kurtz MJ, Edwards RB. Influence of bicarbonate and insulin on
pigment synthesis by cultured adult human retinal pigment epithelial cells. Exp Eye Res 1991; 53:681-4.
41. Campochiaro PA, Hackett SF. Corneal endothelial cell matrix
promotes expression of differentiated features of retinal pigmented epithelial cells: implication of laminin and basic fibroblast growth factor as active components. Exp Eye Res 1993;
57:539-47.
42. Pfeffer BA. Improved methodology for cell culture of human
and monkey retinal pigment epithelium. Prog Retinal Res 1991;
10:251-91.
43. Rak DJ, Hardy KM, Jaffe GJ, McKay BS. Ca++-switch induction of RPE differentiation. Exp Eye Res 2006; 82:648-56.
44. Dorey CK, Torres X, Swart T. Evidence of melanogenesis in porcine retinal pigment epithelial cells in vitro. Exp Eye Res 1990;
50:1-10.
45. Julien S, Kociok N, Kreppel F, Kopitz J, Kochanek S, Biesemeier
A, Blitgen-Heinecke P, Heiduschka P, Schraermeyer U. Tyrosi-
Molecular Vision 2007; 13:2066-72 <http://www.molvis.org/molvis/v13/a234/>
nase biosynthesis and trafficking in adult human retinal pigment epithelial cells. Graefes Arch Clin Exp Ophthalmol 2007;
245:1495-505.
46. Orlow SJ, Silvers WK, Zhou BK, Mintz B. Comparative decreases
in tyrosinase, TRP-1, TRP-2, and Pmel 17/silver antigenic proteins from melanotic to amelanotic stages of syngeneic mouse
cutaneous melanomas and metastases. Cancer Res 1998;
58:1521-3.
©2007 Molecular Vision
47. Ayyoub M, Zippelius A, Pittet MJ, Rimoldi D, Valmori D, Cerottini
JC, Romero P, Lejeune F, Lienard D, Speiser DE. Activation of
human melanoma reactive CD8+ T cells by vaccination with an
immunogenic peptide analog derived from Melan-A/melanoma
antigen recognized by T cells-1. Clin Cancer Res 2003; 9:66977.
48. Parmiani G, Castelli C, Santinami M, Rivoltini L. Melanoma
immunology: past, present and future. Curr Opin Oncol 2007;
19:121-7.
The print version of this article was created on 3 Nov 2007. This reflects all typographical corrections and errata to the article through that date.
Details of any changes may be found in the online version of the article. α
2072