Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD Laboratory for telomere research, Rabin Medical Center, Beillinson Campus Felsenstein Medical Research Center 8 March 2010 Historical perspective • 1908, McClintock & Muller “Chromosome bore a special component at their ends that provided stability” • Telomere: telos- end, merospart • 1961, Hayflick & Moorehead “Normal somatic cells have a limited life span- a status that is terminated in M1 stage- replicative senescence”. Leonard Hayflick Biological landmarks • 1971, Olovnikov: “Marginotomy”- the end-replication problem may account for the Hayflick limit • 1972, Watson: DNA polymerase could not replicate chromosomes to the tip The end-replication problem 5’ 3’ 3’ 5’ DNA Replication 5’ 3’ R R R R R 5’ 3’ RNA primer removal Fill-in DNA replication Ligation 5’ 3’ 3’ 5’ Each division 50-100 bp loss Biological landmarks (cont.) • 1978, Blackburn discovered telomeres in Tetrahymena (TTGGGG)n • 1984, Blackburn & Greider telomerase activity was detected in Tetrahymena Telomeric end of DNA (TTAGGG)n (AATCCC)n Unique Proxim al subtelomeric Genomic DNA Degenerate (TTAGGG) n Distal subtelomeric (TTAGGG) n repeats Telomere Molecular structure of the telomere Functions of telomere [(TTAGGG)n] • Protects the chromosomal ends from: • • Enables a complete replication of the DNA Contributes to the functional organization of chromosomes in the nucleus Participates in regulation of gene expression Serves as “mitotic clock”: shortens with each cell division • • – Recombination – End-to-end fusion – Recognition as damaged DNA Telomere length in healthy population Uziel et al. 2002 8000 Telomere length (bp) 7000 6000 5000 4000 3000 2000 y = -27.45x + 6972.5 1000 R 2 = 0.4636 0 0 20 40 Age (years) 60 80 100 Consequences of telomere shortening & damage Two-step hypothesis of cellular senescence and immortalization Wright & Shay Microbiol Mol Biol Rev 2002 Telomerase 5’ TTAGGGTTAG CAAUCCCAAUC telomerase Telomerase 5’ TTAGGGTTAGGGTTAG CAAUCCCAAUC telomerase hTERT hTR-CAAUCCCAAUC 5’ TTAGGGTTAGGGTTAG CAAUCCCAAUC telomerase 5’ TTAGGGTTAGGGTTAGGGTTAG CAAUCCCAAUC telomerase Elongation of a telomere by telomerase. Wong L S et al. Cardiovasc Res 2009;81:244-252 Published on behalf of the European Society of Cardiology. All rights reserved. © The Author 2008. For permissions please email: [email protected] Keeping telomerase in its place Maser & DePinho Nature Medicine 2002 The telomere model for cellular transformation Telomere length Germ cells: telomerase ON Somatic cells: telomerase OFF Oncogenetically transformed cells: bypass senescence, telomerase OFF Senescence Crisis # of cell divisions Immortal cells: telomerase ON TRF measurements Southern blot Shapiro, Uziel and Lahav 2000 FISH flow FISH on paraffin embedded tissues Clinical applications of telomere research Cancer Senescence Acquired capabilities of cancer (Hanahan and Weinberg, Cell 100: 57-70, 2000) Minimal set of genetic alterations required for conversion of fibroblasts to cancer cells Sun et al 2006 • Malignant conversion: • Malignant cells are not immortal - enter crisis and die Telomerase expression renders cell immortal • – SV40 large T antigen (p53 and pRb inactivation) – Ras activation Telomerase up-regulation cause or consequence • Human cancer cells have • Correlation between anaphase bridges and telomere length • Human colorectal cancers show a peak in anaphase bridges index in early lesions; – shorter telomeres then normal – dysfunctional telomeres (anaphase bridges, ends fusions etc.,) Effect of telomerase inhibition on malignant cells growth Telomerase inhibition in cancer Lahav 2010 Chemosensitization by telomeres Lahav 2009 Comet assay DNA damage Lahav 2010 DNA damage focci telomere dysfunction Lahav 2009 Association of telomerase activity with disease free survival in non-small cell lung cancer Gonzalez-Quevedo, R. et al. J Clin Oncol. 2002;20:254-262 Thalidomide downregulates telomerase promoter gene expression molecular pharmacology Druker, Uziel, Lahav et al. 2004 molec pharmacol [ThD] mg/ml 0 ARH-77 12.5 25 50 100 hTERT IGFI-R b actin CD63 [ThD] mg/ml 0 RPMI 8226 12.5 25 50 [ThD] mg/ml 0 100 12.5 25 50 100 hTERT hTERT IGFI-R IGFI-R b actin CD63 U266 CD63 b actin Gleevec inhibits telomerase activity in SK-N-MC cells Uziel and Lahav,2005 BJC 10mM 15mM R8 Telomerase activity after Gleevec 5 days treatment Telomerase activity (%) 0mM 120 100 80 60 40 20 0 10 2 10 315 [Gleevec](uM) Inhibition range: 70-90% (% of control) telomerase activity Kinetics of telomerase activity during Gleevec treatment 120 100 80 60 40 20 0 1 2 3 time (days) 4 5 Telomerase cellular localization in STI571 treated cells Uziel, Beery et al 2003 Control cells STI571 treated cells Telomerase as a drug target • Significant difference of telomerase expression between malignant and normal tissues • Possible adverse effects: damage to stem and germ cells • Telomerase inhibitors will be effective only when the telomeres shorten to critical length • Will probably be used as an adjuvant therapy Potential effects of telomerase inhibition over time on telomere length and proliferative capacity Experts reviews in molecular medicine 2002 Strategies for inhibition of telomerase activity • Telomerase targeting agents: • Telomeres targeting agents • compounds from random screening – – The RNA template Reverse transcriptase inhibitors – Modulators of telomerase regulating proteins – Inhibitors that interact with G4-DNA structures – Inhibitors against telomeres associated proteins – “Old” DNA -interacting drugs Effect of telomerase antisense on malignant cell culture Uziel and Lahav, 2004 Antimetastatic effects of GRN163L on pretreated A549-Luc cells Dikmen, Z. G. et al. Cancer Res 2005;65:7866-7873 Telomere attrition sensitize SK-N-MC cells to DNA SS breaks inducing agent, Cisplatinum proliferation (%) Uziel and Lahav, 2006 120 100 80 60 40 20 0 Control +GRN163 0 0.2 0.4 120 120 100 100 proliferation (%) proliferation (%) Cisplatinum (ug/ml) 80 60 40 20 0 80 60 40 20 0 0 5 10 Vincristine (ng/ml) 15 0 50 100 Doxorubicin (ng/ml) 150 Telomerase inhibition – future directions • New effective inhibitors • Antitelomerase vaccines • Antitelomerase adoptive immunotherapy • Promoter driven therapy • Development of antitelomerase – cytotoxic drugs – other biologic interventions combinations Telomerase promoter-driven gene therapy • hTERT promoter is highly active in • • cancer cells (not active in somatic cells) Expression of harmful genes under the control of hTERT promoter- expression directed to malignant cells Genes used – Proapoptotic genes: caspase 8, caspase 6, TRAIL, Bax Adenovirus and telomerase promoter Telomerase immunotherapy • • • • Immunizing patients against tumor antigens to elicit antibody or cytotoxic T-cells killing of tumor cells T cells against a short hTERT peptide in vitro and in mouse models in vivo; Somatic cells are not affected Prostate or breast cancer patients were vaccinated with cells expressing tert peptide; 4 responded; No se. 12 prostate cancer patients were treated as above, majority responded positively Aging Aging Comparison between a single homologue from one individual and a single homologue from an unrelated individual carrying the same genetic marker Dolly or failure of resetting the cellular clock Willmut et al, 1997 Telomere length & survival rate Trans-differentiation of pluripotent stem cells Telomerase effect on cells Telomere binding defect in progeria Diabetes control and telomeres Lahav 2006 Telomere-telomerase and p53 function De Angelis, A. et al. Circulation 2010;121:276-292 Copyright ©2010 American Heart Association Histogram showing haemoglobin levels and their association with telomere length. Wong L S et al. Eur J Heart Fail 2010;12:348-353 Published on behalf of the European Society of Cardiology. All rights reserved. © The Author 2010. For permissions please email: [email protected]. Telomere length in the anaemic vs. non-anaemic group. Wong L S et al. Eur J Heart Fail 2010;12:348-353 Published on behalf of the European Society of Cardiology. All rights reserved. © The Author 2010. For permissions please email: [email protected]. Absolute and Relative Mean Changes in Telomere Length Over 5 Years by Quartile of Omega-3 Fatty Acid Level, Adjusted for Age and Baseline Telomere Length Farzaneh-Far, R. et al. JAMA 2010;303:250-257. Copyright restrictions may apply. Translational applications ; • Cancer; Mechanism of malignancy • Therapeutic approaches • Aging; • • Cellular ( stem cells) Organism ; normal accelerated aging