Download Tiburón de galápagos (Carcharhinus galapagensis)

Tiburón de galápagos (Carcharhinus
galapagensis)
Si n ón i mos: Carcharias galapagensis, Eulamia galapagensis
¿Tienes alguna duda, sugerencia o corrección acerca de este taxón? Envíanosla y con gusto la atenderemos.
Foto: (c) Gerardo del Villar / Banco de Imágenes CONABIO, algunos derechos reservados (CC BY-NC-ND)
Ver todas las fotos etiquetadas con Carcharhinus galapagensis en Banco de Imagénes »
Descripción de EOL Ver en EOL (inglés) →
Description 1
Common names: shark (English), tiburón (Espanol)
Carcharhinus galapagensis (Snodgrass & Heller, 1905)
Galapagos shark
A large, relatively slender grey shark; snout moderately long and broadly rounded; eyes large, round; nasal flaps
rudimentary; lip furrows short; upper teeth broadly triangular, serrated, straight to slightly oblique; lower teeth with
high narrow straight points; a low ridge between dorsal fins; origin of first dorsal fin above about rear edge of
pectoral fins; first dorsal fin moderately large (height 9.1-12.1% or more of TL), with straight front edge, its apex
pointed or narrowly rounded, moderately concave rear edge its origin over rear 1/3 of inner margin of pectoral
fin; origin of second dorsal fin about over anal fin origin; pectorals large, with narrowly rounded to pointed tips and
straight rear edge.
Very similar in appearance and easily confused with C. obscurus; best means of separation is the taller dorsal
fin: 9.1-12.1% of TL in C. galapagensis vs. 5.8-9.9 % in C. obscurus.
Brownish grey on back and sides, white below; tips of most fins dusky, especially underside of pectorals.
Attains 370 cm.
Habitat: usually associated with oceanic islands. Often occurs in aggregations.
Depth: 0-180 m.
Circumtropical distribution; all the oceanic islands, also central Baja California, and the Gulf of California to Peru.
Range description 2,3
Circumglobal distribution in warm and temperate waters. Essentially limited to oceanic islands (e.g. Galapagos Is.;
Clipperton Is.; Virgin Is.; St. Paul's Rocks; Azores; St. Helena; Ascension Is.; Ogasawara Is.; Lord Howe Is., Norfolk Is.;
Kermadec Is., Rapa Is., Hawaiian Is.). Also from high seas and adjacent to continental shelves (e.g. California & N.
Carolina, U.S.A.). Regionally, known from Lord Howe Island (Aust), American Samoa, Western Samoa, Cook Is., French
Polynesia, and the Kermadec Islands (NZ). Records suggest that it may also occur along the continental shelves of
adjacent landmasses (Last and Stevens 1994, Schwartz 1998).
Size 1
Length max (cm): 370.0 (S)
Size 4
Maximum size: 3700 mm TL
Description 5,6
Found close inshore to well offshore near on the insular or continental shelves, on rugged coral and rocky bottoms.
Capable of crossing considerable distances of open ocean between islands (at least 50 km). Juveniles found in
shallower waters. Feeds mainly on fishes and less on cephalopods and crustaceans. Viviparous (with a yolk-sac
placenta), 6 to 16 young in a litter. Found in superficial aggregations. Aggresive. Incriminated in human attacks.
I dnature guides 7
Identification key for shorefishes of the tropical eastern Pacific
Habitat and ecology 2,3
Hab i tat an d Ecol ogy
Carcharhinus galapagensis is most commonly found over rugged, rocky terrain in clear water. There is a suggestion
that this species prefers areas with strong water currents. In Hawaii the majority of sharks were found near points of
land characterised by having currents that converge and move offshore at those points (Wetherbee et al. 1996).
Isolated rocky islets serve as congregation sites (Edwards and Lubbock 1982, Brum and Azevedo 1995), suggesting that
underwater pinnacles may also be suitable habitat, giving this species a more extensive range of sites than currently
understood. Occurs from surface waters to depths of over 280 m, with some suggestion of segregation on the basis of
size. Vertical distribution patterns appear to be site specific and vary considerably between geographical areas/habitat
types. In some regions juveniles are found in shallow water (less than 1 m) whereas in others they prefer deeper water
(around 40 m) (Wetherbee et al. 1996). This species is reputed to reach a maximum body size of about 350 cm total
length (TL), although specific records suggest that 300 cm TL appears more likely. Females mature at about 215 to 250
cm TL, males at about 205 to 250 cm TL (Bass et al . 1973, Last and Stevens 1994, Wetherbee et al. 1996). Estimated age
at maturity is 6 to 8 years for males and 6.5 to 9 years for females (De Crosta et al. 1984). Litter size ranges from 4 to
16, with young born at 60 to 81 cm TL. Reproductive life histories are not well known. Females probably breed every
two (or three) years with mating likely to occur in winter/spring. The species has a limited intrinsic rebound potential
(Smith et al. 1998).
Carcharhinus galapagensis feeds primarily on demersal prey with fishes and cephalopods important to all size
classes. Ontogenetic dietary shifts occur, with sharks and rays taken by larger (>200 cm TL) individuals. Ascribed a
relatively high trophic level of 4.2 (Corts 1999). An aggressive shark considered potentially dangerous to humans.
Systems
Marine
Feeding 1
Feeding Group: Carnivore
Diet: mobile benthic crustacea (shrimps/crabs), octopus/squid/cuttlefish, bony fishes
Life cycle 8
Viviparous, with a yolk sac placenta (Ref. 244). 6 to 16 young born at 60-80 cm (Ref. 26346). Distinct pairing with
embrace (Ref. 205).
Reproduction 1
Egg Type: Live birth, No pelagic larva
Functional adaptation 9
Ski n i n h i b i ts mi crob es: sh ark
Skin of sharks prevent microbes and other organisms from attaching due to surface microtopography.
Maintain physical integrity > Protect from biotic factors > Microbes
"An engineered surface microtopography based on the skin of sharks, Sharklet AFTM, has been designed on a
polydimethyl siloxane elastomer PDMSe to disrupt the formation of bacterial biofilms without the use of bactericidal
agents. The Sharklet AF™ PDMSe was tested against smooth PDMSe for biofilm formation of Staphylococcus aureus
over the course of 21 days. The smooth surface exhibited early-stage biofilm colonies at 7 days and mature biofilms at
14 days, while the topographical surface did not show evidence of early biofilm colonization until day 21. At 14 days,
the mean value of percent area coverage of S. aureus on the smooth surface was 54% compared to 7% for the Sharklet
AF™ surface (p < 0.01). These results suggest that surface modification of indwelling medical devices and exposed
sterile surfaces with the Sharklet AF™ engineered topography may be an effective solution in disrupting biofilm
formation of S. aureus." (Chung et al. 2007:89)
Learn more about this functional adaptation.
10
Barcode data: carcharhinus galapagensis 10
The following is a representative barcode sequence, the centroid of all available sequences for this species.
There are 16 barcode sequences available from BOLD and GenBank.
Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.
See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
CCTTTACCTGATTTTTGGTGCATGAGCAGGTATAGTTGGAACAGCCCTAAGTCTCCTAATTCGAGCTGAACTTGGGCAACCTGGCTCACTTTTAG
-- end -Download FASTA File
Iucn red list assessment 2,3
R ed Li st Category
NT
Near Threatened
R ed Li st Cri teri a
Versi on
3.1
Year Assessed
2003
Needs updating
Assessor/s
Bennett, M.B., Gordon, I. & Kyne, P.M. ( SSG Australia & Oceania Regional Workshop, March 2003)
R evi ewer/s
Fowler, S. & Cavanagh, R.D. (Shark Red List Authority)
Con tri b u tor/s
Ju sti fi cati on
Carcharhinus galapagensis has a widespread, but patchy distribution, occurring at many widely separated island and
some coastal sites in the Pacific, Atlantic and Indian Oceans.
It is classified globally as Near Threatened (just failing to meet Vulnerable A2acd, and likely to be A3d in the near
future) because populations at many of these sites may be subject to high levels of fishing pressure (tuna longline
fisheries, targeted drop-line fishing, recreational/tourism-based angling). There is considerable potential to cause
severe local declines in the number of mature individuals. Evidence of such reductions/extirpations exists for this
species around Central America (Pacific and Atlantic Oceans). As the species has a limited intrinsic rebound potential,
and there are no data on recruitment to isolated sites, such local depletions could lead to loss of populations at
specific localities. Continued fishing pressures throughout its range will result in further declines and populations
require monitoring.
The species is classified as Data Deficient in Australia and Oceania: although it is not considered to be under threat off
Lord Howe Island (Australia) and off the Kermadec Islands (New Zealand) where a marine reserve encompasses the
species' range, there is currently no information on these populations.
Conservation status 1
IUCN Red List: Listed, Near threatened
CITES: Not listed
Population 2,3
Pop u l ati on
Reported as a very common inshore species at oceanic islands off Central and South America (Beebe and Tee-Van
1941), but may have undergone severe population reductions at many of these islands. Very common species at Saint
Paul's Rocks, a group of barren islets on the mid-Atlantic Ridge, where the shark population is reported to be "one of
the densest shark populations of the Atlantic Ocean" (Edwards and Lubbock 1982). This species is reported to be one
of the more common sharks in the main Hawaiian Islands and is very abundant at the Northwestern Hawaiian Islands
(Wetherbee et al. 1996). This single study on the Hawaiian population suggests that the species is locally numerous
and there is no immediate negative impact on the population by moderate fishing pressure (no measurable effect on
CPUE over two seasons of long-lining). There are no data on the populations at other sites.
Pop u l ati on Tren d
Unknown
Threats 2,3
M aj or Th reats
The life history parameters of this species make it susceptible to population declines from which it may not recover.
The major threat comes from long-lining and other bait-fishing activities around islands and sub-sea mounts
throughout its range. The aggressive nature of this common species together with the occupation of inshore habitats
may result in pressures to extirpate local populations. Evidence of such reductions/extirpations exists for this species
around Central America (Pacific and Atlantic Oceans) (L.J.V. Compagno, pers. comm.). The interrupted geographical
distribution and unknown level of immigration to these isolated populations could place subpopulations at significant
risk from over fishing. It should also be noted that uncontrolled legal and illegal shark fin fishing takes place at sites in
the Pacific, including the Galpagos Marine Resources Reserve where a significant population of this species is known
to occur (Bonfil et al. in press)
Conservation actions 2,3
Con servati on Acti on s
The Data Deficient listing for Australia and Oceania waters reflects the lack of information about this species in this
region where it is the species is known from only a very few sites, and the number of individuals, their movements on
a daily and seasonal basis and the levels of immigration/emigration are unknown. At these sites, a program that would
encourage anglers to tag and release Galapagos sharks should help safeguard the populations and expand on our
limited knowledge base. Involvement of tourist diving companies would assist in conservation efforts by raising public
awareness and providing useful data on shark behaviour, numbers and preferred habitats.
The population at the Kermadec Islands is protected by a 12 nm marine reserve which extends in places to cover
depths of over 3,000 m. The species also occurs within other marine reserves such as the Galpagos Marine Resources
Reserve, (unfortunately illegal fishing is known to occur here).
11
Importance 11
fisheries: minor commercial; price category: medium; price reliability: very questionable: based on ex-vessel price for
species in this family
References
1. © Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep, some rights reserved
2. Bennett, M.B., Gordon, I. & Kyne, P.M. ( SSG Australia & Oceania Regional Workshop, March 2003) 2003.
Carcharhinus galapagensis. In: IUCN 2014 . IUCN Red List of Threatened Species. Version 2014.1 .
<www.iucnredlist.org>
3. © International Union for Conservation of Nature and Natural Resources, some rights reserved
4. © FishWise Professional, some rights reserved
5. Froese, R. & D. Pauly (Editors). (2014). FishBase. World Wide Web electronic publication.
6. © WoRMS for SMEBD, some rights reserved
7. © Discover Life and original sources, some rights reserved
8. © FishBase, some rights reserved
9. © The Biomimicry Institute, some rights reserved
10. © Barcode of Life Data Systems, some rights reserved
11. © FishBase, some rights reserved