Download Characterization of stem/progenitor cells from human prostate

Characterization of stem/progenitor cells from
human prostate cancer tissue
Graduate School for Cellular and Biomedical Sciences
University of Bern
PhD Thesis
Submitted by
Natalia Guzmán Ramírez
from Bogotá, Colombia
Thesis advisor
Prof. Dr. George Thalmann
Department of Urology and Urology Research Laboratory
Faculty of Medicine of the University of Bern
Thesis abstract
Last name
Guzmán Ramírez
First name
Institute
Urology clinic and Department for Clinical research
Urology Research Laboratory
Natalia
Faculty
Interfaculties
Thesis advisor
Prof. Dr. George Thalmann
Title of thesis
Characterization of cancer stem/progenitor cells from human prostate cancer tissue
Date of doctorate degree
Abstract
Organ-confined prostate cancer can be cured by surgical treatment in 70-80% of patients. The remaining 20-30% will develop a
local or distant recurrence leading to progressive disease and decreased survival. These recurrences are due to disseminated
tumour cells (DTC) which have already colonized the target tissue at the time of surgery of the primary tumour and will
ultimately develop into a clinically evident metastasis. DTC are not detectable by conventional histopathological analysis and
high resolution imaging methods. Thus, it is of high clinical relevance to characterize DTC in order to find suitable approaches
to target them.
The cancer stem cell hypothesis postulates that tumour growth is sustained by a rare subpopulation of cancer cells with stem
cell properties such as self-renewal, high proliferative potential and the capacity to differentiate. DTC with these characteristics
have been hypothesized to be responsible for metastasis initiation and relapse. The identification and characterization of these
cells at an early stage of the disease has important clinical implications since it may allow the identification of patients at risk for
metastatic relapse. Accordingly, we aimed at determining whether clinical samples of human prostate cancer tissue contain
cells with stem cell characteristics. We characterized them in order find a set of potential markers that allows their identification
in primary tumours and within the DTC population in lymph nodes and bone marrow.
We show that prostate cancer clinical specimens contain cells which exhibit self-renewal potential and high proliferative
capacity. These cells can be enriched in free-floating prostaspheres that can be serially propagated. They express markers of
the basal compartment of the prostate and different putative stem cell markers with increased expression of PSCA as compared
to the epithelial cells in the original tumour tissue. The neoplastic origin of prostasphere-forming cells was demonstrated by the
detection of the TMPRSS2/ERG gene fusion. Collectively, these results suggest that human primary prostate cancer specimens
contain cells with stem/progenitor cell properties and that PSCA may represent a candidate marker for their identification.
Ongoing studies performed by our group investigate whether stem/progenitor cell markers identified in prostaspheres are
expressed by the DTC population of lymph nodes and bone marrow from prostate cancer patients in order to test the presence
of stem/progenitor cells. Preliminary results in lymph nodes from 6 patients show that PSCA detects a subpopulation of cells,
which is not detected by conventional histopathological analysis or by PSA expression. In bone marrow from 42 patients the
presence of c-met, CD49f, and CD49b (other putative stem cell markers expressed by prostaspheres) positive cells, was
significantly increased in patients with biological relapse. Further studies will allow to determine whether markers expressed in
prostaspheres are of actual clinical relevance and will ultimately contribute to the development of more effective therapies in the
treatment of prostate cancer.
TABLE OF CONTENTS
INTRODUCTION ................................................................................................................................................. 3
BIOLOGY OF THE PROSTATE ................................................................................................................................ 3
Anatomy of the human prostate ..................................................................................................................... 3
Prostate epithelial cell types.......................................................................................................................... 4
Prostate stroma ............................................................................................................................................. 5
PROSTATE CANCER ............................................................................................................................................. 6
Introduction ................................................................................................................................................... 6
Heterogeneous nature of prostate cancer ...................................................................................................... 7
Prostate cancer and gene fusions .................................................................................................................. 8
Disseminated tumour cells (DTC) and minimal residual disease.................................................................. 9
Methods for detection of DTC ..................................................................................................................... 10
Biological properties of DTC ...................................................................................................................... 11
MODELS OF TUMOUR PROGRESSION .................................................................................................................. 12
CANCER STEM CELL HYPOTHESIS ...................................................................................................................... 13
CANCER STEM/PROGENITOR CELLS ................................................................................................................... 15
CANCER STEM/PROGENITOR CELLS AS METASTASIS INITIATING CELLS ............................................................. 17
IDENTIFICATION OF CANCER STEM/PROGENITOR CELLS IN HUMAN MALIGNANCIES........................................... 18
Haematopoietic cancer stem/progenitor cells ............................................................................................. 23
Cancer stem/progenitor cells in solid tumours ............................................................................................ 24
Normal and cancer prostate stem/progenitor cells ..................................................................................... 26
THERAPEUTICAL IMPLICATIONS OF THE CANCER STEM CELL HYPOTHESIS ........................................................ 31
AIM OF THE THESIS ....................................................................................................................................... 35
MANUSCRIPT IN PRESS ................................................................................................................................. 36
INTRODUCTION ................................................................................................................................................. 36
ADDITIONAL RESULTS.................................................................................................................................. 37
DETECTION OF PSCA MRNA EXPRESSION IN LYMPH NODES OF PATIENTS WITH PROSTATE CANCER ................ 37
DETECTION OF CD49F, CD49B AND C-MET POSITIVE CELLS IN BONE MARROW OF PATIENTS WITH PROSTATE
CANCER ............................................................................................................................................................. 40
OUTLOOK AND FUTURE QUESTIONS ....................................................................................................... 43
CONCLUSION ................................................................................................................................................... 47
LIST OF ABBREVIATIONS............................................................................................................................. 48
REFERENCES .................................................................................................................................................... 49
CURRICULUM VITAE ..................................................................................................................................... 58
2
INTRODUCTION
Biology of the Prostate
Anatomy of the human prostate
The adult prostate is a glandular male accessory sex organ surrounding the base of the
bladder. The prostate secretion constitutes 95% of the seminal fluid and it provides essential
secretory proteins for its function. It is one of the most common sites for neoplastic
transformation in humans.
Prostate ontogenesis occurs during embryogenesis and originates from the urogenital
sinus through epithelial budding from the urethra. The human prostate possesses a ductalacinar morphology (Figure 1). There are three different morphological regions in the prostate:
the peripheral zone, the transition zone and the central zone (McNeal 1969; McNeal 1988).
These zones are functionally distinguished. Importantly, benign prostate hyperplasia mainly
develops in the transition zone while prostate carcinoma originates most of the times in the
peripheral zone (McNeal 1981).
Figure 1. Schematic illustration of the anatomy of the human
prostate (Taken from Abate-Shen and Shen, 2000).
3
Prostate epithelial cell types
The prostate epithelium is divided into basal and luminal layers. Prostate basal cells
form a layer along the basement membrane of each acinus and luminal cells form a layer
above the basal cells delimiting the lumen (Figure 2).
Basal cells
Luminal cells
Lumen
Figure 2. Different cell types within a prostate acinus are shown in a frozen section of the human prostate tissue (left)
and in a scheme (righ) (Taken from Abate-Shen and Shen, 2000).
Within these two compartments, there are 3 functionally distinct cell types, each
expressing specific markers. The most abundant cell type is the secretory luminal cell.
Luminal cells are terminally differentiated, androgen-dependent cells that express high levels
of cytokeratin (CK) 8, CK18, CK19, androgen receptor (AR), and prostate specific antigen
(PSA), but do not express CK5 and CK14 (Schalken and van Leenders 2003). Cells from the
basal layer express high levels of CK5, CK14, CD44 and p63 and low levels of AR, PSA, and
CK18 (Wang, Hayward et al. 2001; Schalken and van Leenders 2003). The basal layer is
thought to contain epithelial stem/progenitor cells that generate transit/amplifying cells, the
progeny of which will differentiate into luminal cells. The specific marker expression profile
of the stem/progenitor cells has not yet been specifically elucidated. Transit amplifying cells
express CK19 and high levels of the basal cytokeratins CK5, CK14 and the hepatocyte
growth factor receptor (HGF) receptor c-met. Expression of CK18 is either low or absent (van
4
Leenders, Dijkman et al. 2000). Neuroendocrine cells are a small cell population scattered
within the basal layer and characterized by the expression of neuroendocrine markers such as
chromogranin A (CHRA), synaptophysin (SYP) and neuron-specific-enolase (NSE) (van
Leenders and Schalken 2003; Letellier, Perez et al. 2007) (Figure 3).
Figure 3. Hierarchy of epithelial cell in the prostate and related markers (Curved
arrow: self-renewal potential).
Prostate stroma
The epithelial cells in the prostate are embedded within a stromal tissue. They express
adrenergic receptors, steroid hormone receptors (like AR), oestrogen receptor and 5-αreductase. The stroma is composed of three main cell types: myofibroblasts, fibroblasts, and
smooth muscle cells. Myofibroblasts express procollagen I (Ayala, Tuxhorn et al. 2003) and
fibroblasts express vimentin and laminin (Micke and Ostman 2004). Desmin, α-actin,
calponin, caldesmon, myosin, smoothelin, and dystrophin are expressed by smooth muscle
cells (Antonioli, Cardoso et al. 2007). In stromal cells, androgens regulate the production of
growth factors, which play an important role in the homeostasis of prostate glandular tissue
tissue by directing growth and differentiation of the different epithelial and neuroendocrine
cell types through the stroma. The most important factors include transforming growth factor
5
β (TGFβ), platelet derived growth factor (PDGF), fibroblast growth factors (FGF), epidermal
growth factor (EGF), hepatocyte growth factor (HGF), insulin-like growth factor (IGF1),
hypoxia inducible factor (HIF1α), interleukin 6 (IL-6) and vascular endothelial growth factor
(VEGF) (Berry, Maitland et al. 2008).
Prostate cancer
Introduction
Prostate cancer is the most frequently diagnosed male malignancy in the Western
world (Landis, Murray et al. 1999). Current diagnostic methods include the measurement of
serum levels for PSA (De Angelis, Rittenhouse et al. 2007) and other markers like Prostate
Cancer-Gen-3 (PCA3) in the urinary sediment (Hessels, Klein Gunnewiek et al. 2003). PSA
early detection is effective in identifying patients that may have prostate cancer, but is often
elevated in non-malignant diseases like benign prostate hyperplasia and prostatitis. Therefore,
this measurement cannot be reliably used to predict patients at risk of developing prostate
cancer (Lalani, Stubbs et al. 1997). Organ confined disease is treated by surgical removal of
the prostate and/or radiation. However, around 20-30% of patients relapse after the initial
therapy (Grubb and Kibel 2007). Advanced prostate cancer treatment includes androgen
ablation therapy which, usually results in an immediate decrease in PSA levels because of a
decrease in the bulk of the tumour due to apoptosis of androgen dependent tumour cells
(Rocchi, So et al. 2004). Androgen independent (or castration resistant) disease and
subsequent wide-spread metastatic disease occurs almost invariably 5 to 10 years after initial
treatment and within 11 to 32 months after androgen ablation therapy (Kasper and Cookson
2006).
Metastases are most commonly found in bones, lymph nodes, liver and lungs
(Bubendorf, Schopfer et al. 2000; Roudier, True et al. 2003; Shah, Mehra et al. 2004). In 90%
6
of the patients with advanced disease, bone metastasis occurs and is a leading cause of
morbidity. Anemia and susceptibility to infection arise as a result of the replacement of
haematopoietic bone marrow by tumour cells. Altered bone remodelling and osteoblastic
reactions lead to pain, fracture and spinal cord compression (Logothetis and Lin 2005).
According to the conventional view, androgen independent prostate cancer may develop as a
result of several molecular mechanisms which compensate for the low levels of androgen
following surgical or chemical androgen ablation therapy (reviewed in Feldman and Feldman,
2001). AR may be overproduced (by gene amplification), may have enhanced response to
ligand binding, or may be hyper-phosphorylated and therefore activated independently of the
ligand. Alternatively, AR may become a promiscuous receptor that can be activated by nonandrogenic steroids.
Heterogeneous nature of prostate cancer
Prostate cancer is a heterogeneous lesion. A section of prostate cancer tissue typically
contains a mixture of benign glands, prostatic intraepithelial neoplasia (PIN), and neoplastic
foci of different grades of severity, which can be classified according to the Gleason system
(Gleason 1996) (Figure 4). This system distinguishes the severity of the lesion according to 5
patterns where Gleason pattern 1 defines lesions containing differentiated acini while Gleason
pattern 5 describes lesions with lack of acinar differentiation to anaplastic growth. Prostate
cancer biopsies are assigned a Gleason score ranging from 2 to 10, which results from the
sum of the two most prominent Gleason patterns. A high Gleason score is an indicator of bad
prognosis (Cheng, Koch et al. 2005).
7
Figure 4. Schematic diagram of the Gleason grading system.
In addition to its heterogeneous aspect, prostate cancer is multifocal as well. Each
neoplastic lesion within a prostate cancer tissue section has been found to be genetically
distinct (Bostwick, 1998 Macintosh, 1998). This suggests that different neoplastic loci may
develop independently. The heterogeneity and multifocality of prostate cancer disease, in
addition to the small size of prostate tissue samples, represent technical drawbacks for the
researchers aiming at studying the tumourigenesis of prostate cancer.
Prostate cancer and gene fusions
The TMPRSS2 gene encodes for a serine protease that is secreted by prostate
epithelial cells. Fusion of the TMPRSS2 promoter with ETS transcription factors, particularly
the ERG gene, is specific for prostate cancer and has been shown to be present in ~ 70% of
tumours (Tomlins, Rhodes et al. 2005; Narod, Seth et al. 2008). The TMPRSS2 promoter
region contains androgen responsive elements and can mediate the overexpression of ETS
family members in prostate cancer (Afar, Vivanco et al. 2001). As mentioned in the previous
section, prostate tumours specimens are highly heterogeneous and thus are likely to contain a
mixture of normal and cancer cells. Therefore, the detection of the TMPRSS2/ERG is useful
to determine the neoplastic nature of prostate cancer cells (Goldstein, Lawson et al. 2008).
8
Disseminated tumour cells (DTC) and minimal residual disease
Because of the progress achieved in early diagnosis and surgical treatment of the
primary tumour, mortality of cancer patients is increasingly linked to metastatic disease (up to
70-90%) (Hoon, Kitago et al. 2006). Depending on the study, 20-30% of patients with
localized prostate cancer develop overt metastasis within the next 5 to 10 years after surgery
and/or radiation. The reason for this clinical behaviour is that even at early stages of the
disease, patients may already harbour disseminated cancer cells (DTC) in their tissues,
sometimes with a latency of several years (= dormancy). Such DTC are able to reach lymph
nodes, peripheral blood, bone marrow as well as other distant sites to ultimately develop into
a clinical manifest macrometastasis. This condition is known as micrometastatic or minimal
residual disease. DTC are not detectable by conventional histopathological analysis (occult
metastasis) and they are resistant to current therapies, i.e. hormonal deprivation or
radiotherapy (Braun and Pantel 1999). This implies that the majority of the patients, even
when undergoing radical prostatectomy, have still a considerable risk to die from subsequent
metastatic relapse. Therefore, it is of high clinical relevance to detect occult DTC before the
clinical occurrence of incurable metastasis. However, the presence of DTC by itself is not
predictive of the clinical outcome of the patient. It is rather the presence of cells with high
proliferative potential within the DTC population, which has a prognostic value (Solakoglu,
Maierhofer et al. 2002). Currently, the uncertainty about the presence of such cells, leads to
overtreatment of patients with toxic agents that cause severe side effects. Early detection of
relevant DTC will help to identify patients in need of additional therapy once the primary
tumour has been surgically removed and will avoid overtreatment of those patients which are
not at risk.
9
Methods for detection of DTC
Approaches for detection of DTC include immunocytochemical and molecular
methodologies. Screening is normally performed in blood or bone marrow samples since the
bone marrow is easily accessible by needle aspiration through the iliac crest and is one of the
most frequent sites of cancer metastasis. The current limit of detection by either methodology
is of 1 DTC in 106 to 107 mononucleated blood or bone marrow cells (Pantel, Brakenhoff et
al. 2008). The detection of such low numbers has become more efficient because of the use of
methods for enrichment previous to the isolation of cells. These methods include gradient
centrifugation followed by immunomagnetic bead isolation, which can be performed based on
the depletion of haematopoietic cells via negative selection of CD45+ cells. Among the
immunocytochemical methods, immunocytochemistry and/or FACS analysis are the most
widely used for their identification. These methods employ monoclonal antibodies against
specific epithelial differentiation antigens such as CK (cytoskeletal proteins, specifically
expressed in epithelial cells), and EpCAM (-epithelial cell adhesion molecule- expressed in
normal and malignant epithelial cells). A method currently in use for blood samples is a
microfluidic platform (CTC chip), which mediates the interaction of DTC with anti-EpCAM
antibody-coated microspots on a chip (Sequist, Nagrath et al. 2009). A different antibody
based approach is provided by the EPISPOT assay, used to detect proteins released by DTC
(Alix-Panabieres, Vendrell et al. 2007). The last two methods allow the detection of viable,
protein-excreting cells, which can be further characterized in vitro.
The detection rates of DTC and its correlation with clinical outcome vary considerably
among research groups (Riethdorf, Wikman et al. 2008). This may be explained by the
different sensitivity and specificity of the detection methods, by the marker used for their
identification and by the lack of a defined marker, which specifically targets, among the DTC
10
population, the cells responsible for metastasis initiation and relapse (metastasis initiating
cells).
Detection of DTC has also been performed at the molecular level using the reverse
transcriptase polymerase chain reaction (RT-PCR) to detect the expression of markers like
PSA, a member of the kallikrein gene family expressed by benign and malignant prostate
epithelial cells (Halabi, Small et al. 2003) and prostate-specific membrane antigen (PSMA)
(Ghossein, Osman et al. 1999; Adsan, Cecchini et al. 2002).
Biological properties of DTC
According to the conventional view, DTC are heterogeneous in their expression of
growth factor receptors, adhesion molecules, proteases, major histocompatibility complex
antigens, and telomerase activity (Pantel and Brakenhoff 2004; Pantel, Brakenhoff et al.
2008). In the last decade, studies on the characterization of DTC have provided important
evidence to support the hypothesis that DTC may possess stem or progenitor cell features (see
below: “Cancer stem cell hypothesis”). For instance, several studies in breast and prostate
cancer DTC have demonstrated the lack of expression of the proliferation marker Ki-67 in a
high proportion of DTC (Schmidt, De Angelis et al. 2004; Muller, Stahmann et al. 2005),
indicating that the majority of DTC may persist in a non-proliferative, dormant state as stem
cells do. Another study in DTC from various solid tumours showed that, at early stages of the
disease, the proliferative potential of DTC rather than their number in bone marrow correlates
with an increased rate of cancer related death and a decreased overall survival (Solakoglu,
Maierhofer et al. 2002). This suggests that within the DTC population not all cells have the
same proliferative potential and only those with a high proliferative potential (stem or
progenitor cells) may be of pathophysiological and clinical relevance.
The methods for DTC detection mentioned in the previous section are based on the
expression of CK or other markers, which define terminally differentiated epithelial cells.
11
Therefore, the possibility remains that CK based identification may not detect stem or
progenitor cells, which do not express markers of differentiation. This is consistent with the
finding that CK-positive DTC can be detected in the bone marrow of patients with early stage
breast cancer that never relapse (Braun, Muller et al. 1998). There is an urgent need for DTC
detection methods to be able to truly identify the metastasis initiating cell and, thus, provide
new insights about the prognostic value and specific biological properties of DTC.
Models of tumour progression
Cancers are composed of a heterogeneous population of cells, which differ in their
potential to reconstitute tumours upon transplantation (Hamburger and Salmon 1977;
Sabbath, Ball et al. 1985). It has been shown for haematological malignancies and solid
cancers that only a small proportion of cells have a high clonogenic potential in vitro and in
vivo (Bonnet and Dick 1997; O'Brien, Kreso et al. 2009). For example, in one of the first
studies, the proportion of cells from either lung cancer, ovarian cancer or neuroblastoma able
to form colonies in soft agar was only 1 in 1,000 to 1 in 5,000 (Hamburger and Salmon 1977).
Two hypotheses arose in order to explain the phenotypical and functional heterogeneity of
cancer cells: the stochastic and the hierarchical model (Reya, Morrison et al. 2001; Dick
2008) (Figure 5). The stochastic model postulates that all cancer cells have the potential to
proliferate extensively and initiate tumours, but the probability that every cell will enter the
cell cycle is low and controlled stochastically by extrinsic and intrinsic factors (Nowell 1976).
Therefore, this model predicts that studying the bulk population should allow the
identification of the key tumour properties. Alternatively, the hierarchical model assumes that
only a small subset of cells (tumor-initiating cells), which have been hypothesized to exhibit
stem or progenitor cell properties (see below: “Cancer stem cell hypothesis”), has the ability
12
to proliferate and initiate tumours, while most cancer cells represent the differentiated
progeny and have only a limited or absent proliferative potential. Thus, eliminating the bulk
of the tumour may not be enough to ensure a definitive tumour remission if the tumour
initiating cells persist. This model suggests that distinct subsets of cells should be identified
within each tumour to confirm their functional characteristics in vitro and in vivo.
Determining which of the two models explains tumour initiation and progression has
important implications in designing therapeutic approaches.
Figure 5. Two models of tumorigenesis. The stochastic model assumes that many cells within
a tumour have the potential to proliferate extensively but its behaviour is influenced by diverse
stochastic factors. The hierarchical model states that only a subset of cancer cells has the
potential to proliferate and maintain the tumour. Both models account for tumour
heterogeneity (Taken from Dick, 2008).
Cancer stem cell hypothesis
The cancer stem cell hypothesis is a direct consequence of the hierarchical model of
tumour progression. Mounting evidence supports this hypothesis, which states that long-term
13
maintenance of tumour growth is sustained by a rare subpopulation of putative cancer stem
cells, which are different from cells constituting the bulk of the tumour and possess properties
that resemble those of their normal stem cell counterparts (Reya, Morrison et al. 2001; Pardal,
Clarke et al. 2003; Dalerba, Cho et al. 2007). Putative cancer stem cells have been
prospectively identified and calculated to exist in a frequency of 0.2% - 1% in leukaemic cells
(Bonnet and Dick 1997; Passegue, Jamieson et al. 2003) and in a proportion of 0.07% - 35%
in different solid tumours (Visvader and Lindeman 2008).
Before exploring the detailed implications of this hypothesis in the haematopoietic
system and in solid tumours it is important to define conceptual differences between stem and
progenitor cells (Box 1). Normal stem cells are required for the maintenance of cell turnover
in tissues, where cells need to be replaced continuously. They are defined as cells that exhibit
four main characteristics: self-renewal capacity, high proliferative potential (even though
most of the time they are slow cycling or maintained in a non-proliferative, quiescent state),
the ability to differentiate into the different types of cells that compose a tissue and their
persistence throughout life (Bonnet and Dick 1997; Reya, Morrison et al. 2001; Tang,
Patrawala et al. 2007). They reside in the stem cell niche, a specialized microenvironment that
regulates proliferative signals and provides an equilibrium between stem cell maintenance and
expansion (Li and Neaves 2006). Most of the knowledge on stem cells has been derived from
the haematopoietic system. In the mouse bone marrow haematopoietic stem cells are
heterogeneous populations of cells composed by “long-term” stem cells that comprise 0.05%
of bone marrow cells and are able to retain their lifelong self-renewal capacity. They develop
into “short-term” stem cells that retain self-renewal in vivo for approximately 8 weeks. Shortterm stem cells generate into multipotent progenitors, which have similar properties to stem
cells, but differ in that they have limited self-renewal and proliferative potential. Multipotent
progenitors in turn, generate lineage restricted progenitors or precursors that lack self-renewal
14
capacity (Morrison, Wandycz et al. 1997; Passegue, Jamieson et al. 2003). Thus, during cell
lineage development cells with distinct self-renewal, proliferative and differentiation abilities
co-exist. In theory, this scheme could be extended to stem cells in other tissues such as
epithelia. However, little is known about most epithelial stem cell lineages.
Box 1. Definition of normal stem and progenitor cells.
Stem cells are rare cells that have four main characteristics:
1. self-renewal potential: ability to form new stem cells with the same
potential for proliferation, expansion, and differentiation, thus
maintaining the stem cell pool (Dalerba, Cho et al. 2007);
2. high proliferative potential: potential to proliferate, while being
quiescent/dormant most of the time.
3. differentiation potential: the ability to give rise to a heterogeneous
progeny of cells, which progressively diversify and specialize according
to a hierarchical process, constantly replenishing the tissue of short lived
mature cells (Dalerba, Cho et al. 2007).
4. persistence through life time
Progenitor cells are cells that still retain, but have a limited proliferative
potential as compared to stem cells.
Cancer stem/progenitor cells
Cancer cells in general, have long been compared to stem cells. Both cell types are
able to self renew and generate different cell lineages, even though cancer cells do so in a
poorly regulated manner (Sell and Pierce 1994). These parallels have suggested the possibility
of applying the principles of stem cell biology to cancer and thus the concept of a “cancer
stem cell”. Normal adult stem cells are known to originate during foetal development, where
embryonic stem cells self-renew and generate adult stem cells that often continue to selfrenew and undergo multi-lineage differentiation to maintain the adult tissues (Figure 6A). The
cellular origin of cancer stem cells still remains elusive. Either they originate from normal
stem cells, or from more differentiated progenitor cells or from both (Figure 6B). In favour of
15
the first option, it can be observed that in order to initiate cancer development a number of
mutations must occur and, in tissues that are commonly a target of neoplastic transformation,
the differentiated cells and restricted progenitors have in general a short life span compared to
stem cells that may persist throughout life. Therefore, it is likely that mutations accumulate in
the stem cells rather in the more differentiated cells. Alternatively, more differentiated
progenitor cells could acquire self-renewal potential, as a result of mutation, and originate
cancer stem/progenitor cells (Sell and Pierce 1994; Reya, Morrison et al. 2001).
Figure 6. Parallel between normal stem cells and cancer stem cells.
Normal somatic stem cells originate from embryonic precursors and
self renew to form daughter stem cells and generate different cell
lineages to maintain adult tissues. Cancer stem cells may arise either
from the mutational transformation of normal stem cells or from more
differentiated progenitor cells that have reacquired self-renewal
potential (Taken from Pardal et al, 2003).
16
Cancer stem/progenitor cells as metastasis initiating cells
The process of cancer metastasis consists of a long series of sequential, interrelated
steps. In this process, the primary tumour is vascularized once it has reached a certain size.
Subsequently, tumour cells detach from the primary tumour and invade the extracellular
matrix. Cells disseminate via the lymphatic and/or blood circulation and extravasate into
secondary organs to establish micrometastases that subsequently grow to develop into
clinically manifest metastases (Nguyen, Bos et al. 2009). One of the key molecular events in
the metastatic cascade is the loss of cell-cell and cell-matrix contact due to the loss of Ecadherin (Christofori and Semb 1999). This process is known as the epithelial-mesenchymal
transition (EMT), characterized by the loss of epithelial characteristics and the acquisition of
mesenchymal phenotype which enables the cells to migrate. Clinical and experimental data
has shown that only a small proportion (0.01%) of cells from the primary tumour can undergo
EMT and complete all the steps of the metastatic process (Fidler 1970; Chambers, Groom et
al. 2002; Gupta and Massague 2006). In fact, there is evidence from prostate and other
cancers that dissemination of tumour cells from the primary tumour is an early event, but the
majority of these cells do not establish metastases (Ellis, Pfitzenmaier et al. 2003; AguirreGhiso 2007).
According to the cancer stem cell hypothesis, a suitable candidate for a metastasis
initiating cell must fulfil two basic requirements: the ability of self-renewal in order to initiate
tumour formation and the capacity to migrate to distant organs. Cancer stem/progenitor cells,
which have retained or regained a migratory phenotype through activation of their intrinsic
EMT program, are therefore potential candidates for metastasis initiating cells. This is an
alternative to the traditional view of cancer metastasis that predicts that metastatic cells are
the result of clonal selection of tumour cells, which possess metastatic potential (Fidler 2003).
Both the cancer stem cell and the clonal selection hypotheses explain the fact that only a
17
minority of cancer cells are able to initiate metastases, but in the first case it is assumed that
cancer stem cells already possess the properties that allows them to undergo the metastatic
process, while in the second case it is predicted that the metastatic process favours the
survival and growth of cells with high metastatic potential. However, these two explanations
are not mutually exclusive since cancer stem cells may be as well targets of clonal selection
(Visvader and Lindeman 2008).
Identification of cancer stem/progenitor cells in human
malignancies
Several criteria to define a cancer stem/progenitor cell have been proposed (Box 2)
(Vescovi, Galli et al. 2006; Tang, Patrawala et al. 2007). Methodologies useful to prove these
criteria were first described for the identification of normal stem/progenitor cells, but have
been adapted to cancer cells. These include: marker based prospective identification,
xenograft models, and functional assays like the sphere and colony formation assays.
Box 2. Criteria to define cancer stem/progenitor cells
1. Cancer-initiating ability: the candidate cancer stem/cell population
should be enriched in cells able to re-initiate tumours, which resemble
the original patient tumour (see below Xenograft models).
2. Self-renewal and high proliferative potential: the candidate cancer
stem/progenitor cell population should be shown to possess
characteristics normally associated with stem cells. For example, through
the sphere and colony formation assays in vitro (see below).
3. Presence of karyotypic or genetic alterations.
4. Aberrant or limited differentiation capacity.
Marker expression based prospective identification
The most commonly used method for the identification cancer stem/progenitor cells is
the use of selected cell surface markers to isolate different subpopulations of cells by flow
18
cytometry and test their clonogenic and self-renewal capacities either in vitro or in vivo. In
prostate cancer tissue CD133, CD44, CD49b and CD49f (α2 and α6 integrins, respectively)
have been widely used. CD133, a glycoprotein localized to membrane protrusions or
microvilli, is the human orthologue for mouse prominin (Weigmann, Corbeil et al. 1997). In
addition to prostate cancer cells (Collins, Berry et al. 2005), it is expressed in normal prostate
tissue (Richardson, Robson et al. 2004), in human hematopoietic stem cells (Yin, Miraglia et
al. 1997), endothelial cells (Peichev, Naiyer et al. 2000), neurons and glia (Uchida, Buck et al.
2000). CD133 is now extensively used as a surface marker to identify and isolate tumour
stem/progenitor cells in various solid cancers. However, results are controversial since in
most of the cases, CD133- cells also exhibit stem cell properties (Cheng, Liu et al. 2009)
CD44, a multifunctional cell surface molecule involved in cell adhesion and signalling
has been used in the identification of putative prostate and breast stem/progenitor cells (AlHajj, Wicha et al. 2003; Patrawala, Calhoun et al. 2006). It is also expressed by
haematopoietic stem cells (Avigdor, Goichberg et al. 2004), mesenchymal stem cells
(Oswald, Boxberger et al. 2004), neural stem/progenitor cells (Schwartz, Bryant et al. 2003),
and mammary stem/progenitor cells (Gudjonsson, Villadsen et al. 2002).
Integrins are integral membrane glycoproteins in cells, which bind to the extracellular
matrix. They are involved in cell-cell interactions and cell shape, orientation and movement
(Hynes 2002). Cells expressing α2 integrin are rapidly adherent to type I collagen (Hudson
2004). Taking advantage of this, it has been found that integrin α2β1high selection enriches for
normal and cancer prostate stem/progenitor cells (Richardson, Robson et al. 2004; Collins,
Berry et al. 2005). Alpha-6 integrin, a laminin binding integrin has also been shown as a
normal and malignant prostate stem/progenitor cell marker (Bello-DeOcampo, Kleinman et
al. 2001; Lawson, Xin et al. 2007). Laminin binding integrins seem to play a role in tumour
19
metastasis since changes in their expression level and distribution often take place during
tumour progression (Ziober, Lin et al. 1996).
Other methodologies based on the expression of markers are the side population (SP)
technique and the ALDH (aldehyde dehydrogenases) based isolation. The SP technique relies
on the ability of stem cells in culture to preferentially express multidrug resistant proteins
such as ABCG2 and MDR-1 (Bhatt, Brown et al. 2003). Nevertheless, it has not been
demonstrated yet whether cells from the SP fulfil the criteria for being stem/progenitor cells
(Brown, Gilmore et al. 2007). ALDH is a family of enzymes that play diverse roles in
detoxification pathways. High level of ALDH activity is a characteristic of stem cells and
represents a marker for the identification of cancer stem/progenitor cells (Burger, Gupta et al.
2009).
It is important to note that none of the markers used to isolate stem cells in various
cancerous tissues are expressed exclusively by stem cells. Additionally, markers that are
useful to identify stem cells in mice are often not useful for identifying stem cells in humans.
Therefore, it is not sufficient to define a stem cell based only on the expression of cell surface
markers. This must be accompanied by functional assays that demonstrate that the candidate
cancer stem/progenitor population contains cells that posses stem cell properties.
Xenograft models
Serial transplantation of xenografted cells is the gold standard assay to demonstrate
both, self-renewal capacity and ability to generate different lineages in a candidate cancer
stem/progenitor cell population (Clarke, Dick et al. 2006). However, this technique has some
limitations. First, the lag phase for tumour development in each passage in most cases can last
up to 6 months (Tang, Patrawala et al. 2007). Secondly, tumours are composed by a variety of
stromal cell types that give support to the tumour initiating cells. The microenvironment of
20
the orthotopic site in the host is still different than that of the human counterpart, and the
tumour cells will need the recruitment of host cells, resulting in a tumour which will not be
the same as the original primary patient tumour. Therefore, because of the species-specificity
of some essential growth factors, it is highly unlikely that a single cell or a small number of
cells will succeed to completely regenerate a tumour when xenotransplanted into a foreign
host. Co-injection of the putative tumour initiating cells with stromal cells (from the same
species) in an extracellular matrix in an orthotopic site is used in order to minimize this
limitation. Incomplete immunosupression is a further limiting issue. Because of the
limitations mentioned above, recent efforts have been devoted to the establishment of
surrogate in vitro assays that can replace the xenograft model.
In vitro colony formation
The ability of epithelial cells to form colonies at a clonal density is an indication of
their proliferative potential. This can be assessed in vitro by the colony formation assay in
which cells are cultured at low density (1000 cells per 10 cm dish) in serum free medium
under adherent conditions. In this assay, both normal (Barrandon and Green 1987) and
neoplastic (Hamburger and Salmon 1977) epithelial cells form three types of colonies:
holoclones, meroclones and paraclones (Figure 7). Holoclones are colonies of large size, a
homogeneous rounded edge and composed of small, densely packed cells (Locke, Heywood
et al. 2005; Li, Chen et al. 2008). Paraclones are small colonies with irregular shape and
composed by large cells in loose reciprocal contact. Meroclones exhibit intermediate features
of size and shape and composed by a mixture of large and small cells (Barrandon and Green
1987; Locke, Heywood et al. 2005). Importantly, holoclones contain stem/progenitor cells
with the highest proliferative potential that are able to generate colonies after serial passages
and, therefore, are considered as a proof for the presence of stem/progenitor cells. In contrast,
21
paraclones and meroclones cannot be serially propagated as colonies, since they are composed
by more differentiated cells, which do not further possess clonogenic potential (Barrandon
and Green 1987; Locke, Heywood et al. 2005; Li, Chen et al. 2008).
Figure 7. In vitro colony formation assay (Guzmán-Ramírez, Völler et al.
2009).
In vitro sphere formation
The sphere formation assay represents a suitable surrogate assay for in vivo serial
xenotransplantation to demonstrate self-renewal potential (Shi, Gipp et al. 2007). The assay
has been originally established for normal neural tissue (Reynolds and Rietze 2005). When
cultured under non-adherent serum free medium conditions, normal adult stem cells from the
nervous system are maintained in an undifferentiated state and form free-floating, spherical
structures named neurospheres. Neurospheres consist of 4%-20% of stem cells, the rest of the
population representing progenitor cells at various levels of differentiation (Reynolds and
Weiss 1996). Comparable structures have been characterized in neural, breast and colon
cancer tissue for the identification of cancer stem/progenitor cells. (Singh, Hawkins et al.
2004; Ponti, Costa et al. 2005; Ricci-Vitiani, Lombardi et al. 2007).
When employing this assay, it is important to bear in mind that the mere generation of
spheres is not an indication of self-renewal capacity. This characteristic can only be attributed
22
to cells by showing their ability to form new spheres in each of several serial passages (Figure
8).
Figure 8. In vitro sphere formation assay. A single cell suspension is cultured under nonadherent and serum-free medium conditions, where it forms spherical structures (spheres) that
enrich for stem/progenitor cells. Spheres should be serially passaged to demonstrate selfrenewal potential of the cells. (Taken from Visvader, 2008).
Haematopoietic cancer stem/progenitor cells
Studies in leukaemia and multiple myeloma demonstrated for the first time that only a
small subset of cancer cells is capable of extensive proliferation. Myeloma cells, separated
from normal haematopoietic cells, were tested for clonogenic potential. Only 1 in 10000 to 1
in 100 cancer cells were able to form colonies at a clonal density (Park, Bergsagel et al.
1971). Other studies showed that when leukaemic cells were transplanted in vivo, only 1-4%
could transfer the disease (Bruce and Van Der Gaag 1963; Bergsagel and Valeriote 1968).
Since these differences in clonogenic potential have also been observed in normal
haematopoietic cells, the clonogenic leukaemic cells were described as leukaemic stem cells
(Park, Bergsagel et al. 1971).
To further prove the hypothesis that only a subset of cells was highly enriched for
clonogenic capacity, Dick and collaborators identified the first cancer stem cell population in
acute myeloid leukaemia (AML) (Bonnet and Dick 1997). This study showed that only 0.01%
to 0.5% of AML cells, restricted to the CD34+CD38– phenotype, proliferated extensively and
were able to transfer leukaemia to immunodeficient mice. Leukaemic cells of different
phenotype were not able to transfer the disease.
23
Cancer stem/progenitor cells in solid tumours
Putative cancer stem/progenitor cells have been identified in many epithelial
malignancies, including breast, brain, colon, pancreas, lung, skin and liver (Al-Hajj and
Clarke 2004).
In human breast cancer, a population of putative tumour initiating cells has been
prospectively identified and isolated based on the expression of surface markers. As few as
100 CD44+/CD24+/Lin- cells were reported to form tumours in mice and could be serially
passaged and generate progeny with diverse phenotypes reproducing the histological
heterogeneity of the original patient tumour. Thousands of cells with different phenotype
failed to form tumours (Al-Hajj, Wicha et al. 2003). Breast cancer cells have also been shown
to grow as non-adherent mammospheres, which can be serially passaged (Ponti, Costa et al.
2005).
Brain cancer stem/progenitor cells have been identified based on the expression of
CD133. One study shows that CD133+ cells exhibit stem cells properties in vitro as well as in
vivo where only the CD133+ tumour fraction contain cells able to generate tumours in
immunodeficient mice. Injection of as few as 100 cells produced a serially transplantable
tumour, which was phenotypically similar to the original tumour. CD133- cells did not cause
tumours even when up to 105 cells were implanted (Singh, Hawkins et al. 2004). However,
another study in gliomas reports that the expression of CD133 does not always correlate with
cancer stem cell activity. In fact, glioblastomas could be propagated from both CD133+ and
CD133- populations (Beier, Hau et al. 2007).
Similarly to brain tumour cancer stem/progenitor cells, colon and lung cancer
initiating cells with the CD133+ phenotype have been found to be enriched in cells able to
generate serially transplantable tumours that recapitulate the original tumour in mice (RicciVitiani, Lombardi et al. 2007; Eramo, Lotti et al. 2008). Both CD133+ colon and lung cancer
24
cells were able to grow as spheres in serum free medium. Colon cancer CD133+ cells grew
exponentially for more than one year in this type of culture while maintaining the ability to
engraft and reproduce the characteristics of the original tumour. However, a recent study in
lung cancer cell lines showed that both CD133+ and CD133- cells, purified by magnetic
isolation, displayed similar abilities of colony formation, self-renewal, proliferation,
differentiation, and invasion, as well as resistance to chemotherapy drugs. These results
suggest that CD133 alone may not be used as a stem cell marker for lung cancer cells (Meng,
Li et al. 2009).
Cancer
stem
cells
have
also
been
identified
in
pancreatic
cancer.
EpCAM+/CD44+/CD24+ cells represent less than 1% of the cells in the tumour. These cells,
when implanted into mice, self-renew, produce differentiated progeny and have a 100-fold
increase in tumorigenic potential when compared to the cancer population that do not express
the markers above. The tumours generated in immunocompromised mice recapitulate the
original patient tumour and the cells maintain the expression of the markers that define the
pancreatic cancer stem/progenitor cells after serial passages as xenografts (Li, Heidt et al.
2007).
Malignant melanoma stem/progenitor cells defined by the expression of the
chemoresistance mediator ABCG2 possess higher tumorigenic capacity and the ability to
regenerate the original tumour heterogeneity as compared to the negative bulk population in
xenografts assays. Administration of an anti-ABCG2 monoclonal antibody was shown to
induce antibody-dependent cytotoxicity in ABCG2+ melanoma cells and caused tumourinhibitory effects (Schatton and Frank 2008; Schatton, Murphy et al. 2008).
A recent study in hepatocellular carcinoma revealed that EpCAM+/APF+ (alphafetoprotein) cells had hepatic cancer stem/progenitor cell properties and could initiate tumours
in immunodeficient mice. Importantly, activation of the Wnt/beta-catenin pathway enriched
25
the EpCAM positive cell population, whereas down regulation of EpCAM, a Wnt/betacatenin signalling target attenuated the activities of these cells (Yamashita, Ji et al. 2009).
It is evident from the findings described above, that there are different markers for the
identification of stem/progenitor cells in different cancers and that, within each cancer there
may exist different stem/progenitor cells. This highlights the need of defining, for each type
of cancer, specific markers that identify all stem/progenitor cells.
Normal and cancer prostate stem/progenitor cells
There is increasing evidence for the existence of stem cells in prostate tissue (Collins
et al., 2005). According to this hypothesis, during normal prostate development, self-renewing
stem cells in the basal cell layer give rise to a population of transit amplifying cells, which in
turn differentiate into terminally differentiated luminal cells, located in the secretory (luminal)
compartment. The cancer stem cell hypothesis applied to prostate, predicts that cancer
stem/progenitor cells may be either stem cells with deregulated self renewal or transit
amplifying cells, which have acquired self-renewal potential. Both possibilities result in
abnormal cell growth (Figure 9).
Figure 9. Stem cell model for prostate differentiation and prostate carcinogenesis. (Curved
arrow: self-renewal potential).
26
Normal prostate stem/progenitor cells
The concept of a prostate stem cell emerged following the work from Isaacs and
Coffey (Isaacs and Coffey 1981), which found that the rat ventral prostate undergoes
involution after androgen deprivation, but can completely regenerate (even after months)
when the hormone levels are restored. This cycle can occur many times. Therefore, it was
hypothesized that a population of androgen-independent stem cells, responsible for the
regeneration of the gland must exist. Prostate stem cells are found in the region closest to the
urethra, denominated the proximal region since there is evidence that the majority of non
cycling cells are located in this region and cells isolated from the proximal region have higher
proliferative capacity in vitro (Tsujimura, Koikawa et al. 2002).
A number of reports suggest that prostate stem cells are located in the basal cell layer.
Basal cells have been shown to preferentially survive androgen ablation and to be able to
differentiate and give rise to luminal cells in vitro, consistent with the existence of stem cells
(English, Santen et al. 1987; Robinson, Neal et al. 1998). There is also evidence that the
majority of proliferating cells are located in the basal compartment (Bonkhoff, Stein et al.
1994), where several molecules important for self-renewal and differentiation potential like
Notch-1 (Shou, Ross et al. 2001) and p63 (Signoretti, Waltregny et al. 2000) exclusively
localize. In addition most, if not all, cells possessing extensive clonogenic capacity, have a
basal cell phenotype (Hudson, O'Hare et al. 2000).
Several candidate populations of stem/progenitor cells in the normal human prostate
have been reported. The subpopulation of cells expressing CD44+/α2ß1high/CD133+, which
represents approximately 0.75% of the prostate epithelial cells, was shown to possess higher
colony forming efficiency and to be able to reconstitute prostatic-like acini in 20% recipient
nude mice (Richardson, Robson et al. 2004). However, the CD133- population also contained
clonogenic cells suggesting the possibility that these markers may still exclude a fraction of
27
stem/progenitor cells. In a recent study, an additional marker, tumour associated calcium
signal transducer 2 (Trop-2), in combination with CD49f, has been found to enrich for sphere
formation capacity in normal prostate. CD49f+/Trop-2high cells could be serially passaged as
prostaspheres up to three generations (Goldstein, Lawson et al. 2008). Another subset of cells
that co-express CK5, CK18, CK19 and p63, resembling transit-amplifying cells, has also been
proposed as putative prostate stem/progenitor cell population (Wang, Hayward et al. 2001).
The SP technique has also been used in the identification of prostate stem/progenitor cells.
The SP fraction represents approximately 1.4% of the epithelial cells in benign prostate
hyperplasia samples and the majority of them are in the G0-G1 phase of the cell cycle (Liu,
True et al. 1997).
Normal stem/progenitor cells have been reported as well in the mouse prostate.
Sorting for Sca-1+/CD49f+ mouse prostate cells results in a 60-fold enrichment for colonyand sphere formation capacity. These cells can self-renew and expand as sequential
generations of spheres and differentiate to produce prostatic tubule structures containing both
basal and luminal cells in vivo (Lawson, Xin et al. 2007). More recently, Trop-2 was found to
be enriched in the mouse prostate after castration, in sphere forming cells and in the basal
fraction. Sca-1+CD49f+Trop-2high basal cells were able to generate prostatic tubules in vivo
including basal, luminal and neuroendocrine cells, whereas the remaining basal cells had
minimal activity (Goldstein, Lawson et al. 2008). A recent study has identified CD117 (c-kit,
stem cell factor receptor) as a new stem/progenitor marker in normal mouse prostate. A single
cell defined by the phenotype Lin-/Sca-1+/CD133+/CD44+/CD117+ can regenerate a
functional, secretion-producing prostate after transplantation in vivo. CD117 expression is
predominantly localized to the region of the mouse prostate proximal to the urethra and is
upregulated after castration induced prostate involution. Furthermore, CD117+ cells have long
28
term self-renewal capacity, as evidenced by serial transplantation in vivo (Leong, Wang et al.
2008).
Cancer prostate stem/progenitor cells
The identification of putative prostate cancer stem/progenitor cells has been attempted
using mouse xenografts of human cancer cells, cell lines and human prostate tissue. Studies
on xenograft models have shown that the highly purified CD44+ prostate cancer cell fraction
has a 100-fold higher tumour-initiating capacity than the CD44- fraction. Additionally,
xenografted CD44+ cells express higher mRNA levels of several putative stem cell markers
including Oct-3/4, Bmi, β-catenin, and Smoothened and can differentiate to generate CD44cells (Patrawala, Calhoun et al. 2006). A later study showed that the CD44+ population can be
further fractionated based on the expression of α2ß1 integrin to enrich for prostate cancer
stem/progenitor cells. CD44+/α2ß1high cells showed the highest tumour initiating potential
compared to populations with alternative phenotypes (Patrawala, Calhoun-Davis et al. 2007).
Evidence of the presence of prostate cancer stem/progenitor cells has also been found
in human prostate cancer cell lines. The fact that often hundreds of thousands of long-term
cultured cells are necessary to establish a tumour in mice already suggests that cell lines may
contain rare stem/progenitor cells with high proliferative potential. In fact, in a recent study
using the prostate cancer cell line PC3, it was demonstrated that holoclones contained cells
that can initiate serially transplantable tumours and can be serially passaged while
regenerating new holoclones, meroclones and paraclones. In contrast, meroclones and
paraclones could not be continuously propagated and failed to initiate tumour development
(Li, Chen et al. 2008). This suggested that not all cells in a cell line have the same
proliferative and self-renewing potential and that a hierarchy is maintained in long-term
cultured cell lines.
29
Flow cytometry analysis on LNCaP cells showed that CD44+/CD24- cells form
colonies in soft agar and generate tumours in immunodeficient mice when as few as 100 cells
are injected. These cells can be maintained as spheres in serum free medium (Hurt, Kawasaki
et al. 2008). Another prostate cancer cell line, the Du145, has been investigated for the
presence of prostate cancer stem/progenitor cells. Du145 cells with the CD44+/α2β1+/CD133+
phenotype have the capacity for self-renewal, extensive differentiation potential and high
proliferative and tumorigenic potential as compared with the negative fraction (Wei, Guomin
et al. 2007).
Studies using telomerase immortalized epithelial cells from primary prostate tumours
showed that these cells are able to reconstitute the original human tumour in vivo after serial
transplantation and differentiate into the three prostate epithelial cell lineages, suggesting their
self-renewal and differentiation potential (Gu, Li et al. 2006; Gu, Yuan et al. 2007).
Additionally,
the
cell
population
identified
by
the
phenotype
CD44+/α2β1+/CD133+/EpCAM+/CK18+/AR-/PSA- exhibit high proliferative potential and the
ability to differentiate into an AR+ phenotype (Miki, Furusato et al. 2007). The
immortalization model described above has however some limitations given that in vitro
selection may influence the transformed cell phenotype. Additionally, telomeraseimmortalized cell lines from normal epithelium have been shown to possess abnormal
karyotypes.
Conclusive demonstration of the presence of cancer stem/progenitor cells from freshly
isolated human primary prostate tissue has not been reported so far. There are a number of
limitations associated with patient samples including limited access to biopsy material, the
suspected small proportion of the cells of interest, the multifocality of the cancer location
within the prostate and the characteristic heterogeneity of prostate tumours between patients
and even within the same sample. However, a study conducted on radical prostatectomy
30
specimens reported a putative prostate cancer stem/progenitor cell population restricted to the
CD44+/α2β1+/CD133+ phenotype (Collins, Berry et al. 2005). This subpopulation was shown
to possess higher proliferative, self-renewal and invasive potentials in vitro than the negative
population and to be able to regenerate more differentiated populations of non-clonogenic
cells. These observations suggest that patient prostate tumours may also contain
stem/progenitor cells. However, in addition to the fact that direct demonstration of the
neoplastic origin of the putative cancer stem/progenitor cells is lacking in this study, the
original tissue was submitted to long term culture before performing the characterization of
the cells, which may cause variations in their phenotype. Additionally, the tumorigenic
potential of these cells remains to be determined in vivo.
Therapeutical implications of the cancer stem cell hypothesis
The potential existence of cancer stem/progenitor cells involved in the maintenance
and metastasis of tumours will have important implications in the way cancer treatment
should be conceived and the design of future therapeutic approaches. Current therapies target
rapidly dividing cells that comprise the bulk of the tumour while the cancer stem/progenitor
cell fraction may remain viable and re-initiate tumour growth. These approaches are,
therefore, unlikely to be successful and relapse is to be expected. Effective tumour eradication
will require specific targeting of cancer stem/progenitor cells (Figure 10) (Allan, Vantyghem
et al. 2006; Clarke, Dick et al. 2006).
31
Figure 10. Implication of the cancer stem cell hypothesis for cancer
therapy (taken from Reya, 2001).
Preliminary evidence from several solid tumours indicates that cancer stem/progenitor
cells are preferentially resistant to the effects of both, radiation and chemotherapy consistent
with their slow cycling/dormant nature and the preferential expression of detoxifying
enzymes (O'Brien, Kreso et al. 2009). Studies in xenograft models have shown that CD133+
colon and pancreatic cancer cells are more resistant to currently used chemotherapy agents
than the negative population (Hermann, Huber et al. 2007; Todaro, Perez Alea et al. 2008).
Interestingly, one study in breast cancer has attempted to correlate a cancer stem/progenitor
cell population with clinical outcome. This study tested the effect of an epidermal growth
factor receptor/HER2 pathway inhibitor on CD44+CD24- breast cancer cells in patients with
advanced disease. The results revealed that treatment with conventional chemotherapeutic
agents, namely, docetaxel or cyclophosphamide, caused an enrichment of CD44+CD24- cells
and increased sphere formation efficiency. Furthermore, after chemotherapy, these cells were
also shown to have an increased self-renewal potential in vivo. Combined treatment with the
HER2 inhibitor and conventional therapy prevented the enrichment of CD44+CD24- cells (Li,
Lewis et al. 2008).
32
Studies in brain tumours have addressed the association of radioresistance with the
presence of stem/progenitor cells. In a glioma xenograft model it was shown that CD133+
cells were significantly increased and had a survival advantage after radiation as compared to
the parental tumour. The increased survival was a result of the activation of DNA damage
response (Bao, Wu et al. 2006).
In prostate cancer, the most challenging clinical task is the treatment of androgenindependent spread disease. Androgen deprivation is the standard therapeutic approach in the
treatment for advanced disease. Prostate cancer stem/progenitor cells do not express androgen
receptor and thus are androgen independent for growth. Instead, the majority of cells in the
tumour are androgen dependent for growth. Therefore, androgen deprivation would eliminate
the bulk of the tumour while having no effect on the stem/progenitor cells. This could
obviously explain the resistance to androgen ablation therapy and the fact that androgen
deprivation does not significantly affect prostate cancer mortality or symptom-free survival
(Studer, Whelan et al. 2006). Recent reports show that androgen ablation may favour the
enrichment of cancer stem/progenitor cells and may negatively affect patient survival (Huss,
Gray et al. 2005; Iversen, Johansson et al. 2006; Wirth, Hakenberg et al. 2008). Accordingly,
new therapies for prostate cancer and other carcinomas should interfere with key stem cell
properties to sensitize cancer stem/progenitor cells. Some potential mechanisms to target
stem/progenitor cells include interference with self-renewal, differentiation therapy and
inhibition of drug transporters.
Self-renewal is the most important feature of stem cells. Evidently, interference with
this process may have a potential therapeutic application. So far treatments with agents that
target key self-renewal signalling pathways like Shh (Sonic hedgehog) and Wnt have been
successful in some cases (Galmozzi, Facchetti et al. 2006). Treatment with Shh pathway
inhibitors like cyclopamine, anti-Hedgehog antibodies and siRNAs against Gli have been
33
shown to abrogate the growth of medulloblastoma and prostate cancer in murine models
(Karhadkar, Bova et al. 2004; Romer, Kimura et al. 2004; Stecca, Mas et al. 2005). An
indirect way to hamper self-renewal in stem/progenitor cells is to induce cell differentiation.
In a xenograft model of glioblastoma, the exposure to BMP4 (bone morphogenic protein 4)
induced differentiation and abolished the ability of transplanted glioblastoma CD133+ cells to
establish tumours and resulted in a reduction in proliferation and increased expression of
markers of differentiation. A decrease in the CD133+ population which correlated with
reduced clonogenic potential was also observed (Piccirillo and Vescovi 2006).
Another property of stem cells, which could be clinically relevant, is the expression of
ATP-binding cassette transporters (ABCG2 and ABCG5) and multidrug resistance protein 1
(MDR1). These proteins pump drugs out of the cell and, thus, might be involved in drug
resistance. Inhibition of these proteins could make the cells more susceptible to current o
newly designed therapies. In fact, the expression of ABCG5 is correlated with clinical
melanoma progression and inhibition of ABCG5 with a monoclonal antibody significantly
reduced tumour growth (Schatton, Murphy et al. 2008).
The challenge of the future therapeutic approaches, however, is targeting cancer
stem/progenitor cells while sparing normal tissue stem cells, which utilize the same selfrenewal pathways and most likely express the same surface proteins.
34
AIM OF THE THESIS
Given the necessity of developing new diagnostic and therapeutic approaches for the
treatment of prostate cancer, this project aimed at the following: first, characterizing cells
with stem/progenitor cell properties, which may be involved in the maintenance of prostate
cancer and current therapy failure; second, identifying candidate markers for the detection of
prostate cancer stem/progenitor cells in primary prostate tumours from clinical specimens
and, third, using this set of markers to identify cells with stem/progenitor cell characteristics
within the DTC population. In this manner, this work represents an important contribution to
the main clinical challenge in prostate cancer: the identification of cells responsible for the
development of castration resistant prostate cancer and metastatic relapse.
35
MANUSCRIPT IN PRESS
Introduction
According to the cancer stem cell hypothesis, tumour growth is sustained by a
subpopulation of cancer stem/progenitor cells, which possess self-renewal and high
clonogenic potential. Our working hypothesis supports the idea that the cancer stem cell
model can be extended to prostate cancer. Therefore, we investigated whether clinical
specimens of human prostate cancer contain cells with stem/progenitor cell properties. The
manuscript below, which will be published in The Prostate, describes how we demonstrated
the presence of cells with self-renewal and high clonogenic potential in clinical prostate
cancer tissue specimens by means of the prostaspheres generation assay. Additionally, we
characterized prostasphere-generating cells at the mRNA and protein levels. From these
analyses, we find that prostasphere-generating cells express a characteristic set of putative
stem cell markers and markers of the transit/amplifying compartment of the prostate
epithelium. PSCA emerged as the most promising marker for the detection of self-renewing,
clonogenic cells in human prostate cancer tissue. These markers may be useful for the
identification of cancer stem/progenitor cells among the DTC population and, therefore, of the
prostate cancer patients at risk of metastatic relapse.
36
The Prostate
InVitro Propagation and Characterization of
Neoplastic Stem/Progenitor-Like Cells From
Human Prostate CancerTissue
Natalia Guzmán-Ramı́rez,1 Maureen Völler,2 Antoinette Wetterwald,1
Markus Germann,1 Neil A. Cross,3 Cyrill A. Rentsch,1 Jack Schalken,2
George N. Thalmann,1 and Marco G. Cecchini1*
1
Departments of Urologyand Clinical Research,University of Bern, Bern, Switzerland
Department of Urology, Radboud University Nijmegen Medical Centre, Nijmegen,The Netherlands
3
Biomedical Research Centre, Sheff|eld Hallam University, Sheff|eld,UK
2
BACKGROUND. According to the cancer stem cell hypothesis, tumor growth is sustained by a
subpopulation of cancer stem/progenitor-like cells. Self-renewal and high clonogenic potential
are characteristics shared by normal stem and neoplastic stem/progenitor-like cells. We
investigated whether human prostate cancer specimens contain cells with these properties.
METHODS. Self-renewal and clonogenic potential were assessed by serial passaging of
spheres and colony formation, respectively. Gene expression was analyzed by real time PCR.
Protein expression was detected by immunocytochemistry. The neoplastic nature of the cells
was verified by detection of the TMPRSS2/ERG gene fusion expression.
RESULTS. The epithelial fraction isolated from surgical specimens generated colonies in 68%
(19/28) of the patients. Laminin adhesion selected for cells with high clonogenic potential. The
epithelial fraction from 85% (42/49) of the patients generated primary prostaspheres. Serial
passaging of prostaspheres demonstrated their self-renewal capacity, which is also supported
by their expression of the stem cell markers Oct-4, Nanog, Bmi-1, and Jagged-1 mRNA. Cells
derived from prostaspheres were more clonogenic than the parental epithelial fraction. The
pattern of mRNA expression in prostaspheres resembled that of the basal compartment of the
prostate (CK5þ/CK14þ/CK19high/CK18/low/c-metþ/AR/low/PSA/low), but also included
stem cell markers (CD49bþ/CD49fþ/CD44þ/DNp63þ/Nestinþ/CD133þ). The distribution
of marker expression in prostaspheres suggests their heterogeneous cell composition.
Prostaspheres expressed significantly higher PSCA mRNA levels than the epithelial fraction.
CONCLUSION. Human prostate cancer specimens contain neoplastic cells with self-renewal
and clonogenic potential, which can be enriched and perpetuated in prostaspheres. Prostaspheres should prove valuable for the identification of prostate cancer stem/progenitor-like
cells. Prostate # 2009 Wiley-Liss, Inc.
KEY WORDS:
prostaspheres; cancer stem/progenitor-like cells; self-renewal; PSCA;
CD49f
Additional Supporting Information may be found in the online
version of this article.
Abbreviations: AR, androgen receptor; CaP, prostate cancer; CK,
cytokeratin; MEM, minimal essential medium; PBS, phosphate
buffered saline; PSA, prostate specific antigen; PSCA, prostate stem
cell antigen; S/P-like, stem/progenitor-like.
Grant sponsor: 6th Framework Program of the European Community; Grant number: PROMET-018858; Grant sponsor: Department of
Clinical Research, University of Bern.
Cyrill A. Rentsch’s present address is Department of Urology,
University Hospital Basel, Basel, Switzerland.
2009 Wiley-Liss, Inc.
*Correspondence to: Marco G. Cecchini, Departments of Urology
and Clinical Research, Urology Research Laboratory, University of
Bern, Murtenstrasse 35, CH3010 Bern, Switzerland.
E-mail: [email protected]
Received 27 February 2009; Accepted 24 June 2009
DOI 10.1002/pros.21018
Published online in Wiley InterScience
(www.interscience.wiley.com).
2
Guzma¤n-Ram|¤ rez et al.
INTRODUCTION
The cancer stem cell hypothesis postulates that
tumor growth is sustained by a rare subpopulation of
putative cancer stem/progenitor-like (S/P-like) cells,
sharing the principal characteristics, namely selfrenewal, clonogenicity and multipotency, with normal
adult stem cells [1–3]. This has important implications
in the way cancer treatment should be conceived
and future therapeutic approaches will be designed.
Current therapies target rapidly dividing cells that
comprise the bulk of the tumor while the cancer
stem/progenitor cell fraction may remain viable and
re-initiate tumor growth. Effective cancer treatment
will additionally require the specific targeting of the
S/P-like cell subset [3,4].
Putative cancer S/P-like cells have been identified in
hematological malignancies [5], as well as in many
epithelial tumors including carcinomas of the breast
[6], colon [7], lung [8], and pancreas [9]. The identification of putative prostate cancer (CaP) S/P-like cells
has been attempted using human CaP cell lines in vivo,
as xenografts [10], and in vitro [11–13]. In human CaP
tissue putative, cancer S/P-like cells have been
þ
reported as being CD44þ/a2 bþ
1 /CD133 cells, which
possess the capacity to propagate in long-term serial
culture [14].
Self-renewal and clonogenic potential are two of the
most representative characteristics of normal stem
cells. Functional assays developed to assess these
properties in vitro are the sphere and the colony
formation assays. When cultured under non-adherent
conditions normal, adult stem cells from the nervous
system and from the mammary gland form freefloating, spherical structures named neurospheres
[15] and mammospheres [16], respectively. Comparable structures are generated by neoplastic cells derived
from glioblastoma [17] and mammary cancer [18]. The
ability of cells to generate spheres after serial passages
in vitro demonstrates their self-renewal potential. In
turn, clonogenic potential can be assessed by the ability
of both normal [19] and neoplastic epithelial cells [20] to
form colonies at a clonal density.
Previous attempts to identify human CaP S/P-like
cells have been performed after prospective selection of
cells based on the expression of known surface stem cell
markers [14]. A functional identification and characterization of neoplastic S/P-like cells in human CaP
specimens by means of the sphere formation assay has
not been reported yet.
In this study we demonstrate that human CaP tissue
contain cells with self-renewal potential, as assessed by
the generation of free-floating spheres (prostaspheres)
when cultured under non-adherent and serumfree, defined medium conditions. We also show that
The Prostate
CaP-derived prostaspheres are enriched in neoplastic
cells with clonogenic potential and express several
embryonic and adult stem cell markers together with
markers of the stem/progenitor cell compartments of
the normal human prostate.
MATERIALS AND METHODS
Tissue Collection and Epithelial Fraction Enrichment
Human prostate tissue was obtained from CaP
patients undergoing radical prostatectomy at the
Department of Urology, University of Bern, Switzerland. Tissue sampling was approved by the local ethical
committee of the Canton of Bern and informed
consent was obtained from all patients. The tissue
was digested overnight in a solution containing
200 U/ml collagenase I (Worthington, Bioconcept,
Allschwil, Switzerland) 30 U/ml DNAse I (Roche,
Basel, Switzerland) and 0.1 mg/ml hyaluronidase
(Sigma, Buchs, Switzerland) in serum-free CnT-52
(CELLnTEC, Bern, Switzerland) medium. Disaggregated tissue was passed through an 18G needle
and washed with PBS. A single cell suspension was
obtained after sieving through a 100 mm cell strainer
(BD FalconTM, BD Biosciences, Allschwil, Switzerland)
and a 30 mm Filcon filter (Consul T.S, Keul, Steinfurt,
Germany). The freshly isolated whole epithelial fraction of the prostate tissue, referred from now on as the
‘‘epithelial fraction,’’ was separated from the stromal
fraction by low speed centrifugation at 200g for 1 min.
All cultures and assays were performed in serum-free
CnT-52 (CELLnTEC) medium.
Because of the priority assigned to the pathological
evaluation, for each patient only a limited amount of
tissue was available for investigation. Therefore, not all
of the assays listed below could be performed for each
of the patients (n ¼ 49).
Differential Substrate Adhesion
The single cell suspension obtained from the
epithelial fraction was further selected based on the
differential adhesion to either collagen or laminin
coated dishes (BD BiocoatTM, BD Biosciences). Cells
were plated at an average density of 1 104 cells/cm2
and allowed to adhere for 20 min at 378C. After gentle
swirling, non-adherent cells were removed for further
analysis. Cells adherent to collagen, laminin or plastic
were washed three times with 1 PBS and released
from their substrate after incubation with 1 trypsin for
5 min at 378C. Both, adherent and non-adherent cells
were tested in the clonogenic assay. Because of the
limited yield of cells after laminin/collagen adhesion,
adherent cells were not tested in the self renewal assay.
Self-Renewing Cells in Human Prostate Cancer
Clonogenic Assay
The clonogenic potential of cells from the epithelial
fraction of 28 patients was analyzed directly in
the clonogenic assay. For a subset of five of these
patients this was compared with the clonogenic
potential of cells selected by adhesion to either collagen
or laminin. For another subset of five patients the
clonogenic potential of cells derived from prostaspheres was compared to that of their original epithelial
fraction.
Single cell suspensions were plated in regular 10 cm
diameter Petri dishes (Falcon) at the clonal density of
1,000 cells per dish. After an average of 15 days of
culture, colonies were fixed with citrate buffered
acetone for 10 min, stained with crystal violet for
additional 10 min, and washed twice with 1 PBS.
Colonies were scored when having a minimum diameter of 2 mm. Holoclones were identified as colonies of
large size with an homogeneous rounded edge and
composed of small, densely packed cells. Paraclones
were considered as small colonies with irregular
shape and composed by large cells in loose reciprocal
contact. Meroclones were identified as colonies with
intermediate features of size and shape and composed
by a mixture of large and small cells [21]. Colonies were
quantified as total number of colonies, including
holoclones, meroclones and paraclones and as number
of holoclones only.
Self-Renewal Assay
Single cell suspensions either from the epithelial
fraction or from pooled colonies were plated on
ultra low adherent wells (Corning, Vitaris, Baar,
Switzerland) at a density of 1 104 cells/cm2. Fresh
medium was added every 3 days. After a maximum of
12 days, pooled prostaspheres were collected by
centrifugation at 200g for 5 min and digested with 1
trypsin for 4 min at 378C. A single cell suspension was
obtained after sieving through 30 mm Filcon filter
(Consul T.S). Single cell status was confirmed microscopically. Cells were re-plated and cultured as
above for serial generation of new prostaspheres. The
proportion of sphere-generating cells in four serial
passages was calculated by dividing the number of
cells seeded by the number of prostaspheres [22].
Gene Expression Analysis
RNA extraction from the epithelial fraction and
from prostaspheres was performed with RNeasy
mini kit (Qiagen, Hombrechtikon, Switzerland) according to the manufacturer’s instructions. RNA concentration and protein contamination was determined
using Nanodrop (Witec AG, Littau, Switzerland).
The Prostate
3
RNA was subjected to reverse transcription using
Superscript III (Invitrogen, Karlsruhe, Germany),
random hexamer primers (Promega, Dübendorf,
Switzerland) and RNAse inhibitor (Roche Diagnostics,
Rotkreuz, Switzerland). Human specific real-time
PCR primers and fluorescent reporter probes (Supplementary Table I) were purchased from Applied
Biosystems (-TaqMan gene expression assays- Rotkreuz, Switzerland). Real-time PCR was performed
with an ABI Prism 7700 Sequence Detection System
(Applied Biosystems).
Immunocytochemistry
Prostaspheres were suspended in PBS and cytocentrifuged at 300 rpm for 5 min onto glass slides.
Alternatively, prostaspheres were suspended 1:1 (v/v)
in a mixture of 89% rat tail collagen (BD Biosciences),
9% 10 MEM and 2% 1.3 M NaOH in 24 wells dishes.
The suspension was gelled at 378C and gels from
each well were transferred to a glass slide. Dry collagen
layers were obtained as previously described [23].
Prostaspheres prepared in either way were fixed
in ice cold acetone and stained with antibodies
against the following molecules: CD49b, CD49f,
CD44, CD24, p63 (all from Pharmingen, BD Biosciences), c-met (Santa Cruz Biotechnologies, LabForce,
Nunningen, Switzerland), CD133/1 (Miltenyi Biotec,
Bergisch Gladbach, Germany), Cytokeratin (CK)
14 (Abcam, Cambridge, UK), CK 18 (Dako, Glostrup,
Denmark), Nestin (Chemicon, Lucernachem, Lucerne,
Switzerland), Androgen Receptor (AR) (Novocastra,
Medite, Nunningen, Switzerland) prostate stem cell
antigen (PSCA) (Invitrogen) and prostate specific
antigen (PSA) (Dako). Biotinylated secondary antibodies followed by streptavidin/horseradish peroxidase conjugate (Amersham, Biosciences, UK) and
3-Amino-9-ethyl-carbazole (AEC, Sigma) were used
as detection system and chromogen, respectively.
Detection of TMPRSS2/ERG Gene FusionTranscripts
Detection of the TMPRSS2/ERG gene fusion was
performed by nested PCR in cDNA obtained from the
freshly isolated epithelial fraction, prostaspheres
and from non-matched, non-cancerous prostate tissue.
The following primers were used: external set, caggaggcggaggcgga (forward) and ggcgttgtagctgggggtgg
(reverse); inner set, gcctggagcgcggca (forward) and
gcgtaggatctgctggcacgat (reverse). The DuCaP and
LNCaP cell lines were used as positive and negative
controls, respectively. A touch down PCR program
with 38C decrease in the annealing temperature every
three cycles from 658C to 558C was used. The expected
size for the inner set is 390 bp (TMPRSS2 exon1 to ERG
exon 4). For some patients, an additional band at 170 bp
4
Guzma¤n-Ram|¤ rez et al.
is also visible (TMPRSS2 exon 1 to ERG exon 5).
PCR products were separated by electrophoresis in a
1% agarose gel for 45 min at 85 V. b-Actin was used as a
loading control. Products were visualized using a
VersaDoc imaging system (Bio-Rad).
Statistical Analysis
GraphPad Prism Version 4 (GraphPad Software,
Inc.) was used for all statistical analysis. The one-way
ANOVA test was used for comparing the number
of colonies in different subpopulations of cells.
The two-way ANOVA test was used to compare
mRNA expression between epithelial fractions and
prostaspheres. The paired Student’s t test was used
to compare PSCA gene expression levels between
epithelial fractions and prostaspheres. A P-value
<0.05 was considered significant.
RESULTS
CaP Cells Possess Clonogenic Potential InVitro and
They Can be Enriched by Adhesion to Laminin
The clonogenic potential can be assessed in vitro
by the colony formation assay, in which cells are
cultured at low density in serum-free medium. Under
these conditions epithelial cells generate three types
of colonies: holoclones, meroclones, and paraclones.
Holoclones contain stem/progenitor cells with the
highest proliferative potential that are able to
generate colonies after serial passages and, therefore,
are considered as a proof for the presence of S/P-like
cells [11,21]. Instead, paraclones and meroclones
cannot be serially propagated as colonies, since they
are composed by more differentiated cells, which do
not further possess clonogenic potential [19,21].
When plated at clonal density (1,000 cells/10 cm
diameter dish) cells from the epithelial fraction of
68% (19/28) of the patients generated holoclones,
meroclones, and paraclones (Fig. 1A). The typical
morphology of these colonies is shown in Supplementary Figure 1. The total number of colonies varied
from 1 to 11 per 1,000 cells plated after an average of
15 days in culture (Fig. 1B). The number of holoclones
varied from 1 to 4 per 1,000 cells (Fig. 1C).
The clonogenic potential was also tested with cells
selected by adhesion to either collagen or laminin. Cells
selected by adhesion to either substrate showed a
tendency to form a higher number of total colonies as
compared to the original epithelial fraction and to the
non-adherent cells (Fig. 1B). However, a significantly
higher number of holoclones was generated exclusively by cells selected by adhesion to laminin,
suggesting the enrichment of cells with high proliferative capacity (Fig. 1C).
The Prostate
Fig. 1. Clonogenic capacity of the CaP derived epithelial fraction.
Macroscopic aspectofcolony typesgeneratedbyplating1,000cellsin
a10 cmdiameterdish(A).Totalnumberofcolonies(B)andholoclones
(C) scored in cultures derived from the epithelial fraction, and from
collagen- and laminin-adherent (adh.) and non-adherent cells after
11days of culture (n ¼ 5; *P < 0.05).
Self-Renewing Cells in Human Prostate Cancer
CaP Cells Exhibit Self-Renewal Capacity InVitro
The sphere generation assay [24] was used to
determine the self-renewal capacity of cells from the
CaP epithelial fraction. Many of the cells in this fraction
died under non-adherent conditions, but a number of
cells survived forming spherical structures in suspension, which can be clearly distinguished from cell
aggregates by phase contrast microscopy (Fig. 2A,B).
Spheres derived from in vitro transformed human
prostate cell lines have been named prostaspheres [25]
by analogy to neurospheres [15] and mammospheres
[16]. A minimum amount of 0.3 g of tissue was
determined to be needed to provide for a sufficient cell
yield to generate prostaspheres. Cells from the epithelial
fraction of 85% (42/49) of the patients generated primary
prostaspheres, ranging from 50 to 150 mm in diameter,
within 4–5 days of culture. For those seven patients
(15%), in whom spheres failed to develop, the amount of
starting material was below the limit mentioned above.
For most patients the amount of original CaP tissue
was too low to perform a systematic, parallel analysis of
self-renewal, of marker expression and of clonogenic
potential of primary prostaspheres. Nevertheless,
when sufficient original CaP tissue was available, we
were invariably able to propagate second-generation
prostaspheres (26/26). Prostaspheres from 14 of
these 26 patients were used for mRNA and protein
expression analysis. Prostaspheres from the remaining
5
12 patients were all able to initiate a third-generation.
We could further propagate a fourth generation of
prostaspheres from nine out of nine patients. The
number of cells still available from four patients allowed
us to obtain a fifth generation of prostaspheres for all
four patients. A large amount of cancer tissue was
available only for two patients. In these patients, analysis
of self-renewal was possible up to six serial passages
(Table I). The capacity of prostaspheres to be serially
passaged indicates self-renewal potential in a subpopulation of the epithelial fraction freshly isolated
from human CaP. For one patient the proportion of
prostasphere-forming cells was calculated in each of the
four serial passages. The average proportion of prostasphere forming cells was 0.47% and no significant
variation among the serial passages was observed
(Supplementary Fig. 2). Interestingly, when the sphere
generation assay was performed using cells derived
from pooled colonies generated by the freshly isolated
epithelial fraction, no sphere formation was observed
after up to 20 days of culture (n ¼ 2) (not shown).
Prostaspheres Contain Cells of the Stem and
Transit/Amplifying Compartments of the
Prostate Epithelium
The mRNA expression of pan-epithelial and prostate specific markers was analyzed to determine the
phenotype of the cells composing the prostaspheres.
Fig. 2. Prostaspheres gene expression profiling. Phase contrast images of a representative primary prostasphere after 5 days of culture
(A) and of a cell aggregate (B). mRNA expression of pan-epithelial and prostate specific markers in patient matched epithelial fraction (C) and
prostaspheres (D) (n ¼ 5; *P < 0.05).Error barsrepresent the standard error.
The Prostate
6
Guzma¤n-Ram|¤ rez et al.
TABLE I. Serial Propagation of Prostaspheres
Prostasphere generation
(G) number
G1
G2
G3
G4
G5
G6
Number of patient samples
able to form spheres (%)
42/49
26/26
12/12
9/9
4/4
2/2
(85)
(100)
(100)
(100)
(100)
(100)
When compared to the epithelial fraction, the
expression of the luminal differentiation markers
CK18, PSP94, AR, and PSA tended to decrease in
prostaspheres. The expression of the basal markers
CK5, CK14, CK19, and c-met tended to increase, with
only CK19 showing a significantly higher level of
expression in prostaspheres (Fig. 2C,D).
This pattern, resembling that of the transit/
amplifying compartment of the normal prostate
epithelium, was consistently common to the prostaspheres generated from all CaP specimens, regardless of the ordinal number of generation. The epithelial
origin of the cells composing the prostaspheres was
confirmed by low or absent expression of the stromal
markers calponin and transgelin [26] (not shown).
Cells Derived From the CaP Epithelial
Fraction and Prostaspheres Express
Stem/Progenitor Cell Markers
The mRNA expression of the known embryonic
markers Nanog and Oct-4 [27], of the adult stem cell
markers Bmi-1 [28], Jagged-1 [29], Hes-1 [30], Patched,
Smoothened [31], Nestin [32], and CD201 [33], of the
normal epithelial and/or cancer, putative stem/
progenitor cell markers CD49b (alpha-2 integrin) [34],
CD49f (alpha-6 integrin) [35], CD44 [36], CD24 [13],
CD133 [37], DNp63 [38], and PSCA [39] was analyzed.
All these markers were found to be expressed
by both the epithelial fraction and patient matched
prostaspheres with no significant differences in the
expression level (Fig. 3A,B). The only exception was
PSCA, which showed a significantly increased expression in prostaspheres.
Prostaspheres Contain Cells With
Clonogenic Potential
To determine whether the frequency of clonogenic
cells differs between second generation prostaspheres
and the original epithelial fraction, both cell populations were compared in the clonogenic assay (Fig. 4). In
two out of five patients there was an increase in the
The Prostate
Fig. 3. Expression of putative stem cell markers. mRNA expressionin patientmatched epithelial fraction (A) andprostaspheres (B)
(n ¼ 5; *P < 0.05).
number of both holoclones and total colonies
formed by prostaspheres when compared to the
epithelial fraction. In two other patients, there was
an increase in the number of holoclones, but not in the
total number of colonies generated by prostaspheres.
One patient showed only an increase in the total
number of colonies while the number of holoclones
formed by prostaspheres remained the same as in the
epithelial fraction. Importantly, holoclones derived
from prostaspheres were larger than those derived
from the epithelial fraction, which suggests that prostaspheres may contain cells with higher proliferative
potential.
In order to determine whether the clonogenic
efficiency of prostasphere derived cells varies upon
passaging, the colonies generated by prostaspheres
from four consecutive passages were quantified for
one patient. The total number of prostasphere
derived colonies did not vary significantly from that
generated from the epithelial fraction and among the
serial passages. Also in this case the number of
holoclones generated by prostaspheres was higher
than the number of holoclones formed by the epithelial
fraction, and remained constant in all four passages
(Supplementary Fig. 3). This suggests that in serial
prostasphere generations, the proportion of S/P-like
cells is maintained constant rather than being
expanded.
Self-Renewing Cells in Human Prostate Cancer
7
prostaspheres may be composed of cells with different
phenotypes.
Expression of TMPRSS2/ERG Gene Fusion Indicates
the Presence of CaP Cells in Prostaspheres
To verify the neoplastic nature of the cells composing prostaspheres, the expression of the TMPRSS2/
ERG gene fusion [40] was investigated in cDNAs from
the original epithelial fraction and patient matched
prostaspheres of five patients. In all cases the prostaspheres maintained the same gene fusion as the
original epithelial fraction. When non-matched, noncancerous prostate tissue from additional two patients
was tested, no gene fusion could be detected (Fig. 6).
DISCUSSION
Fig. 4. Prostaspheres clonogenic capacity. Macroscopic aspect
of colony types generated by cells derived from the epithelial
fraction (left) and from generation two prostaspheres (right) (A).
Comparison of the number of total colonies (B) and holoclones
(C) formed by cells from patient matched epithelial fraction (black
bars) and cells derived formprostaspheres (whitebars) (n ¼ 5).
Prostaspheres Have a Heterogeneous
Cell Composition
The protein expression of some of the markers tested
at the mRNA level, and their localization within the
prostaspheres was analyzed by immunocytochemistry
(Fig. 5). Prostaspheres were positive for PSCA, CD49b,
CD49f, CD44, c-met, CK14, Nestin, and p63. However,
they were negative for CK18, AR, PSA, and CD133 (not
shown), in accordance to their corresponding low
mRNA expression levels. While CD44 and c-met
stained prostaspheres homogeneously in all patients,
the proportion of positive cells and the staining
intensity for the remaining markers varied both
between patients and between prostaspheres from
the same patient. This observation indicates that
The Prostate
The introduction of the sphere assay has represented
a major advance in stem cell research since it is a
suitable surrogate assay for the in vivo serial transplantation to verify self-renewal potential. For the
prostate, the sphere assay has proven the self-renewal
of stem cells derived from normal mouse prostate
epithelium [41], similarly to what has been described
for stem cells derived from both human normal
epithelia and solid cancers [16–18,42]. It has also been
used to determine the presence of S/P-like cells in
human prostate cell lines [13,43]. For the first time we
demonstrate by this assay that surgical specimens
of human CaP tissue contain neoplastic cells with
self-renewal potential.
Radical prostatectomy specimens may contain
normal prostate tissue with normal stem cells, which
may also generate prostaspheres. Previous attempts by
others to identify CaP S/P-like cells in surgical tissue
specimens did not prove the neoplastic nature of the
self-renewing cells [14] or failed to generate neoplastic
prostaspheres [44]. Fusion of the TMPRSS2 promoter
with ERG gene is specific for CaP and has been shown
to be present in 70% of prostate tumors [45]. Here we
show that prostaspheres express the TMPRSS2/ERG
fusion, as detected by RT-PCR and, thus, are composed
of neoplastic cells. Furthermore, we demonstrate that
the epithelial fraction isolated from surgical specimens
of human CaP tissue contains holoclone-forming cells,
which possess the highest clonogenic potential [11].
This is a further indication for the presence of S/P-like
cells. Remarkably, prostaspheres contain holocloneforming cells at a higher frequency and generate
larger holoclones than the original epithelial fraction.
This may indicate that S/P-like cells contained in
prostaspheres have a higher proliferative potential.
For some patients there is no parallel increase in the
number of total colonies and of holoclones generated
by prostaspheres. This may suggest that individual
8
Guzma¤n-Ram|¤ rez et al.
Fig. 5. Immunocytochemicalanalysis ofputative stemcellmarkersinprostaspheres.Due to thehighvariabilitybetweenpatients, figures are
notrepresentative of allresults obtained.Bar ¼100 mm
prostate cancers are maintained by self-renewing cells
with low differentiation or proliferative potential.
On the other hand, cells derived from colonies are
unable to form prostaspheres. This may indicate that
monolayer culture, while being extremely useful
for assessing clonogenic capacity, is not permissive
for the maintenance of self-renewal potential. Only
the three-dimensional culture as free-floating prostaspheres allows the cells to maintain this property. In
agreement to this, it has been found that normal mouse
prostate epithelial cells lose their regenerative potential
when cultured on adherent surface and that only
prostasphere culture maintains and propagates progenitor cells [41].
In this study the presence of self-renewing cells in
prostaspheres is supported both by their ability to form
new generations of prostaspheres and to retain their
clonogenic potential after serial passages. Our results
indicate that the proportion of prostasphere-generating
cells stays constant throughout passaging, which is
consistent with the findings by others [44]. However, it
has been shown that in normal mouse prostate the
Fig. 6. ExpressionofTMPRSS2/ERG genefusiontranscripts.PCRproductsof freshlyisolatedwholeepithelialfractionfrom5patients(lanes1,
3, 5, 7, 9), patient matched generation 2 prostaspheres (lanes 2, 4, 6, 8,10), non-cancerous prostate samples from 2 patients (lanes11and12),
DuCaP (positive control, lane13) and LNCaP (negative control, lane14) are displayed.Thelower panel shows the b-actin control.
The Prostate
Self-Renewing Cells in Human Prostate Cancer
number of stem cells increases upon passaging of
spheres [22,46]. Either differences in species or in the
origin, normal or neoplastic, of the S/P-like cells may
explain these discrepancies.
We cannot exclude that free-floating spheres may
partially result from coalescence of cells and, thus, the
size and number of spheres may not accurately reflect
the precise number of sphere-generating cells in the
original cell population [47]. Therefore, the sphere
generation assay cannot be used quantitatively. Previous studies have employed the semisolid Matrigel
matrix approach to culture prostaspheres in order
to overcome this limitation [22]. However, under
these conditions, cells have been shown to undergo
differentiation [22,48]. Independently of this limitation,
the sphere generation assay still represents a powerful
methodology to assess qualitatively the self-renewal
potential within a given cell population [42].
The expression of markers of self-renewal, such as
the polycomb group gene Bmi-1, the members of Notch
signaling Jagged-1, Jagged-2, and Hes-1, the hedgehog
signaling proteins Patched and Smoothened, and the
embryonic stem cell markers Nanog and Oct-4,
further corroborates the presence of S/P-like cells in
prostaspheres. Furthermore, prostaspheres expressed
CD49b and CD49f, which have been related to selfrenewal and multipotency in normal and malignant
prostate [34,49], and in normal mammary tissue [50].
This is also in agreement with a recent report from
Goldstein et al. [44], which shows that normal prostate
epithelial cells expressing CD49f and Trop-2 are able to
form spheres in vitro.
CD49b and CD49f are involved in binding to laminin
[51]. Here we show that epithelial cells selected by
laminin adhesion have high clonogenic potential, as
indicated by the formation of an increased number
of holoclones, which contain the cells with the
highest regenerative capacity [11]. In contrast, collagen
adhesion selects for clonogenic cells in general, but not
for holoclone-forming cells, as previously shown [52].
Thus, laminin-rather than collagen-adherent cells
are enriched in S/P-like cells with high proliferative
potential. The observation that laminin adherence
enriches significantly for holoclone-forming cells, but
not for the total number of colonies, may be explained
by the fact that the laminin adherent population still
contains a proportion of cells generating meroclones/
paraclones that varies among patients. Co-expression
of CD49f and CD49b and/or the combination with beta
subunits may further define subsets among S/P-like
cells.
Self-renewal is an attribute of normal stem cells. In
cancer, it has been postulated that not only stem cells,
but also downstream progenitors can acquire selfrenewal as a result of malignant transformation [2,53].
The Prostate
9
Our results show that cancer-derived prostaspheres
express markers of both the stem cell and transit/
amplifying compartments of the normal prostate epithelium. Immunohistochemical analysis showed that
not all markers analyzed are uniformly expressed in the
prostaspheres. It is likely that prostaspheres are composed of a heterogeneous cell population in which the
majority of cells may represent the transit/amplifying
progeny of the initiating cell, as reported for neurospheres and mammospheres [16,54]. Thus, it is still not
possible to discriminate whether prostaspheres originate from a neoplastic cell of the stem cell compartment
with intrinsic self-renewal or from progenitor cells of the
transit/amplifying compartment, which acquired selfrenewal potential through malignant transformation.
Only the identification of the prostasphere-initiating
cancer cell will answer this question.
Human CaP stem cell populations have been
previously isolated based on the expression of CD133
[14]. Although controversial, CD133 expressing cells
are assigned to the stem cell compartment of human
epithelia [55], including the prostate [37], and of
the brain [17]. We confirmed CD133 expression at
the mRNA level in the epithelial fraction and in
prostaspheres derived from some, but not all CaP
specimens. This suggests that prostaspheres may be
generated both by CD133þ and CD133 freshly isolated
CaP cells, indicating that neoplastic transformation
can confer self-renewal potential also to CD133
progenitors cells, as previously suggested [1]. This
implies that in cancer, no unique phenotype may define
the self-renewing cells. It also suggests that, consistent
with the heterogeneous nature of CaP, selection by a
single marker is unlikely to identify all putative cancer
S/P-like cell types.
When comparing the mRNA expression level of
stem cell markers in prostaspheres and in the epithelial
fraction, PSCA was the only marker expressed at a
significantly higher level in prostaspheres. In spite of its
name, PSCA has not been recognized as a prostate stem
cell marker since it has been described to be expressed
by both basal and luminal prostate cells [56,57]. It has
been reported to be over-expressed in the majority of
CaP specimens [39]. However, at the mRNA level PSCA
is expressed in a subset of basal cells of the normal
prostate epithelium, consistent with the localization
of prostate stem cells [58]. Our finding that PSCA
expression is relatively low in the freshly isolated
epithelial fraction, but strongly increased in prostaspheres, supports its association with S/P-like cells.
Further studies will clarify whether there is a difference
in clonogenic and self-renewal potential between the
PSCAþ and PSCA CaP cells.
The conventional strategy to identify putative cancer
S/P-like cells relies on their prospective selection based
10
Guzma¤n-Ram|¤ rez et al.
on the expression of surface markers. Here we
performed a retrospective characterization of selfrenewing and clonogenic cells from primary CaP tissue
using the prostasphere assay. This represents a less
biased approach than the use of established cell lines to
functionally validate putative CaP S/P-like cell populations. CaP-derived prostaspheres will be useful for
further refining the identification of CaP S/P-like cells.
11. Li H, Chen X, Calhoun-Davis T, Claypool K, Tang DG. PC3
human prostate carcinoma cell holoclones contain self-renewing
tumor-initiating cells. Cancer Res 2008;68(6):1820–1825.
ACKNOWLEDGMENTS
14. Collins AT, Berry PA, Hyde C, Stower MJ, Maitland NJ.
Prospective identification of tumorigenic prostate cancer stem
cells. Cancer Res 2005;65(23):10946–10951.
We are very much indebted with Daniel Muellener
for coordinating the collection of surgery specimens.
We are also grateful to Dr. R. Calderari (CELLnTEC,
Bern) for his input. Human material was kindly
provided by the Tumorbank Bern. The Tumorbank
Bern is sponsored by the Department of Clinical
Research of the University of Bern and the Bernese
Cancer League.
REFERENCES
1. Tang DG, Patrawala L, Calhoun T, Bhatia B, Choy G, SchneiderBroussard R, Jeter C. Prostate cancer stem/progenitor cells:
Identification, characterization, and implications. Mol Carcinog
2007;46(1):1–14.
2. Wicha MS, Liu S, Dontu G. Cancer stem cells: An old idea—A
paradigm shift. Cancer Res 2006;66(4):1883–1890; discussion
1895–1886.
3. Reya T, Morrison SJ, Clarke MF, Weissman IL. Stem cells,
cancer, and cancer stem cells. Nature 2001;414(6859):105–
111.
4. Clarke MF, Dick JE, Dirks PB, Eaves CJ, Jamieson CH, Jones DL,
Visvader J, Weissman IL, Wahl GM. Cancer stem cells—
Perspectives on current status and future directions: AACR
Workshop on cancer stem cells. Cancer Res 2006;66(19):9339–
9344.
5. Bonnet D, Dick JE. Human acute myeloid leukemia is organized
as a hierarchy that originates from a primitive hematopoietic cell.
Nat Med 1997;3(7):730–737.
6. Al-Hajj M, Wicha MS, Benito-Hernandez A, Morrison SJ, Clarke
MF. Prospective identification of tumorigenic breast cancer cells.
Proc Natl Acad Sci USA 2003;100(7):3983–3988.
7. Ricci-Vitiani L, Lombardi DG, Pilozzi E, Biffoni M, Todaro M,
Peschle C, De Maria R. Identification and expansion of
human colon-cancer-initiating cells. Nature 2007;445(7123):
111–115.
8. Eramo A, Lotti F, Sette G, Pilozzi E, Biffoni M, Di Virgilio A,
Conticello C, Ruco L, Peschle C, De Maria R. Identification and
expansion of the tumorigenic lung cancer stem cell population.
Cell Death Differ 2008;15(3):504–514.
9. Hermann PC, Huber SL, Herrler T, Aicher A, Ellwart JW, Guba
M, Bruns CJ, Heeschen C. Distinct populations of cancer stem
cells determine tumor growth and metastatic activity in human
pancreatic cancer. Cell Stem Cell 2007;1(3):313–323.
10. Patrawala L, Calhoun-Davis T, Schneider-Broussard R, Tang
DG. Hierarchical organization of prostate cancer cells in
xenograft tumors: The CD44þalpha2beta1þ cell population is
enriched in tumor-initiating cells. Cancer Res 2007;67(14):6796–
6805.
The Prostate
12. Wei C, Guomin W, Yujun L, Ruizhe Q. Cancer stem-like cells in
human prostate carcinoma cells DU145: The seeds of the cell
line? Cancer Biol Ther 2007;6(5):763–768.
13. Hurt EM, Kawasaki BT, Klarmann GJ, Thomas SB, Farrar WL.
CD44þ CD24() prostate cells are early cancer progenitor/stem
cells that provide a model for patients with poor prognosis. Br
J Cancer 2008;98(4):756–765.
15. Reynolds BA, Weiss S. Clonal and population analyses
demonstrate that an EGF-responsive mammalian embryonic
CNS precursor is a stem cell. Dev Biol 1996;175(1):1–13.
16. Dontu G, Abdallah WM, Foley JM, Jackson KW, Clarke MF,
Kawamura MJ, Wicha MS. In vitro propagation and transcriptional profiling of human mammary stem/progenitor cells.
Genes Dev 2003;17(10):1253–1270.
17. Singh SK, Clarke ID, Terasaki M, Bonn VE, Hawkins C, Squire J,
Dirks PB. Identification of a cancer stem cell in human brain
tumors. Cancer Res 2003;63(18):5821–5828.
18. Ponti D, Costa A, Zaffaroni N, Pratesi G, Petrangolini G,
Coradini D, Pilotti S, Pierotti MA, Daidone MG. Isolation and
in vitro propagation of tumorigenic breast cancer cells with
stem/progenitor cell properties. Cancer Res 2005;65(13):5506–
5511.
19. Barrandon Y, Green H. Three clonal types of keratinocyte with
different capacities for multiplication. Proc Natl Acad Sci USA
1987;84(8):2302–2306.
20. Hamburger A, Salmon S. Primary bioassay of human tumor
stem cells. Science 1977;197(4302):461–463.
21. Locke M, Heywood M, Fawell S, Mackenzie IC. Retention of
intrinsic stem cell hierarchies in carcinoma-derived cell lines.
Cancer Res 2005;65(19):8944–8950.
22. Xin L, Lukacs RU, Lawson DA, Cheng D, Witte ON. Self-renewal
and multilineage differentiation in vitro from murine prostate
stem cells. Stem Cells 2007;25(11):2760–2769.
23. Cecchini MG, Fleisch H. Bisphosphonates in vitro specifically
inhibit, among the hematopoietic series, the development of the
mouse mononuclear phagocyte lineage. J Bone Miner Res 1990;
5(10):1019–1027.
24. Lawson DA, Witte ON. Stem cells in prostate cancer initiation
and progression. J Clin Invest 2007;117(8):2044–2050.
25. Tokar EJ, Ancrile BB, Cunha GR, Webber MM. Stem/progenitor
and intermediate cell types and the origin of human prostate
cancer. Differentiation 2005;73(9–10):463–473.
26. Assinder SJ, Stanton JA, Prasad PD. Transgelin: An actinbinding protein and tumor suppressor. Int J Biochem Cell Biol
2008;41(3):482–486.
27. Liang J, Wan M, Zhang Y, Gu P, Xin H, Jung SY, Qin J, Wong J,
Cooney AJ, Liu D, Songyang Z. Nanog and Oct4 associate with
unique transcriptional repression complexes in embryonic stem
cells. Nat Cell Biol 2008;10(6):731–739.
28. Liu S, Dontu G, Mantle ID, Patel S, Ahn NS, Jackson KW, Suri P,
Wicha MS. Hedgehog signaling and Bmi-1 regulate self-renewal
of normal and malignant human mammary stem cells. Cancer
Res 2006;66(12):6063–6071.
29. Nikopoulos GN, Duarte M, Kubu CJ, Bellum S, Friesel R, Maciag
T, Prudovsky I, Verdi JM. Soluble Jagged1 attenuates lateral
Self-Renewing Cells in Human Prostate Cancer
11
inhibition, allowing for the clonal expansion of neural crest stem
cells. Stem Cells 2007;25(12):3133–3142.
prostate epithelial cell lines and in prostate cancer specimens.
Cancer Res 2007;67(7):3153–3161.
30. Yu X, Alder JK, Chun JH, Friedman AD, Heimfeld S, Cheng L,
Civin CI. HES1 inhibits cycling of hematopoietic progenitor cells
via DNA binding. Stem Cells 2006;24(4):876–888.
44. Goldstein AS, Lawson DA, Cheng D, Sun W, Garraway IP, Witte
ON. Trop2 identifies a subpopulation of murine and human
prostate basal cells with stem cell characteristics. Proc Natl Acad
Sci USA 2008;105(52):20882–20887.
31. Rohatgi R, Scott MP. Patching the gaps in Hedgehog signalling.
Nat Cell Biol 2007;9(9):1005–1009.
32. Singh SK, Hawkins C, Clarke ID, Squire JA, Bayani J, Hide T,
Henkelman RM, Cusimano MD, Dirks PB. Identification of
human brain tumor initiating cells. Nature 2004;432(7015):396–
401.
33. Balazs AB, Fabian AJ, Esmon CT, Mulligan RC. Endothelial
protein C receptor (CD201) explicitly identifies hematopoietic
stem cells in murine bone marrow. Blood 2006;107(6):2317–2321.
34. Collins AT, Habib FK, Maitland NJ, Neal DE. Identification and
isolation of human prostate epithelial stem cells based on
alpha(2)beta(1)-integrin expression. J Cell Sci 2001;114(Pt 21):
3865–3872.
35. Lawson DA, Xin L, Lukacs RU, Cheng D, Witte ON. Isolation and
functional characterization of murine prostate stem cells. Proc
Natl Acad Sci USA 2007;104(1):181–186.
36. Patrawala L, Calhoun T, Schneider-Broussard R, Li H, Bhatia B,
Tang S, Reilly JG, Chandra D, Zhou J, Claypool K, Coghlan L,
Tang DG. Highly purified CD44þ prostate cancer cells from
xenograft human tumors are enriched in tumorigenic and
metastatic progenitor cells. Oncogene 2006;25(12):1696–1708.
37. Richardson GD, Robson CN, Lang SH, Neal DE, Maitland NJ,
Collins AT. CD133, a novel marker for human prostatic epithelial
stem cells. J Cell Sci 2004;117(Pt 16):3539–3545.
38. Signoretti S, Pires MM, Lindauer M, Horner JW, Grisanzio C,
Dhar S, Majumder P, McKeon F, Kantoff PW, Sellers WR, Loda
M. p63 regulates commitment to the prostate cell lineage. Proc
Natl Acad Sci USA 2005;102(32):11355–11360.
39. Reiter RE, Gu Z, Watabe T, Thomas G, Szigeti K, Davis E, Wahl
M, Nisitani S, Yamashiro J, Le Beau MM, Loda M, Witte ON.
Prostate stem cell antigen: A cell surface marker overexpressed
in prostate cancer. Proc Natl Acad Sci USA 1998;95(4):1735–
1740.
40. Tomlins SA, Rhodes DR, Perner S, Dhanasekaran SM, Mehra R,
Sun XW, Varambally S, Cao X, Tchinda J, Kuefer R, Lee C, Montie
JE, Shah RB, Pienta KJ, Rubin MA, Chinnaiyan AM. Recurrent
fusion of TMPRSS2 and ETS transcription factor genes in
prostate cancer. Science 2005;310(5748):644–648.
41. Shi X, Gipp J, Bushman W. Anchorage-independent culture
maintains prostate stem cells. Dev Biol 2007;312(1):396–
406.
42. Reynolds BA, Rietze RL. Neural stem cells and neurospheres—
Re-evaluating the relationship. Nat Methods 2005;2(5):333–336.
43. Miki J, Furusato B, Li H, Gu Y, Takahashi H, Egawa S, Sesterhenn
IA, McLeod DG, Srivastava S, Rhim JS. Identification of putative
stem cell markers, CD133 and CXCR4, in hTERT-immortalized
primary nonmalignant and malignant tumor-derived human
The Prostate
45. Narod SA, Seth A, Nam R. Fusion in the ETS gene family and
prostate cancer. Br J Cancer 2008;99(6):847–851.
46. Lukacs RU, Lawson DA, Xin L, Zong Y, Garraway I, Goldstein
AS, Memarzadeh S, Witte ON. Epithelial stem cells of the
prostate and their role in cancer progression. Cold Spring Harb
Symp Quant Biol 2008;73:491–502.
47. Singec I, Knoth R, Meyer RP, Maciaczyk J, Volk B, Nikkhah G,
Frotscher M, Snyder EY. Defining the actual sensitivity and
specificity of the neurosphere assay in stem cell biology. Nature
Methods 2006;3(10):801–806.
48. Hudson DL. Prostate epithelial stem cell culture. Cytotechnology 2003;41(2–3):189–196.
49. Bello-Deocampo D, Kleinman HK, Deocampo ND, Webber MM.
Laminin-1 and alpha6beta1 integrin regulate acinar morphogenesis of normal and malignant human prostate epithelial cells.
Prostate 2001;46(2):142–153.
50. Stingl J, Eirew P, Ricketson I, Shackleton M, Vaillant F, Choi D, Li
HI, Eaves CJ. Purification and unique properties of mammary
epithelial stem cells. Nature 2006;439(7079):993–997.
51. Sonnenberg A. Integrins and their ligands. Curr Top Microbiol
Immunol 1993;184:7–35.
52. Hudson DL, O’Hare M, Watt FM, Masters JR. Proliferative
heterogeneity in the human prostate: Evidence for epithelial
stem cells. Lab Invest J Tech Methods Pathol 2000;80(8):1243–
1250.
53. Kakarala M, Wicha MS. Implications of the cancer stem-cell
hypothesis for breast cancer prevention and therapy. J Clin
Oncol 2008;26(17):2813–2820.
54. Scheffler B, Horn M, Blumcke I, Laywell ED, Coomes D,
Kukekov VG, Steindler DA. Marrow-mindedness: A perspective
on neuropoiesis. Trends Neurosci 1999;22(8):348–357.
55. Mizrak D, Brittan M, Alison MR. CD133: Molecule of the
moment. J Pathol 2008;214(1):3–9.
56. Watabe T, Lin M, Ide H, Donjacour AA, Cunha GR, Witte ON,
Reiter RE. Growth, regeneration, and tumorigenesis of the
prostate activates the PSCA promoter. Proc Natl Acad Sci USA
2002;99(1):401–406.
57. Gu Z, Thomas G, Yamashiro J, Shintaku IP, Dorey F, Raitano A,
Witte ON, Said JW, Loda M, Reiter RE. Prostate stem cell antigen
(PSCA) expression increases with high gleason score, advanced
stage and bone metastasis in prostate cancer. Oncogene 2000;
19(10):1288–1296.
58. van Leenders GJ, Schalken JA. Epithelial cell differentiation in
the human prostate epithelium: Implications for the pathogenesis and therapy of prostate cancer. Crit Rev Oncol Hematol
2003;46(Suppl):S3–S10.
ADDITIONAL RESULTS
In the manuscript in press, the set of markers described to be expressed in
prostaspheres may become of high relevance when further studies will determine whether
expression of these markers can identify a stem/progenitor cell subset in DTC population and,
most importantly, whether this influences the clinical outcome. Therefore, this project
currently aims at detecting DTC based on the expression of PSCA and additional candidate
markers (c-met, CD49b and CD49f) in lymph nodes and bone marrow from prostate cancer
patients. These experiments are being performed by our group, in collaboration with the
INSERM from the University of Lyon. The preliminary results will be summarized in the
next two sections.
Detection of PSCA mRNA expression in lymph nodes of patients
with prostate cancer
The detection of DTC in lymph nodes at the time of radical prostatectomy is one of the
most important determinants of disease progression in patients with no clinical evidence of
systemic metastases (Pagliarulo, Hawes et al. 2006). Furthermore, the presence of pelvic
lymph node metastasis is correlated with an increased risk for disease progression
independently of the type of therapy (Walsh, Partin et al. 1994). Determination of lymph node
metastasis is performed routinely as part of pathological tumour staging (Figure 11). A recent
report shows that patients with few lymph node metastases have a better outcome than
patients with more than 3 positive lymph nodes (Schumacher, Slattery et al. 2008). However,
routine histological examination has only small chances of detecting small metastatic foci.
37
Detection rate can be improved by the use of molecular methodologies. For example, in one
of the first reports, expression of PSA and PSMA mRNAs in lymph node specimens was
assessed by RT-PCR. Among 29 patients with no pathologic evidence of lymph node
involvement, 23 (79%) were positive for the two markers.
Figure 11. Pathological staging of prostate cancer. The TNM system evaluates the location
and size of a tumor in the prostate. T = local tumor growth, N = the lymph nodes, M =
distant metastases (Taken from Kaiser 2003).
The specific objective of this analysis was to analyse the mRNA expression of PSCA
(as a putative stem/progenitor cell marker) and PSA and EpCAM (as conventional markers
for the detection of DTCs) in parallel with conventional histopathological examination, in
series of local lymph nodes dissected from prostate cancer patients undergoing radical
prostatectomy.
In a preliminary screening, the mRNA expression of the 3 markers was analyzed in
lymph node tissue samples from 5 patients: 1 patient with advanced metastatic prostate
cancer; 2 benign prostate hyperplasia patients; 1 renal cancer patient and 1 female patient
undergoing cystectomy for non-cancerous disease (Figure 12). Expression of the 3 markers
was restricted to lymph node tissue of the patient with metastatic disease, while in the other
38
patients with no prostate cancer (renal cancer patient) or non cancerous disease (BPH or
female patients) no background expression for PSA, PSCA and EpCAM was found.
Figure 12. Lymph node mRNA expression measured by real time PCR in an advanced prostate
cancer patient (Advanced CaP), two benign prostate hyperplasia patients (BPH1 and BPH2), a renal
cancer patient (Renal Ca) and a female patient undergoing cystectomy (Female LN).
In a subsequent series of 6 patients undergoing radical prostatectomy, 8 to 25 regional
pelvic lymph nodes per patient were surgically excised. Each lymph node was divided in 2
equal parts. One half was used for conventional pathological diagnosis and the other half was
entirely homogenized for RNA extraction and the measurement of PSA, PSCA and EpCAM
mRNA by real-time PCR (Table 1).
Pathological staging
Patient
1
2
3
4
5
6
Gleason
6 (3+3)
6 (3+3)
7 (3+4)
8 (4+4)
8 (3+5)
9 (4+5)
Stage
T2a
T2c
T3b
T3b
T3b
T3b
mRNA expression determined by RT-PCR
LNM
N0
N0
N0
N0
N1
N1
Proportion of positive LN (%)
PSA+
PSCA+
Ep-CAM+
0/8 (0)
0/19 (0)
0/8 (0)
0/12 (0)
7/10 (70)
2/25 (8)
0/8 (0)
5/19 (26)
1/8 (12)
5/12 (17)
7/10 (70)
5/25 (20)
2/8 (25)
12/19 (63)
4/8 (50)
4/12 (33)
7/10 (70)
12/25 (48)
PSCA+/
Ep-CAM0/8 (0)
1/19 (5)
0/8 (0)
3/12 (25)
1/10 (10)
1/25 (4)
Table 1. Pathological staging and mRNA expression in series of lymph nodes from 6 patients.
Only 2 out of 6 patients (patients 5 and 6) were diagnosed with lymph node metastasis
(N1) by conventional histopathological staging. In the lymph nodes of the same 2 patients,
PSA was found to be expressed. Expression of EpCAM, a pan-epithelial marker, was found in
25 to 70% of the lymph nodes of all 6 patients. Five out of the 6 patients contain a proportion
39
of PSCA+ lymph nodes. In the 4 patients, which were positive for both EpCAM and PSCA,
the proportion of either EpCAM+ or PSCA+ lymph nodes differed considerably and are
discordant. In general, a small proportion of PSCA+/EpCAM- lymph nodes was observed.
These preliminary results indicate that conventional histopathology detects the same lymph
nodes that express PSA, suggesting that this type of examination can detect cells with some
degree of epithelial differentiation. However, scattered and/or undifferentiated cells are most
likely overlooked in the histopathological examination, but can be still detected by EpCAM
mRNA expression analysis. The fact that EpCAM is positive in all 6 patients may suggest that
dissemination of cancer cells to the local lymph nodes is a common phenomenon in prostate
cancer patients. On the other hand, the fact that PSCA detects DTC in the majority, but not in
all patients, and that there are PSCA+/EpCAM- lymph nodes, suggests that this marker may
detect a different subpopulation of DTC than EpCAM. Future studies will assess whether
detection of a PSCA+ population may have a higher prognostic value for disease progression
than currently used markers.
Detection of CD49f, CD49b and c-met positive cells in bone
marrow of patients with prostate cancer
The specific aim of this study, which was approved by the local ethical committee in
Lyon, is to investigate whether the expression in bone marrow of 3 of the candidate markers,
which we found to be expressed in prostaspheres, namely, CD49f, CD49b and c-met,
correlate with the disease stage of prostate cancer patients. Accordingly to the disease stage, 4
different groups were included in this analysis (Table 2).
40
Group
Disease stage
1
2
3
4
Tumour stage T1 or T2. No biochemical relapse.
Tumor stage T3. Biochemical relapse (high PSA).
Tumor stage variable. Bone metastasis.
Tumor stage variable. Bone metastasis. Androgen independent disease.
The bone marrow of 42 patients was obtained for FACS analysis with informed
consent of the patients. After a CD45 negative selection to exclude the majority of cells from
haematopoietic origin, the remaining cells were analyzed for CD49f, CD49b and c-met
expression (Figure 13).
Figure 13. FACS analysis of CD49f, CD49b c-met in 4 groups of prostate cancer
patients (ANOVA: p<0.001).
In control samples (bone marrow aspirates from women, donors for bone marrow
transplant) this fraction was found not to contain CD49f, CD49b and c-met positive cells (not
shown). Instead, bone marrow samples from all prostate cancer patients were found to contain
c-met, CD49f and CD49b positive cells, suggesting that these cells are present even at early
stages of the disease. There is a significant increase in the percentage of positive cells in
patients from group 2 with locally advanced disease. These patients have evidence of
41
biochemical relapse, because of increased levels of serum PSA, and not yet bone metastasis.
These results suggest that patients at risk of developing metastatic prostate cancer may be
identified by using c-met, CD49f and CD49b (putative stem cell markers). This is the first
indication of their potential prognostic value in predicting bone metastatic relapse. However,
these findings need to be validated in larger independent series.
42
OUTLOOK AND FUTURE QUESTIONS
Metastatic, androgen-independent prostate cancer is a major clinical challenge.
Understanding the mechanisms involved in the development of prostate cancer metastasis is
fundamental for the development of treatment and preventive therapies. Therefore, the
identification of the cell of origin of metastatic prostate cancer represents a major goal in the
field. We support the hypothesis that cells able to initiate metastasis possess stem cell
properties.
The majority of studies for the identification of cancer stem/progenitor cells in solid
tumours relay on a prospective approach in which cells are isolated based on the expression of
surface markers normally associated with normal stem cells from the same or other tissues
and are afterwards tested for their self-renewal and proliferative potential. However, it is often
found that cells, which do not express the markers, not only exhibit stem cell properties
comparable to the selected population, but also grow tumours, indicating that the set of
markers chosen do not truly identify all the cells with stem/progenitor cell characteristics.
Therefore, the proportion of cancer stem/progenitor cells may be underestimated and most
importantly, therapies developed to target cells expressing these markers would not eliminate
all the cells of interest. With regard to prostate cancer, this approach has been almost
exclusively applied to prostate cancer cell lines, which may reflect only partially the clinical
scenario. Our study constitutes a less biased approach in which the biological properties of
unselected cells from clinical specimens of prostate cancer are analyzed as a first step. Only
the cells with self-renewal and high proliferative potential are submitted to further analysis in
order to define a set of suitable markers that defines them and that will allow their isolation
and further characterization. Using this approach, we have been able to provide for the first
time, a marker expression pattern in radical prostatectomy specimens, characteristic of cells
43
that exhibit stem cell properties and, thus, are likely to be involved in the maintenance of the
primary prostate tumour. According to our results, PSCA may be a potential prostate cancer
stem/progenitor cell marker in primary prostate tumours since its expression is elevated in
prostaspheres as compared to the original epithelial fraction of the original tumour. Previous
studies have shown that PSCA is highly expressed in prostate cancer as compared to normal
tissue and that the expression level directly correlates with high Gleason score, advanced
stage and bone metastasis (Gu, Thomas et al. 2000). For the first time, our study associates
PSCA mRNA expression with prostasphere-forming stem/progenitor cells derived from
primary prostate tumour tissue. However, the key question of whether these cells actually
contribute to primary tumour dissemination and metastatic disease has not yet been
conclusively answered. This, ultimately, will allow the development of more suitable
therapeutic approaches. Current studies performed by our group aim at reaching this goal.
In a preliminary analysis we have found expression of PSCA mRNA in series of
lymph nodes from patients at the moment of radical prostatectomy. However, the question of
whether these disseminated cells expressing PSCA also exhibit stem cell characteristics
remains to be answered and most importantly, whether this is the relevant population able to
initiate metastasis and ultimately be responsible for clinical relapse. Previous reports point
towards this direction. One study showed that in patients where PSCA mRNA expression in
primary tumour was increased after hormonal ablation therapy, there was an increased risk for
local recurrence or distant metastasis on follow-up (Zhigang and Wenlu 2005). In a similar
study, patients undergoing radiation therapy, where PSCA expression levels in primary
tumour increased after therapy, had an increased risk for biochemical relapse or distant
metastasis (Zhigang and Wenlu 2007). These findings already suggest that PSCA may detect
a population of cells resistant to androgen ablation and radiotherapy (a characteristic of stem
cells), which may be of relevance for clinical outcome of the patients.
44
One of the basic questions that still remain to be answered is whether cancer
stem/progenitor cells derive from normal stem cells or from more differentiated progenitor
cells. This has important implications in the development of future therapies. The first case
would be likely considering that if cancer stem cells derive from normal stem cells they
would be able to use the already active machinery for self-renewal and would only need
further mutations for malignant transformation. A recent report provides experimental
evidence for this view (Barker, Ridgway et al. 2009). In the second case, more differentiated
progenitor cells would need to maintain or re-acquire the capacity to self-renew. Studies in
leukaemia suggest that both mechanisms may occur (Cozzio, Passegue et al. 2003; Krivtsov,
Twomey et al. 2006). In prostate tissue, markers that specifically identify stem cells and their
immediate progeny are not as defined as in the haematopoietic system and thus it is still not
possible to differentiate between the two possibilities. Nevertheless, circumstantial evidence
seems to support both mechanisms. On one hand, it has been suggested that markers
expressed in normal prostate stem cells like CD133+, are also expressed by putative prostate
cancer stem/progenitor cells (Richardson, Robson et al. 2004; Collins, Berry et al. 2005).
However, intermediate cells with the phenotype CK5+CK18+ have been also proposed as
primary targets of malignant transformation and precursors of androgen independent tumour
progression (Isaacs and Coffey 1989; Verhagen, Ramaekers et al. 1992; van Leenders, Gage
et al. 2003).
Another fundamental question to be solved is whether the cancer stem/progenitor cell
content in the primary tumour or disseminated tumour cells have prognostic significance. In
order to answer this question it would be important to determine if more aggressive cancers
contain an increased proportion of cancer stem/progenitor cells. Cancer develops after
accumulation of multiple mutations that will ultimately cause malignant transformation
(Knudson, Strong et al. 1973; Fearon and Vogelstein 1990). If the targets of malignant
45
transformation are stem cells, this may lead to an increase of their number. Alternatively, a
mutation may confer self-renewal capacity to rapidly expanding cancer progenitor cells,
which could also explain an increase in cells with stem cell properties. In both cases the result
may be a more aggressive cancer. In fact, one study in breast cancer showed that in eight out
of nine patients, the phenotype of cancer stem/progenitor cells was CD44+CD24-/low and
represented the minority of the population. However, in one patient with a highly aggressive
form of breast cancer (comedo-adenocarcinoma), tumorigenic cells were found both in the
CD44+CD24-/low and in the CD44+CD24+ fractions, representing more than 66% of the cells.
This may indicate that CD44+CD24+ may represent a more differentiated, rapidly expanding
progenitor cell subset, which has gained the ability to self-renew leading to a more aggressive
disease progression.
46
CONCLUSION
This thesis describes a general background for understanding the main issues in
prostate cancer in view of the cancer stem cell hypothesis. Our experimental work shows that
prostate cancer clinical specimens contain cells with stem cell properties. Their presence in
DTC from prostate cancer patients may be an indication of a potential role of these cells in the
metastatic process. Our work represents an important step in the characterization of cells
responsible for the development of the currently untreatable, androgen independent prostate
cancer. Future clinical studies will confirm the relevance of these findings and may lead
towards the development of novel and effective therapies for the treatment of this disease.
47
LIST OF ABBREVIATIONS
ABCG2: ATP-binding cassette transporter, sub-family G member 2
APF: alpha-fetoprotein
AR: androgen receptor
CHRA: chromogranin A
CK: cytokeratin
c-met: hepatocyte growth factor receptor
CTC chip: circulating tumor cells chip
DTC: disseminated tumor cells
Du145: dura metastasis from prostate cancer (cell line)
EGF: epidermal growth factor
EMT: epithelial mesenchymal transition
EpCAM: epithelial cell adhesion molecule
ERG: v-ets erythroblastosis virus E26 oncogene homolog gene
ETS: E twenty-six transcription factors
FACS: fluorescent-activated cell sorting
FGF: fibroblast growth factor
HGF: hepatocyte growth factor
HIF1α: hypoxia inducible factor one alpha
IGF1: insulin-like growth factor one
IL-6: interleukin 6
Lin: lineage
LnCaP: lymph node metastasis from prostate cancer (cell line)
MDR-1: multidrug resistance protein 1
NSE: neuron specific enolase
Oct-4: octamer-4
PC3: prostate cancer (cell line) 3
PCA3: prostate cancer-gen-3
PDGF: platelet derived growth factor
PIN: prostate intraepithelial neoplasia
PSA: prostate specific antigen
PSCA: prostate stem cell antigen
PSMA: prostate specific membrane antigen
Sca-1: stem cell antigen 1
SYP: synaptophysin
TGFβ: transforming growth factor beta
TMPRSS: transmembrane protease serine 2
Trop-2: tumour associated calcium signal transducer 2
VEGF: vascular endothelial growth factor
Wnt: “wingless” signaling pathway
α2β1: alpha2-beta1 integrin
48
REFERENCES
Adsan, O., M. G. Cecchini, et al. (2002). "Can the reverse transcriptase-polymerase chain
reaction for prostate specific antigen and prostate specific membrane antigen improve
staging and predict biochemical recurrence?" BJU Int 90(6): 579-85.
Afar, D. E., I. Vivanco, et al. (2001). "Catalytic cleavage of the androgen-regulated
TMPRSS2 protease results in its secretion by prostate and prostate cancer epithelia."
Cancer Res 61(4): 1686-92.
Aguirre-Ghiso, J. A. (2007). "Models, mechanisms and clinical evidence for cancer
dormancy." Nat Rev Cancer 7(11): 834-46.
Al-Hajj, M. and M. F. Clarke (2004). "Self-renewal and solid tumor stem cells." Oncogene
23(43): 7274-82.
Al-Hajj, M., M. S. Wicha, et al. (2003). "Prospective identification of tumorigenic breast
cancer cells." Proc Natl Acad Sci U S A 100(7): 3983-8.
Alix-Panabieres, C., J. P. Vendrell, et al. (2007). "Detection and characterization of putative
metastatic precursor cells in cancer patients." Clin Chem 53(3): 537-9.
Allan, A. L., S. A. Vantyghem, et al. (2006). "Tumor dormancy and cancer stem cells:
implications for the biology and treatment of breast cancer metastasis." Breast Dis 26:
87-98.
Antonioli, E., A. B. Cardoso, et al. (2007). "Effects of long-term castration on the smooth
muscle cell phenotype of the rat ventral prostate." J Androl 28(5): 777-83.
Assinder, S. J., J. A. Stanton, et al. (2008). "Transgelin: An actin-binding protein and tumour
suppressor." Int J Biochem Cell Biol.
Avigdor, A., P. Goichberg, et al. (2004). "CD44 and hyaluronic acid cooperate with SDF-1 in
the trafficking of human CD34+ stem/progenitor cells to bone marrow." Blood 103(8):
2981-9.
Ayala, G., J. A. Tuxhorn, et al. (2003). "Reactive stroma as a predictor of biochemical-free
recurrence in prostate cancer." Clin Cancer Res 9(13): 4792-801.
Balazs, A. B., A. J. Fabian, et al. (2006). "Endothelial protein C receptor (CD201) explicitly
identifies hematopoietic stem cells in murine bone marrow." Blood 107(6): 2317-21.
Bao, S., Q. Wu, et al. (2006). "Glioma stem cells promote radioresistance by preferential
activation of the DNA damage response." Nature 444(7120): 756-60.
Barker, N., R. A. Ridgway, et al. (2009). "Crypt stem cells as the cells-of-origin of intestinal
cancer." Nature 457(7229): 608-11.
Barrandon, Y. and H. Green (1987). "Three clonal types of keratinocyte with different
capacities for multiplication." Proc Natl Acad Sci U S A 84(8): 2302-6.
Beier, D., P. Hau, et al. (2007). "CD133(+) and CD133(-) glioblastoma-derived cancer stem
cells show differential growth characteristics and molecular profiles." Cancer Res
67(9): 4010-5.
Bello-DeOcampo, D., H. K. Kleinman, et al. (2001). "Laminin-1 and alpha6beta1 integrin
regulate acinar morphogenesis of normal and malignant human prostate epithelial
cells." Prostate 46(2): 142-53.
Bergsagel, D. E. and F. A. Valeriote (1968). "Growth characteristics of a mouse plasma cell
tumor." Cancer Res 28(11): 2187-96.
Berry, P. A., N. J. Maitland, et al. (2008). "Androgen receptor signalling in prostate: effects of
stromal factors on normal and cancer stem cells." Mol Cell Endocrinol 288(1-2): 30-7.
49
Bhatt, R. I., M. D. Brown, et al. (2003). "Novel method for the isolation and characterisation
of the putative prostatic stem cell." Cytometry A 54(2): 89-99.
Bonkhoff, H., U. Stein, et al. (1994). "The proliferative function of basal cells in the normal
and hyperplastic human prostate." Prostate 24(3): 114-8.
Bonnet, D. and J. E. Dick (1997). "Human acute myeloid leukemia is organized as a hierarchy
that originates from a primitive hematopoietic cell." Nat Med 3(7): 730-7.
Braun, S., M. Muller, et al. (1998). "Re: Micrometastatic breast cancer cells in bone marrow
at primary surgery: prognostic value in comparison with nodal status." J Natl Cancer
Inst 90(14): 1099-101.
Braun, S. and K. Pantel (1999). "Biological characteristics of micrometastatic cancer cells in
bone marrow." Cancer Metastasis Rev 18(1): 75-90.
Brown, M. D., P. E. Gilmore, et al. (2007). "Characterization of benign and malignant
prostate epithelial Hoechst 33342 side populations." Prostate 67(13): 1384-96.
Bruce, W. R. and H. Van Der Gaag (1963). "A Quantitative Assay for the Number of Murine
Lymphoma Cells Capable of Proliferation in Vivo." Nature 199: 79-80.
Bubendorf, L., A. Schopfer, et al. (2000). "Metastatic patterns of prostate cancer: an autopsy
study of 1,589 patients." Hum Pathol 31(5): 578-83.
Burger, P. E., R. Gupta, et al. (2009). "High ALDH Activity: A Novel Functional Marker of
Murine Prostate Stem/Progenitor Cells." Stem Cells.
Cecchini, M. G. and H. Fleisch (1990). "Bisphosphonates in vitro specifically inhibit, among
the hematopoietic series, the development of the mouse mononuclear phagocyte
lineage." J Bone Miner Res 5(10): 1019-27.
Chambers, A. F., A. C. Groom, et al. (2002). "Dissemination and growth of cancer cells in
metastatic sites." Nat Rev Cancer 2(8): 563-72.
Cheng, J. X., B. L. Liu, et al. (2009). "How powerful is CD133 as a cancer stem cell marker
in brain tumors?" Cancer Treat Rev.
Cheng, L., M. O. Koch, et al. (2005). "The combined percentage of Gleason patterns 4 and 5
is the best predictor of cancer progression after radical prostatectomy." J Clin Oncol
23(13): 2911-7.
Christofori, G. and H. Semb (1999). "The role of the cell-adhesion molecule E-cadherin as a
tumour-suppressor gene." Trends Biochem Sci 24(2): 73-6.
Clarke, M. F., J. E. Dick, et al. (2006). "Cancer stem cells--perspectives on current status and
future directions: AACR Workshop on cancer stem cells." Cancer Res 66(19): 933944.
Collins, A. T., P. A. Berry, et al. (2005). "Prospective identification of tumorigenic prostate
cancer stem cells." Cancer Res 65(23): 10946-51.
Collins, A. T., F. K. Habib, et al. (2001). "Identification and isolation of human prostate
epithelial stem cells based on alpha(2)beta(1)-integrin expression." J Cell Sci 114(Pt
21): 3865-72.
Cozzio, A., E. Passegue, et al. (2003). "Similar MLL-associated leukemias arising from selfrenewing stem cells and short-lived myeloid progenitors." Genes Dev 17(24): 302935.
Dalerba, P., R. W. Cho, et al. (2007). "Cancer stem cells: models and concepts." Annu Rev
Med 58: 267-84.
De Angelis, G., H. G. Rittenhouse, et al. (2007). "Twenty Years of PSA: From Prostate
Antigen to Tumor Marker." Rev Urol 9(3): 113-23.
Dick, J. E. (2008). "Stem cell concepts renew cancer research." Blood 112(13): 4793-807.
Dontu, G., W. M. Abdallah, et al. (2003). "In vitro propagation and transcriptional profiling of
human mammary stem/progenitor cells." Genes Dev 17(10): 1253-70.
50
Ellis, W. J., J. Pfitzenmaier, et al. (2003). "Detection and isolation of prostate cancer cells
from peripheral blood and bone marrow." Urology 61(2): 277-81.
English, H. F., R. J. Santen, et al. (1987). "Response of glandular versus basal rat ventral
prostatic epithelial cells to androgen withdrawal and replacement." Prostate 11(3):
229-42.
Eramo, A., F. Lotti, et al. (2008). "Identification and expansion of the tumorigenic lung
cancer stem cell population." Cell Death Differ 15(3): 504-14.
Fearon, E. R. and B. Vogelstein (1990). "A genetic model for colorectal tumorigenesis." Cell
61(5): 759-67.
Fidler, I. J. (1970). "Metastasis: guantitative analysis of distribution and fate of tumor
embolilabeled with 125 I-5-iodo-2'-deoxyuridine." J Natl Cancer Inst 45(4): 773-82.
Fidler, I. J. (2003). "The pathogenesis of cancer metastasis: the 'seed and soil' hypothesis
revisited." Nat Rev Cancer 3(6): 453-8.
Galmozzi, E., F. Facchetti, et al. (2006). "Cancer stem cells and therapeutic perspectives."
Curr Med Chem 13(6): 603-7.
Ghossein, R. A., I. Osman, et al. (1999). "Detection of prostatic specific membrane antigen
messenger RNA using immunobead reverse transcriptase polymerase chain reaction."
Diagn Mol Pathol 8(2): 59-65.
Gleason, D. F. (1996). "Undergrading of prostate cancer biopsies: a paradox inherent in all
biologic bivariate distributions." Urology 47(3): 289-91.
Goldstein, A. S., D. A. Lawson, et al. (2008). "Trop2 identifies a subpopulation of murine and
human prostate basal cells with stem cell characteristics." Proc Natl Acad Sci U S A
105(52): 20882-7.
Grubb, R. L., 3rd and A. S. Kibel (2007). "Prostate cancer: screening, diagnosis and
management in 2007." Mo Med 104(5): 408-13; quiz 413-4.
Gu, G., J. Yuan, et al. (2007). "Prostate cancer cells with stem cell characteristics reconstitute
the original human tumor in vivo." Cancer Res 67(10): 4807-15.
Gu, Y., H. Li, et al. (2006). "Phenotypic characterization of telomerase-immortalized primary
non-malignant and malignant tumor-derived human prostate epithelial cell lines." Exp
Cell Res 312(6): 831-43.
Gu, Z., G. Thomas, et al. (2000). "Prostate stem cell antigen (PSCA) expression increases
with high gleason score, advanced stage and bone metastasis in prostate cancer."
Oncogene 19(10): 1288-96.
Gudjonsson, T., R. Villadsen, et al. (2002). "Isolation, immortalization, and characterization
of a human breast epithelial cell line with stem cell properties." Genes Dev 16(6): 693706.
Gupta, G. P. and J. Massague (2006). "Cancer metastasis: building a framework." Cell 127(4):
679-95.
Guzmán-Ramírez, N., M. Völler, et al. (2009). "In vitro propagation and characterization of
neoplastic stem/progenitor-like cells from human prostate cancer tissue
" The Prostate In press.
Halabi, S., E. J. Small, et al. (2003). "Prognostic significance of reverse transcriptase
polymerase chain reaction for prostate-specific antigen in metastatic prostate cancer: a
nested study within CALGB 9583." J Clin Oncol 21(3): 490-5.
Hamburger, A. and S. Salmon (1977). "Primary bioassay of human
tumor stem cells." Science 197(4302): 461–3.
Hermann, P. C., S. L. Huber, et al. (2007). "Distinct populations of cancer stem cells
determine tumor growth and metastatic activity in human pancreatic cancer." Cell
Stem Cell 1(3): 313-23.
51
Hessels, D., J. M. Klein Gunnewiek, et al. (2003). "DD3(PCA3)-based molecular urine
analysis for the diagnosis of prostate cancer." Eur Urol 44(1): 8-15; discussion 15-6.
Hoon, D. S., M. Kitago, et al. (2006). "Molecular mechanisms of metastasis." Cancer
Metastasis Rev 25(2): 203-20.
Hudson, D. L. (2003). "Prostate epithelial stem cell culture." Cytotechnology 41(2-3): 189-96.
Hudson, D. L. (2004). "Epithelial stem cells in human prostate growth and disease." Prostate
Cancer Prostatic Dis 7(3): 188-94.
Hudson, D. L., M. O'Hare, et al. (2000). "Proliferative heterogeneity in the human prostate:
evidence for epithelial stem cells." Lab Invest 80(8): 1243-50.
Hurt, E. M., B. T. Kawasaki, et al. (2008). "CD44+ CD24(-) prostate cells are early cancer
progenitor/stem cells that provide a model for patients with poor prognosis." Br J
Cancer 98(4): 756-65.
Huss, W. J., D. R. Gray, et al. (2005). "Breast cancer resistance protein-mediated efflux of
androgen in putative benign and malignant prostate stem cells." Cancer Res 65(15):
6640-50.
Hynes, R. O. (2002). "Integrins: bidirectional, allosteric signaling machines." Cell 110(6):
673-87.
Isaacs, J. T. and D. S. Coffey (1981). "Adaptation versus selection as the mechanism
responsible for the relapse of prostatic cancer to androgen ablation therapy as studied
in the Dunning R-3327-H adenocarcinoma." Cancer Res 41(12 Pt 1): 5070-5.
Isaacs, J. T. and D. S. Coffey (1989). "Etiology and disease process of benign prostatic
hyperplasia." Prostate Suppl 2: 33-50.
Iversen, P., J. E. Johansson, et al. (2006). "Bicalutamide 150 mg in addition to standard care
for patients with early non-metastatic prostate cancer: updated results from the
Scandinavian Prostate Cancer Period Group-6 Study after a median follow-up period
of 7.1 years." Scand J Urol Nephrol 40(6): 441-52.
Kaiser, S. (2003). Identification and Characterization of the Ion Channel TRPM8 in Prostate
Cancer. Mathematisch-Naturwissenschaftlichen Fakultät. Berlin, HumboldtUniversität. PhD: 103.
Kakarala, M. and M. S. Wicha (2008). "Implications of the cancer stem-cell hypothesis for
breast cancer prevention and therapy." J Clin Oncol 26(17): 2813-20.
Karhadkar, S. S., G. S. Bova, et al. (2004). "Hedgehog signalling in prostate regeneration,
neoplasia and metastasis." Nature 431(7009): 707-12.
Kasper, S. and M. S. Cookson (2006). "Mechanisms leading to the development of hormoneresistant prostate cancer." Urol Clin North Am 33(2): 201-10, vii.
Knudson, A. G., Jr., L. C. Strong, et al. (1973). "Heredity and cancer in man." Prog Med
Genet 9: 113-58.
Krivtsov, A. V., D. Twomey, et al. (2006). "Transformation from committed progenitor to
leukaemia stem cell initiated by MLL-AF9." Nature 442(7104): 818-22.
Lalani, E. N., A. Stubbs, et al. (1997). "Prostate cancer; the interface between pathology and
basic scientific research." Semin Cancer Biol 8(1): 53-9.
Landis, S. H., T. Murray, et al. (1999). "Cancer statistics, 1999." CA Cancer J Clin 49(1): 831, 1.
Lawson, D. A. and O. N. Witte (2007). "Stem cells in prostate cancer initiation and
progression." J Clin Invest 117(8): 2044-50.
Lawson, D. A., L. Xin, et al. (2007). "Isolation and functional characterization of murine
prostate stem cells." Proc Natl Acad Sci U S A 104(1): 181-6.
Leong, K. G., B. E. Wang, et al. (2008). "Generation of a prostate from a single adult stem
cell." Nature 456(7223): 804-8.
52
Letellier, G., M. J. Perez, et al. (2007). "Epithelial phenotypes in the developing human
prostate." J Histochem Cytochem 55(9): 885-90.
Li, C., D. G. Heidt, et al. (2007). "Identification of pancreatic cancer stem cells." Cancer Res
67(3): 1030-7.
Li, H., X. Chen, et al. (2008). "PC3 human prostate carcinoma cell holoclones contain selfrenewing tumor-initiating cells." Cancer Res 68(6): 1820-5.
Li, L. and W. B. Neaves (2006). "Normal stem cells and cancer stem cells: the niche matters."
Cancer Res 66(9): 4553-7.
Li, X., M. T. Lewis, et al. (2008). "Intrinsic resistance of tumorigenic breast cancer cells to
chemotherapy." J Natl Cancer Inst 100(9): 672-9.
Liang, J., M. Wan, et al. (2008). "Nanog and Oct4 associate with unique transcriptional
repression complexes in embryonic stem cells." Nat Cell Biol 10(6): 731-9.
Liu, A. Y., L. D. True, et al. (1997). "Cell-cell interaction in prostate gene regulation and
cytodifferentiation." Proc Natl Acad Sci U S A 94(20): 10705-10.
Liu, S., G. Dontu, et al. (2006). "Hedgehog signaling and Bmi-1 regulate self-renewal of
normal and malignant human mammary stem cells." Cancer Res 66(12): 6063-71.
Locke, M., M. Heywood, et al. (2005). "Retention of intrinsic stem cell hierarchies in
carcinoma-derived cell lines." Cancer Res 65(19): 8944-50.
Logothetis, C. J. and S. H. Lin (2005). "Osteoblasts in prostate cancer metastasis to bone."
Nat Rev Cancer 5(1): 21-8.
Lukacs, R. U., D. A. Lawson, et al. (2008). "Epithelial Stem Cells of the Prostate and Their
Role in Cancer Progression." Cold Spring Harb Symp Quant Biol.
McNeal, J. E. (1969). "Origin and development of carcinoma in the prostate. ." Cancer 23: 2434.
McNeal, J. E. (1981). "The zonal anatomy of the prostate." Prostate 2(1): 35-49.
McNeal, J. E. (1988). "Normal histology of the prostate." Am. J. Surg. Pathol. 12: 619-633.
Meng, X., M. Li, et al. (2009). "Both CD133(+) and CD133(-) subpopulations of A549 and
H446 cells contain cancer-initiating cells." Cancer Sci.
Micke, P. and A. Ostman (2004). "Tumour-stroma interaction: cancer-associated fibroblasts
as novel targets in anti-cancer therapy?" Lung Cancer 45 Suppl 2: S163-75.
Miki, J., B. Furusato, et al. (2007). "Identification of putative stem cell markers, CD133 and
CXCR4, in hTERT-immortalized primary nonmalignant and malignant tumor-derived
human prostate epithelial cell lines and in prostate cancer specimens." Cancer Res
67(7): 3153-61.
Mizrak, D., M. Brittan, et al. (2008). "CD133: molecule of the moment." J Pathol 214(1): 3-9.
Morrison, S. J., A. M. Wandycz, et al. (1997). "Identification of a lineage of multipotent
hematopoietic progenitors." Development 124(10): 1929-39.
Muller, V., N. Stahmann, et al. (2005). "Circulating tumor cells in breast cancer: correlation
to bone marrow micrometastases, heterogeneous response to systemic therapy and low
proliferative activity." Clin Cancer Res 11(10): 3678-85.
Narod, S. A., A. Seth, et al. (2008). "Fusion in the ETS gene family and prostate cancer." Br J
Cancer 99(6): 847-51.
Nguyen, D. X., P. D. Bos, et al. (2009). "Metastasis: from dissemination to organ-specific
colonization." Nat Rev Cancer 9(4): 274-84.
Nikopoulos, G. N., M. Duarte, et al. (2007). "Soluble Jagged1 attenuates lateral inhibition,
allowing for the clonal expansion of neural crest stem cells." Stem Cells 25(12): 313342.
Nowell, P. C. (1976). "The clonal evolution of tumor cell populations." Science 194(4260):
23-8.
53
O'Brien, C. A., A. Kreso, et al. (2009). "Cancer stem cells in solid tumors: an overview."
Semin Radiat Oncol 19(2): 71-7.
Oswald, J., S. Boxberger, et al. (2004). "Mesenchymal stem cells can be differentiated into
endothelial cells in vitro." Stem Cells 22(3): 377-84.
Pagliarulo, V., D. Hawes, et al. (2006). "Detection of occult lymph node metastases in locally
advanced node-negative prostate cancer." J Clin Oncol 24(18): 2735-42.
Pantel, K. and R. H. Brakenhoff (2004). "Dissecting the metastatic cascade." Nat Rev Cancer
4(6): 448-56.
Pantel, K., R. H. Brakenhoff, et al. (2008). "Detection, clinical relevance and specific
biological properties of disseminating tumour cells." Nat Rev Cancer 8(5): 329-40.
Pardal, R., M. F. Clarke, et al. (2003). "Applying the principles of stem-cell biology to
cancer." Nat Rev Cancer 3(12): 895-902.
Park, C. H., D. E. Bergsagel, et al. (1971). "Mouse myeloma tumor stem cells: a primary cell
culture assay." J Natl Cancer Inst 46(2): 411-22.
Passegue, E., C. H. Jamieson, et al. (2003). "Normal and leukemic hematopoiesis: are
leukemias a stem cell disorder or a reacquisition of stem cell characteristics?" Proc
Natl Acad Sci U S A 100 Suppl 1: 11842-9.
Patrawala, L., T. Calhoun-Davis, et al. (2007). "Hierarchical organization of prostate cancer
cells in xenograft tumors: the CD44+alpha2beta1+ cell population is enriched in
tumor-initiating cells." Cancer Res 67(14): 6796-805.
Patrawala, L., T. Calhoun, et al. (2006). "Highly purified CD44+ prostate cancer cells from
xenograft human tumors are enriched in tumorigenic and metastatic progenitor cells."
Oncogene 25(12): 1696-708.
Peichev, M., A. J. Naiyer, et al. (2000). "Expression of VEGFR-2 and AC133 by circulating
human CD34(+) cells identifies a population of functional endothelial precursors."
Blood 95(3): 952-8.
Piccirillo, S. G. and A. L. Vescovi (2006). "Bone morphogenetic proteins regulate
tumorigenicity in human glioblastoma stem cells." Ernst Schering Found Symp
Proc(5): 59-81.
Ponti, D., A. Costa, et al. (2005). "Isolation and in vitro propagation of tumorigenic breast
cancer cells with stem/progenitor cell properties." Cancer Res 65(13): 5506-11.
Reiter, R. E., Z. Gu, et al. (1998). "Prostate stem cell antigen: a cell surface marker
overexpressed in prostate cancer." Proc Natl Acad Sci U S A 95(4): 1735-40.
Reya, T., S. J. Morrison, et al. (2001). "Stem cells, cancer, and cancer stem cells." Nature
414(6859): 105-11.
Reynolds, B. A. and R. L. Rietze (2005). "Neural stem cells and neurospheres--re-evaluating
the relationship." Nat Methods 2(5): 333-6.
Reynolds, B. A. and S. Weiss (1996). "Clonal and population analyses demonstrate that an
EGF-responsive mammalian embryonic CNS precursor is a stem cell." Dev Biol
175(1): 1-13.
Ricci-Vitiani, L., D. G. Lombardi, et al. (2007). "Identification and expansion of human
colon-cancer-initiating cells." Nature 445(7123): 111-5.
Richardson, G. D., C. N. Robson, et al. (2004). "CD133, a novel marker for human prostatic
epithelial stem cells." J Cell Sci 117(Pt 16): 3539-45.
Riethdorf, S., H. Wikman, et al. (2008). "Review: Biological relevance of disseminated tumor
cells in cancer patients." Int J Cancer 123(9): 1991-2006.
Robinson, E. J., D. E. Neal, et al. (1998). "Basal cells are progenitors of luminal cells in
primary cultures of differentiating human prostatic epithelium." Prostate 37(3): 14960.
54
Rocchi, P., A. So, et al. (2004). "Heat shock protein 27 increases after androgen ablation and
plays a cytoprotective role in hormone-refractory prostate cancer." Cancer Res 64(18):
6595-602.
Rohatgi, R. and M. P. Scott (2007). "Patching the gaps in Hedgehog signalling." Nat Cell Biol
9(9): 1005-9.
Romer, J. T., H. Kimura, et al. (2004). "Suppression of the Shh pathway using a small
molecule inhibitor eliminates medulloblastoma in Ptc1(+/-)p53(-/-) mice." Cancer Cell
6(3): 229-40.
Roudier, M. P., L. D. True, et al. (2003). "Phenotypic heterogeneity of end-stage prostate
carcinoma metastatic to bone." Hum Pathol 34(7): 646-53.
Sabbath, K. D., E. D. Ball, et al. (1985). "Heterogeneity of clonogenic cells in acute
myeloblastic leukemia." J Clin Invest 75(2): 746-53.
Schalken, J. A. and G. van Leenders (2003). "Cellular and molecular biology of the prostate:
stem cell biology." Urology 62(5 Suppl 1): 11-20.
Schatton, T. and M. H. Frank (2008). "Cancer stem cells and human malignant melanoma."
Pigment Cell Melanoma Res 21(1): 39-55.
Schatton, T., G. F. Murphy, et al. (2008). "Identification of cells initiating human
melanomas." Nature 451(7176): 345-9.
Scheffler, B., M. Horn, et al. (1999). "Marrow-mindedness: a perspective on neuropoiesis."
Trends Neurosci 22(8): 348-57.
Schmidt, H., G. De Angelis, et al. (2004). "Frequent detection and immunophenotyping of
prostate-derived cell clusters in the peripheral blood of prostate cancer patients." Int J
Biol Markers 19(2): 93-9.
Schumacher, M. C., M. L. Slattery, et al. (2008). "Prevalence and predictors of cancer
screening among American Indian and Alaska native people: the EARTH study."
Cancer Causes Control 19(7): 725-37.
Schwartz, P. H., P. J. Bryant, et al. (2003). "Isolation and characterization of neural progenitor
cells from post-mortem human cortex." J Neurosci Res 74(6): 838-51.
Sell, S. and G. B. Pierce (1994). "Maturation arrest of stem cell differentiation is a common
pathway for the cellular origin of teratocarcinomas and epithelial cancers." Lab Invest
70(1): 6-22.
Sequist, L. V., S. Nagrath, et al. (2009). "The CTC-chip: an exciting new tool to detect
circulating tumor cells in lung cancer patients." J Thorac Oncol 4(3): 281-3.
Shah, R. B., R. Mehra, et al. (2004). "Androgen-independent prostate cancer is a
heterogeneous group of diseases: lessons from a rapid autopsy program." Cancer Res
64(24): 9209-16.
Shi, X., J. Gipp, et al. (2007). "Anchorage-independent culture maintains prostate stem cells."
Dev Biol 312(1): 396-406.
Shou, J., S. Ross, et al. (2001). "Dynamics of notch expression during murine prostate
development and tumorigenesis." Cancer Res 61(19): 7291-7.
Signoretti, S., M. M. Pires, et al. (2005). "p63 regulates commitment to the prostate cell
lineage." Proc Natl Acad Sci U S A 102(32): 11355-60.
Signoretti, S., D. Waltregny, et al. (2000). "p63 is a prostate basal cell marker and is required
for prostate development." Am J Pathol 157(6): 1769-75.
Singec, I., R. Knoth, et al. (2006). "Defining the actual sensitivity and specificity of the
neurosphere assay in stem cell biology." Nat Methods 3(10): 801-6.
Singh, S. K., I. D. Clarke, et al. (2003). "Identification of a cancer stem cell in human brain
tumors." Cancer Res 63(18): 5821-8.
Singh, S. K., C. Hawkins, et al. (2004). "Identification of human brain tumour initiating
cells." Nature 432(7015): 396-401.
55
Solakoglu, O., C. Maierhofer, et al. (2002). "Heterogeneous proliferative potential of occult
metastatic cells in bone marrow of patients with solid epithelial tumors." Proc Natl
Acad Sci U S A 99(4): 2246-51.
Sonnenberg, A. (1993). "Integrins and their ligands." Curr Top Microbiol Immunol 184: 7-35.
Stecca, B., C. Mas, et al. (2005). "Interference with HH-GLI signaling inhibits prostate
cancer." Trends Mol Med 11(5): 199-203.
Stingl, J., P. Eirew, et al. (2006). "Purification and unique properties of mammary epithelial
stem cells." Nature 439(7079): 993-7.
Studer, U. E., P. Whelan, et al. (2006). "Immediate or deferred androgen deprivation for
patients with prostate cancer not suitable for local treatment with curative intent:
European Organisation for Research and Treatment of Cancer (EORTC) Trial 30891."
J Clin Oncol 24(12): 1868-76.
Tang, D. G., L. Patrawala, et al. (2007). "Prostate cancer stem/progenitor cells: identification,
characterization, and implications." Mol Carcinog 46(1): 1-14.
Todaro, M., M. Perez Alea, et al. (2008). "IL-4-mediated drug resistance in colon cancer stem
cells." Cell Cycle 7(3): 309-13.
Tokar, E. J., B. B. Ancrile, et al. (2005). "Stem/progenitor and intermediate cell types and the
origin of human prostate cancer." Differentiation 73(9-10): 463-73.
Tomlins, S. A., D. R. Rhodes, et al. (2005). "Recurrent fusion of TMPRSS2 and ETS
transcription factor genes in prostate cancer." Science 310(5748): 644-8.
Tsujimura, A., Y. Koikawa, et al. (2002). "Proximal location of mouse prostate epithelial stem
cells: a model of prostatic homeostasis." J Cell Biol 157(7): 1257-65.
Uchida, N., D. W. Buck, et al. (2000). "Direct isolation of human central nervous system stem
cells." Proc Natl Acad Sci U S A 97(26): 14720-5.
van Leenders, G., H. Dijkman, et al. (2000). "Demonstration of intermediate cells during
human prostate epithelial differentiation in situ and in vitro using triple-staining
confocal scanning microscopy." Lab Invest 80(8): 1251-8.
van Leenders, G. J., W. R. Gage, et al. (2003). "Intermediate cells in human prostate
epithelium are enriched in proliferative inflammatory atrophy." Am J Pathol 162(5):
1529-37.
van Leenders, G. J. and J. A. Schalken (2003). "Epithelial cell differentiation in the human
prostate epithelium: implications for the pathogenesis and therapy of prostate cancer."
Crit Rev Oncol Hematol 46 Suppl: S3-10.
Verhagen, A. P., F. C. Ramaekers, et al. (1992). "Colocalization of basal and luminal celltype cytokeratins in human prostate cancer." Cancer Res 52(22): 6182-7.
Vescovi, A. L., R. Galli, et al. (2006). "Brain tumour stem cells." Nat Rev Cancer 6(6): 42536.
Visvader, J. E. and G. J. Lindeman (2008). "Cancer stem cells in solid tumours: accumulating
evidence and unresolved questions." Nat Rev Cancer 8(10): 755-68.
Walsh, P. C., A. W. Partin, et al. (1994). "Cancer control and quality of life following
anatomical radical retropubic prostatectomy: results at 10 years." J Urol 152(5 Pt 2):
1831-6.
Wang, Y., S. Hayward, et al. (2001). "Cell differentiation lineage in the prostate."
Differentiation 68(4-5): 270-9.
Watabe, T., M. Lin, et al. (2002). "Growth, regeneration, and tumorigenesis of the prostate
activates the PSCA promoter." Proc Natl Acad Sci U S A 99(1): 401-6.
Wei, C., W. Guomin, et al. (2007). "Cancer stem-like cells in human prostate carcinoma cells
DU145: the seeds of the cell line?" Cancer Biol Ther 6(5): 763-8.
56
Weigmann, A., D. Corbeil, et al. (1997). "Prominin, a novel microvilli-specific polytopic
membrane protein of the apical surface of epithelial cells, is targeted to plasmalemmal
protrusions of non-epithelial cells." Proc Natl Acad Sci U S A 94(23): 12425-30.
Wicha, M. S., S. Liu, et al. (2006). "Cancer stem cells: an old idea--a paradigm shift." Cancer
Res 66(4): 1883-90; discussion 1895-6.
Wirth, M. P., O. W. Hakenberg, et al. (2008). "Adjuvant hormonal treatment - the
bicalutamide early prostate cancer program." Front Radiat Ther Oncol 41: 39-48.
Xin, L., R. U. Lukacs, et al. (2007). "Self-renewal and multilineage differentiation in vitro
from murine prostate stem cells." Stem Cells 25(11): 2760-9.
Yamashita, T., J. Ji, et al. (2009). "EpCAM-positive hepatocellular carcinoma cells are tumorinitiating cells with stem/progenitor cell features." Gastroenterology 136(3): 1012-24.
Yin, A. H., S. Miraglia, et al. (1997). "AC133, a novel marker for human hematopoietic stem
and progenitor cells." Blood 90(12): 5002-12.
Yu, X., J. K. Alder, et al. (2006). "HES1 inhibits cycling of hematopoietic progenitor cells via
DNA binding." Stem Cells 24(4): 876-88.
Zhigang, Z. and S. Wenlu (2005). "Complete androgen ablation suppresses prostate stem cell
antigen (PSCA) mRNA expression in human prostate carcinoma." Prostate 65(4): 299305.
Zhigang, Z. and S. Wenlu (2007). "External beam radiotherapy (EBRT) suppressed prostate
stem cell antigen (PSCA) mRNA expression in clinically localized prostate cancer."
Prostate 67(6): 653-60.
Ziober, B. L., C. S. Lin, et al. (1996). "Laminin-binding integrins in tumor progression and
metastasis." Semin Cancer Biol 7(3): 119-28.
57
Natalia Guzmán Ramírez
Curriculum Vitae
July, 2009
Personal Details
Name:
Birth date and place :
Nationality:
Home Address:
Phone numbers:
E-mails:
Natalia Guzmán Ramírez
Medellín, December 3rd, 1981
Colombian
Muehledorfstasse 28
CH3018
Bern, Switzerland
+41 79 788 23 70
+57 310 245 36 70
[email protected]
[email protected]
Education
2006-2009
PhD
Graduate School for Cellular and Biomedical Sciences.
University of Bern, Switzerland.
2005 - 2006
MSc in biological sciences
Awarded a Laureate for MSc thesis, the highest honour bestowed by the university.
Molecular Diagnosis and Bioinformatics Laboratory, Bogotá.
Faculty of Sciences, Universidad de los Andes, Bogotá.
2000 - 2005
Bachelors in Microbiology
Faculty of Sciences, Universidad de los Andes, Bogotá.
Languages
Spanish: native language
English: fluent at written and spoken English
German: basic level
58
Publications
Guzmán-Ramírez N, Völler M, Wetterwald A, Germann M, Cross N, Rentsch C, Schalken J, Thalmann G,
Cecchini M. In vitro propagation and characterization of cancer stem/progenitor-like cells from human
prostate cancer tissue. The Prostate. 2009. In press.
Guzmán N, Espitia C, Delgado P, Echeverri D, Buitrago L, Jaramillo C . “Detection of Chlamydia
pneumoniae in Human Aortic Tissue: kdtA Gen Amplification and In vitro Hybridization”. Biomédica. 2005;
25:511-17.
Congresses and Awards
18th Meeting of the European Society for Urological Research. Barcelona. October 2008
Guzmán N, Wetterwald A, Thalmann G.T, Cecchini M.G. “Clonogenic and self-renewal capacity of human
prostate cancer cells in vitro”.
Awarded a travel grant.
The American Urological Association Annual meeting. Orlando. May, 2008.
Guzmán N, Wetterwald A, Thalmann G.T, Cecchini M.G. “Molecular characterization and expansion in vitro of
clonogenic human prostate cancer cells”.
Best of posters award.
European Association of Urology meeting. Milan. March, 2008
Guzmán N, Wetterwald A, Wilkens L, Thalmann G.T, Cecchini M.G. “Clonogenic potential in vitro and molecular
characterization of human prostate cancer cells”.
Oral presentation.
American Association of Cancer Research. Stem cells meeting. Los Angeles. February, 2008.
Guzmán N, Wetterwald A, Thalmann G.T, Cecchini M.G. “Molecular characterization of clonogenic and selfrenewing cells in prostate cancer”.
7th Word Basic Urological Research Congress, University College Dublin, Dublin. September, 2007
Guzmán N, Wetterwald A, Wilkens L, Thalmann G.T, Cecchini M.G. “Molecular Characterization and Expansion
in vitro of Clonogenic Human Prostate Cancer Cells”.
Oral presentation.
XXI Congreso de Cardiología y Cirugía Cardiovascular. Bogotá. August 2006
Montes F, Guzmán N, Buitrago L, Echeverri D. “Efecto Vasodilatador del Levosimendan sobre los Conductos
Arteriales Utilizados en Cirugía de Re-vascularización Coronaria”.
Best of posters award.
XVI Award Sanofi – Aventis Group. Bogotá 2005. November, 2005
Guzmán N, Buitrago L, Montes F, Echeverri D. “La presencia de Chlamydia pneumoniae es altamente frecuente
en enfermedades de aorta ascendente. Podría tener implicaciones fisiopatológicas?”
Award for medical investigation in basic and experimental sciences.
Research Projects Presentation Forum, Faculty of Sciences, Universidad de los Andes. October, 2005.
Guzmán N, Delgado P, Jaramillo C. “Chlamydia pneumoniae and Atherosclerosis: Detection and Distribution of
the Microorganism in Aortic Tissue with and without Atherosclerotic Lesion”,
59
Employment
August 2006 – September 2009
Urology Research Laboratory, Department of Clinical Research, University of Bern
Project: “Prostate cancer molecular-oriented detection and treatment of minimal residual disease” funded by the
European Sixth Framework Program in Life Science, genomics and biotechnology for health
PhD position
June 2005 – February 2006
Vascular Function Research Laboratory, Fundación Cardioinfantil – Instituto de Cardiología, Bogotá
Research assistant
January – December 2005
Molecular Diagnosis and Bioinformatics Laboratory, Faculty of Sciences, Universidad de los Andes
Research assistant
January – December 2005
Faculty of Sciences, Universidad de los Andes
Teacher of the Molecular Biology Laboratory course
January 2002 – December 2004
Faculty of Sciences, Universidad de los Andes
Teacher assistant
60